Vanessa does 50 minutes of yoga two times a week. She always puts a lot of effort into yoga. Which part of the FITT Principle should she increase to get the full benefits of yoga? frequency B intensity C D ttype
Help pleasee i have 5 mins

Answers

Answer 1

Answer:

C TYPE I THINK

Explanation: HURRY!!!!


Related Questions

How can malnutrition affect a person?

Answers

malnutrition can make it more difficult to stay warm due to lack of muscle and tissue mass. it can also increase the time it takes to recover from infection and injury. A major effect is severe weight loss which is often rapidly unhealthy.

Answer:

i would know this because i was malnourished at one point you cant move around a lot and you tiered easily

Unlike when applying for work in other careers dealing with the digestive system, before applying to work in any state, a doctor must first receive
an associate’s degree.
licensing.
training.
a bachelor’s degree.

Answers

Training degree then a bachelors degree

Answer:

Licensing

Explanation:

EDGE 2021

A gas that the lungs take from the air for the body to use is:
O waste.
O carbon dioxide.
O oxygen.
water.

Answers

Answer: carbon dioxide

Explanation:

This question is referring to the function of the respiratory system in the body and the lungs with the respiratory system are allowing us to breathe.

The lungs are bringing at first oxygen into our body and that process is called inspiration or also inhalation. They are sending carbon dioxide out which is a process that is called exhalation or also expiration.

This is the exchange that is happening in our body and with that exchange of oxygen and carbon dioxide, it is called respiration.

Answer:c

Explanation:

The Answer is C:oxygen

Chose the best pre-workout meal option from the three provided:
Ravioli with meat sauce, Italian bread, steamed vegetables, salad, canned fruit, low fat/non-fat milk
White bean chili, salad, cornbread, chocolate cake, carbonated soda
O Ham sandwich on French bread, potato chips, apple, peanut butter cookie, sports drink
ANSWER ASAP

Answers

A) Ravioli, bread, veggies, salad, fruity, milk

The best pre-workout meal option from the three provided are Ravioli, bread, veggies, salad, fruity, and milk. The correct option is A.

What is a pre-workout meal?

A well-balanced pre-workout meal will provide your body with everything it requires for peak performance. Your body transforms glycogen into glucose while you work out.

This is essential for muscle contraction. You can reduce muscle glycogen depletion by providing your body with the proper pre-training diet.

Fiber is something that helps your bowels stay healthy; in other words, it helps you go to the bathroom (a very important vitamin, but not a good choice for a workout). Something high in calories and protein is an excellent pre-exercise choice to keep your muscles robust during your workout.

Therefore, the correct option is A, Ravioli, bread, veggies, salad, fruity, and milk.

To learn more about the pre-workout meals, refer to the link:

https://brainly.com/question/22742248

#SPJ2

Harvey has been having small amounts of blood in his urine and intense waves of pain in his back and abdomen. What urinary disease or disorder do these symptoms suggest?
kidney stones
interstitial cystitis
urinary incontinence
urinary tract infection

Answers

The urinary disease and/or disorder that these symptoms may suggest is kidney stones.

What are kidney stones?

The expression 'kidney stones' make reference to the accumulation of minerals in the kidneys.

This condition (kidney stones) may lead to serious health complications and must be treated immediately.

In conclusion, the urinary disease and/or disorder that these symptoms suggest is kidney stones.

Learn more about kidney stones here:

https://brainly.com/question/26697997

#SPJ1

Answer:

The answer is urinary tract infection. It is the only disease or disorder in this list that has a symptom of bloody urine.

Explanation:

Identify the systolic and diastolic ranges for stage 1 hypertension.

Answers

Answer:

The systolic pressure is 140 to 159 mm Hg or your diastolic pressure is 90 to 99 mm Hg

Asher is a 10-year-old. Her mom diets off and on. How can this affect Asher and her eating habits?

Answers

Answer: This can affect Asher by thinking that she might need a diet and that might cause an eating disorder. This eating disorder can lead to more mental disorders. She could also have a low self esteem What can also happen is she could learn healthy habits that will useful to her in the future.

Explanation:

What if you misdiagnose a patient?

Answers

You can get sued for a lot of money and you may lose your job

what happens if i eat 84 flintstones gummies cuz i did

Answers

Your poop is going to be massive

Answer:

84 must be the limit

Explanation:

which statement defining a pathogen is true?
A. bacteria are pathogens that multiply rapidly in slightly acidic conditions.
B.mