Water is found as a solid, liquid, and gas on ____.

Answers

Answer 1
If this question is about planets, Earth is your answer

Related Questions

What 2 factors do you need in order to calculate speed?

Answers

Answer:

Distance and time.

Explanation:

Speed=Distance/time

The two factors which we need in order to calculate the speed of an object are the distance covered by the object and the time taken to cover that distance.

What is Speed?

Speed is the rate of change of position of an object in any direction. Speed is a scalar quantity as it has only magnitude and no direction. It is measured as the ratio of the distance covered by an object to the time taken in which the distance was covered by that object.

Speed has the dimension of distance covered by the time taken. Thus, the SI unit of speed is the combination of the basic units of distance and the basic unit of Time. Thus, the SI unit of speed is meter per second (m/s).

Learn more about Speed here:

https://brainly.com/question/28224010

#SPJ6

A certain planet has a radius of 4990 km. If, on the surface of that planet, a 95.0 kg object has a weight of 591 N, then what is the mass of the planet?

Answers

Answer:

3743.489 kg

Explanation:

F_g = 591 N

G = 6.674x10^-11 constant of gravity

m_1 = 95 kg

m_2 = unknown

r = 4990*1000 =

F_g = G[(m_1*m_2)/r^2]

591 N = 6.674x10^-11[(95*m_2)/4990^2]

8.855 = [(95*m_2)/4990^2]

355631.472 = 95*m_2

m_2 = 3743.489 kg

The  mass of the planet, which has a radius of 4990 km, is  1.81×10²³kg.

What is Newton's law of universal gravitation ?

Newton's law of universal gravitation states that

The force of attraction between any two bodies is inversely proportional to the square of the distance between them and directly proportional to the product of their masses.

Given parameters:

Mass of the object: m = 95 kg

Radius of the planet: r = 4990 km = 4990 × 1000 m.

Weight f the object: F= 591 N

We know that: universal gravitational constant: G = 6.674x10^-11 SI unit.

We have to find: mass of the planet: M = ?

Now, F= GMm/r^2

591 N = 6.674x10^-11[(95×M)/(4990×1000)^2]

⇒ M =1.81×10²³kg

Hence, mass of the planet is  1.81×10²³kg.

Learn more about gravitational force here:

https://brainly.com/question/12528243

#SPJ5

Calculate the heat energy needed to change the temperature of 2 kg of copper from 10°C to 110°C.

If you could show your process and equations used, that would be very helpful! Thanks!

Answers

Answer:

77000 J

Explanation:

Formula for the heat energy is;

Q = m•c•Δt

We are given;

mass; m = 2 kg

Change in temperature; Δt = 110 - 10 = 100 °C

From online values, specific heat capacity of copper is; c = 385 J/kg.°C

Thus;

Q = 2 × 100 × 385

Q = 77000 J

Answer:

heat = 20 Kcal

Explanation:

What are the units for measuring specific heat?

a. degrees Celsius per gram
b. joules per degrees Celsius
c. joules per gram degree Celsius
d. degrees Celsius per joule gram

Answers

You answer should be C sorry if I’m wrong

Answer:

c. joules per gram degree Celsius

Explanation:

edg 2021

Marvin the Martian needs to get back home. Marvin is 321,770 m from his home on Mars. He decides the quickest way to get home is to use his canon to fire himself into flight. He aims the the canon at an angle of 25 degrees. When the canon is fired Marvin the Martian is launched into flight at an initial velocity of 1250 m/s. The question is will his plan work

Answers

Answer:

y = 14238 m.    the height of the rocket is much less than this distance therefore the plan will not work.

Explanation:

Let's analyze this exercise, so that the Martian's plan works, the vertical height of the body must be zero when it is more than half of the way to the planet Mars, this is so that Mars attracts it and can arrive.

Let's calculate the maximum height of the launch

          [tex]v_{y} ^2 = v_{oy}^2 - 2 g y[/tex]

at the highest point [tex]v_{y}[/tex] = 0

          y = v_{oy}² / 2g

          y = (v₀ sin θ)² / 2g

let's calculate

          y = (1250 sin 25)² /2 9.8

          y = 14238 m

In the exercise, indicate that the distance to Mars is h = 321770 m, half of this distance is

          h / 2 = 160885 m

therefore the height of the rocket is much less than this distance therefore the plan will not work.

The height reached is low, so it is not necessary to take into account the variation of g with height

write the difference between convert and
Concave minores​

Answers

A concave mirror is opaque whereas a concave lens is transparent. ... Difference between concave mirror and concave lens is A concave mirror is opaque whereas a concave lens is transparent. A concave mirror causes reflection of light whereas a concave lens causes refraction of light.

The wavelength of a particular color of yellow light is 579 nm. The energy of this wavelength of light is

Answers

Answer:

3.44× 10⁻¹⁹Joules

Explanation:

Energy of the wavelength is expressed using the formula:

E = hc/λ

h is the Planck constant

c is the velocity of light

λ is the wavelength

Given

h = 6.63 × 10^-34 m² kg / s

c = 3×10⁸ m/s

λ = 579nm = 579 × 10⁻⁹m

λ = 5.79× 10⁻⁷m

Substitute the given values into the formula

E = hc/λ

E = (6.63 × 10⁻³⁴× 3×10⁸)/5.79× 10⁻⁷

E = 19.89× 10⁻³⁴⁺⁸/5.79× 10⁻⁷

E = 19.89× 10⁻²⁶/5.79× 10⁻⁷

E = 3.44× 10⁻²⁶⁺⁷

E = 3.44× 10⁻¹⁹Joules

Hence the energy of this wavelength of light is 3.44× 10⁻¹⁹Joules

The device shows the relative humidity at 22°C. What’s the water vapor density if the maximum water vapor in air at this temperature is 20 grams/cubic meter?
A device showing that at 22 degrees Celsius the relative humidity is 58%.

Answers

Answer:

The answer would be 11.6 g/m^3

Explanation:

Knowing that vapor's density at 100% humidity is 20g/m^3 we can calculate the answer using the following math:

0.58 * 20 = 11.6 grams per cubic meter

the units can also be written as g/m^3

The density of water vapor is 11.6 grams/cubic meter.

What is relative humidity?

The quantity of atmospheric moisture that is present compared to the amount that would be there if the air were saturated is known as relative humidity, and it is stated as a percentage. Relative humidity depends on both moisture content and temperature because the latter quantity is temperature-dependent. The related temperature and dew point for the specified hour are used to calculate relative humidity. it is expresses as %.

Now given that the maximum water vapor in air at this temperature is 20 grams/cubic meter at 22°C, that is, density of vapor at 100% humidity is 20g/[tex]m^3[/tex]  at 22°C.

And, The device showing that at 22 degrees Celsius the relative humidity is 58%

So, water vapor density at that moment is = 20g/[tex]m^3[/tex] × 58%

= 11.6 g/[tex]m^3[/tex] .

= 11.6 grams/cubic meter.

Hence, according to the measurement of device, the water vapor density is 11.6 grams/cubic meter.

Learn more about relative humidity here:

https://brainly.com/question/22069910

#SPJ2

Find the height from which you would have to drop a ball so that it would have a speed of 7.4 m/s just before it hits the ground.

Answers

Answer:

s = 2.79 m

Explanation:

Given that,

A ball have a speed of 7.4 m/s just before it hits the ground.

Initial velocity of the ball was 0 (at rest)

We need to find the height from where the ball was dropped. It means we need to find the distance covered by it. Let it is h.

Using the third equation of motion to find it as follows :

[tex]v^2-u^2=2as\\\\s=\dfrac{v^2}{2g}\\\\s=\dfrac{(7.4)^2}{2\times 9.8}\\\\s=2.79\ m[/tex]

So, the ball is dropped from a height of 2.79 m.

The height from which you would have to drop a ball so that it would have a speed of 7.4 m/s just before it hits the ground is 2.79m

Equation of motions

According to the third equation of motion;

[tex]v^2=u^2+2as[/tex]

where;

v is the final velocity = 7.4m/s

Initial velocity = 0m/s

s is the distance

a = g= 9.8m/s²

Substitute the values into the formula to have:
[tex]7.4^2=0^2+2(9.8)s\\54.76 + 19.6s\\s=\frac{54.76}{19.6}\\ s=2.79m[/tex]

Hence the height from which you would have to drop a ball so that it would have a speed of 7.4 m/s just before it hits the ground is 2.79m

Learn more on equation of motion here: https://brainly.com/question/25951773

A horizontal force of 90.7 N is applied to a 40.5 kg crate on a rough, level surface. If the crate accelerates at 1.08 m/s, what is the magnitude of the force of kinetic friction (in N) acting on the crate?

Answers

Mhide,

if the mass of 60 kg is having an acceleration of 1.2 m/s², we have:

F = m . a

60 x 1.2 = 72 N

That is, the resultant force is 72 newtons.

If the applied force is 95 N, we come to the conclusion that 95 - f = 72

Or,

f = 23 newtons, or 23 N, of kinetic friction.

short essay your teacher have provided you​

Answers

I don’t understand....?

What type of telescope did Galileo use to observe Jupiter?

reflector telescope
refractor telescope
radio telescope
latter telescope

Answers

Answer:

a refractor telescope

Explanation:

Answer:

a. refractor telescope

A 47.5-g ball moves at 30.0 m/s. If its speed is measured to an accuracy of 0.20%, what is the minimum uncertainty in its position

Answers

Answer:

The minimum uncertainty in its position is 1.85 x 10⁻³² m.

Explanation:

Given;

mass of the ball, m = 47.5 g = 0.0475 kg

speed of the ball, v = 30 m/s

measuring accuracy of the speed, = 0.2% = 0.002

The uncertainty in measurement of momentum;

ΔP = mΔv

ΔP = (0.0475)(30 x 0.002)

ΔP = 2.85 x 10⁻³ kgm/s

The uncertainty in position is calculated as;

[tex]\delta x \geq \frac{h}{4\pi (\delta P)}[/tex]

where;

h is Planck's constant

[tex]\delta x \geq \frac{6.626 \ \times \ 10^{-34}}{4\pi (2.85 \ \times \ 10^{-3})} \\\\\delta x \geq 1.85 \ \times \ 10^{-32} \ m[/tex]

Thus, the minimum uncertainty in its position is 1.85 x 10⁻³² m.

Suppose that when spring was wound, 100J of work was done but 15J escaped to the surrounding as heat. The change in internal energy of the spring is? ​

Answers

Answer: 85J

Explanation:

From the question, we are informed that when spring was wound, 100J of work was done but 15J escaped to the surrounding as heat.

Therefore, the change in internal energy of the spring will be calculated as:

ΔU = q + w

where, q = -15J

w = 100J

ΔU = -15J + 100J

= 85J

Need help y’all ASAP please...physics

Answers

Answer:

t = 3/8 seconds

Explanation:

h=-16t^2 - 10t+6

h= 0 when it hits the ground

0=-16t^2 - 10t+6

factor out a -2

0= -2(8t^2 +5t -3)

divide by -2

0 = (8t^2 +5t -3)

factor

0=(8t-3) (t+1)

using the zero product property

8t-3 = 0    t+1 =0

8t = 3         t= -1

t = 3/8     t= -1

t cannot be negative  ( no negative time)

t = 3/8 seconds

Use the graph and the table above to complete the table by estimating the amount of energy transferred near location B.

A.
1600 kilojoules

B.
300 kilojoules

C.
800 kilojoules

D.
400 kilojoules

E.
3200 kilojoules

Answers

Answer:

A. 1600 kilojoules

Explanation:

Looking at the graph, at 4 meters, we can guess the energy transferred would be around 1500 kilojoules. 1600 kilojoules is the closest to that value, so A would be the best choice.

A construction laborer holds a 20 kg sheet of wallboard 3 m above the floor for 4 seconds. During these 4 seconds how much power was expended on the wallboard

Answers

Answer:

zero

Explanation:

no distance has moved while holding the sheet...so no distance means no workdone..no workdone means no power...

Economics these two PLEASE

Answers

Answer:

7. d. England during the Age of Enlightenment

8. a. State governments do not usually act together

Explanation:

The Age of Enlightenment occurred in the 18th century and at this time England was a Constitutional monarchy with a monarch and parliament ruling the country with different powers.

The third and fourth methods of amending the Constitution will be much harder to use because state governments simply do not usually act together as they most times have ideological differences. The sheer number of states it would take to unite for these methods to be used makes this impractical.

if humans have some animal blood sails why do we walk on 2 feet

Answers

not all animals walk on four legs, not all animals even have legs. whales have flippers, centipedes have a hundred legs, kangaroos have two legs, cats have four. it varies depending on the creature because we are built to do different things. if a bird didn’t have wings it couldn’t fly, if a shark didn’t have its fins it wouldn’t be able to swim. just because humans are technically an animal does not mean we are exactly like other animals.

A boat is drifting to the right with a speed of 5.0 m/s when the driver turns on the motor. The motor runs for 6.0 seconds causing a constant leftward acceleration of magnitude 4.0 m/s squared. What is the displacement of the boat over the 6.0 second time interval?

Answers

Answer:

[tex]D= -0.42km[/tex]

Explanation:

From the question we are told that

Drifting right with speed 5.0m/s

The motor runs for 6.0 seconds

Leftward acceleration of magnitude 4.0 m/s squared

Generally the equation [tex]V=ut+1/2at^2[/tex] can be used here

[tex]V=ut+1/2at^2[/tex]

Mathematically solving with the newton equation above we have that

   [tex]D=5*6 + \frac{1}{2} (-4)*6^2[/tex]

   [tex]D=30-72[/tex]

   [tex]D=-42m[/tex] [tex]or -0.42km[/tex]

Therefore having this the Displacement is [tex]D= -0.42km[/tex] leftward

Three displacements are A = 200 m due south, B %3D 0 m due west, and C = 150 m at 30.0° cast of north. %3D Construct a separate diagram for each of the following possible ways of adding these vectors: R = A +B - č, Explain what R = B + C + A; R =C + B + A %3D you can conclude from comparing the diagrams.

Answers

Answer:

a) The diagrams can be seen in the picture attached

(b) By comparing the diagrams we can conclude that the resultant R₁ = R₂ = R₃

Further explanation

Vector is quantity that has magnitude and direction.

One example of a vector is acceleration.

Acceleration is rate of change of velocity.

a = acceleration ( m/s² )

v = final velocity ( m/s )

u = initial velocity ( m/s )

t = time taken ( s )

d = distance ( m )

Let us now tackle the problem !

This problem is about Vector and Vector Diagram.

Given:

Vector A = -200 j

Vector B = -250 i

Vector C = (150 sin 30.0°) i + (150 cos 30.0°) j = 75 i + 75√3 j

Unknown:

R₁ = A + B + C = ?

R₂ = B + C + A = ?

R₃ = C + B + A = ?

Solution:

R₁ = A + B + C  = (-200 j) + (-250 i) + (75 i + 75√3 j)

R₁ = -175i + (75√3 - 200)j

R₂ = B + C + A = (-250 i) + (75 i + 75√3 j) + (-200 j)

R₂ = -175i + (75√3 - 200)j

R₃ = C + B + A  = (75 i + 75√3 j) + (-250 i) + (-200 j)

R₃ = -175i + (75√3 - 200)j

From the results above, it can be concluded that the resultants above produce the same results. This can be confirmed from the diagrams in the attachment.

Explanation:

List two examples of how the land can have a dramatic change in temperature throughout the day.

Answers

Answer:

one could freeze and the second would thaw

Explanation:

sorry if its wrong

The two examples of how land can have a dramatic change in temperature

is during freezing and thawing.

Cold temperatures which is common during the winter period is

characterized by the formation of snow and freezing of smaller water

bodies.

There may be a short phase in which there is relative sunlight which melts

the frozen substances thereby forming liquids . This is usually as result of

the temperature being on the increase in the atmosphere.

Read more on https://brainly.com/question/25671319

14. After finishing her homework, Sue climbs up a 5.00 m high flight of stairs to her bedroom
Find the magnitude of Sue's weight
and how much
work Sue does in climbing the stairs if she
has a mass of 50.0 kg? (4.90 x 2 N, 2450J)

Answers

Explanation:

Given parameters:

Height  = 5m

Mass of Sue  = 50kg

Unknown:

Magnitude of Sue's weight  = ?

Work done by Sue = ?

Solution:

Weight is the vertical force exerted by a body in the presence of gravity.

Mathematically;

        W = mg

m is the mass

g is the acceleration due to gravity  = 9.8m/s²

  Weight  = 50 x 9.8  = 490N

Work done  = Force x distance = weight x height

 Work done  = 490 x 5 = 2450J

HELP ASAP!
Everything on screenshot!

Answers

This is a divergent plate boundary because the two tectonic plates are colliding together.

1. A 75.0 kg man pushes on a 500,000kg wall for 250s but it does not move. How
much work does he do on the wall?

Answers

Answer:

0J

Explanation:

No work is being done on the wall by the man pushing on it.

 Given parameters:

Mass of man  = 75kg

Mass of wall  = 500000kg

Time  = 250s

Unknown:

Work done  = ?

Solution:

Work done is the force applied on a body that moves it along a particular path.

For work to be done, distance must be move or displacement must occur.

Since the wall is not moving the distance is 0;

    Work done  = Force x distance

Since distance is 0m, work done is 0J

The work done on the wall by the man is 0 J.

To calculate the amount of work done by the man, we use the formula below.

Formula:

W = (ma)d............. Equation 1

Where:

W = Work done on the wall by the manm = mass of the walla = acceleration of the walld = distance.

from the question,

Given:

m = 500000 kga = 0 m/s² (not moving)d = 0 m.

Substitute these values into equation 1

W = 500000(0)(0)W = 0 J.

Hence, the work done on the wall by the man is 0 J.

Learn more about work done here: https://brainly.com/question/8119756

A student is creating an electromagnet for an investigation. Which feature of the electromagnet will least influence the magnetic force?
A
the material of the core
B
the brand of the battery
С
the number of wire coils
D
the che of the power source

Answers

C the number of wire coils

An automobile which set the world record for acceleration increase speed from rest to 96 km/h in 3.07 seconds what distance traveled by the time the final speed was achieved

Answers

Answer:

41.02m

Explanation:

Given parameters:

Initial velocity = 0m/s

Final velocity  = 96km/hr

Time taken  = 3.07s

Unknown:

Distance traveled by the time the final speed was achieved = ?

Solution:

To solve this problem, we first find the acceleration of the car;

     Acceleration  = [tex]\frac{v - u }{t}[/tex]

v is the final velocity

u is the initial velocity

t is the time taken

  Now convert the the final velocity to m/s;

          96km/hr to m/s;

               1 km/hr  = 0.278m/s

               96km/hr  = 96 x 0.278 = 26.7m/s

Now;

 Acceleration  = [tex]\frac{26.7 - 0}{3.07}[/tex]   = 8.69m/s²

So;

   v²  = u²  + 2as

v is the final velocity

u is the initial velocity

a is the acceleration

s is the distance

             26.7²  = 0²  + 2 x 8.69 x s

             712.89  = 17.38s

                  s  = 41.02m

a suspension bridge cable is connected to its anchor at a 20 degree angle. calculate the vertical component force on the anchor by the cable. ​

Answers

The question is missing some parts. Here is the complete question.

A suspension bridge cable is connected to its anchor at a 20° angle. Find the vertical and horizontal component of the force on the anchor by the cable.

Answer: [tex]F_{x}=[/tex] 14095.4 N

              [tex]F_{y}=[/tex] 5130.3 N

Explanation: The force applied to the anchor is not perpendicular to the horizontal plane. So, it can be decomposed into 2 components: a vertical component, which is on the y-axis, and a horizontal component, which is on the x-axis.

The force and its components forms a right triangle, so we can calculate the components by using trigonometric relations:

Horizontal

[tex]cos(20)=\frac{F_{x}}{F}[/tex]

[tex]F_{x}=F.cos(20)[/tex]

[tex]F_{x}=15,000(0.9397)[/tex]

[tex]F_{x}=[/tex] 14,095.4 N

Vertical

[tex]sin(20)=\frac{F_{y}}{F}[/tex]

[tex]F_{y}=Fsin(20)[/tex]

[tex]F_{y}=[/tex] 15,000(0.3420)

[tex]F_{y}=[/tex] 5,130.3 N

The vertical and horizontal components of force on the anchor by the cable are 5130.3 N and 14095.4 N, respectively.

Help Help!

You can experience loss of coordination with a BAC as low as 0.02 -0.03.
A. True
B. False

Answers

True because you are trouxa
True because I got it right but yeah

Q2. You push a crate up a ramp with a force of 10 N. Despite your pushing, the crate slides down the ramp 4 m. How much work did you do

Answers

Answer:

40 J

Explanation:

From the question given above, the following data were obtained:

Force (F) = 10 N

Distance (s) = 4 m

Workdone (Wd) =?

Work done is simply defined as the product of force and distance moved in the direction of the force. Mathematically, we can express the Workdone as:

Workdone = force × distance

Wd = F × s

With the above formula, we can obtain the workdone as follow:

Force (F) = 10 N

Distance (s) = 4 m

Workdone (Wd) =?

Wd = F × s

Wd = 10 × 4

Wd = 40 J

Thus, 40 J of work was done.

Other Questions
Why is it a positive thing when the LV (left ventricle) hypertrophies with exercise? Where is Europe located in relation to the United States? What about the location of New York state makes it a good location for trade between the United States and Europe? a similarity or agreement Answer please I need this quick !!!! Please help! I will give thanks and brainliest if possible! At Breakfast Break, 2 eggs and 1 sausage patty cost $2.23 and 3 eggs with 2 sausage patties cost $3.76. Assuming that these amounts only pay for the eggs and sausage, how much does one sausage patty cost? a pulley is used to lift a 2000 N safe over frosty's head. the safe is lifted 6m in 4s by Rudolph. how much power did Rudolph use? what does hi mean in spanish -8t = 64Answer:t = ?Answer the ? Mark pls How did technology contribute to the expansion of European power through imperialism? Hey guys can one of you help me pls its only one small question The plugin that changes Jenkins to use green balls instead of blue for successful builds is ________. Decide whether the pronunciation is correct or incorrect. Drag and drop the word into the correct column.encourage en-KUR-Correct PronunciationIncorrect Pronunciationexplain ik-SPLAYNjustity JUHS-tun-tahyplayful PRET-tuhmspecial SLISP-uhtheroic hi-ray-IT An architect draws a plan for a wheelchair ramp on the plan, the ramp is 2cm high and 24cm long what might the dimensions of the actual ramp be (use equivalent ratios) slope of 2,11 and 5,2 Hey guys please help!! What is the definition of fourteen points? breakout edu keyla winter wonderland questioni CAN'T DO THIS I've tried so many times how do you do it What became of most of the Central powers colonies after World War I? They became independent nations. They remained colonies of Central Powers nations. They became League of Nations mandates. They were run by the League of Nations. TACTTAGAGGCACCACATGGGCCTTGCACT to mRNA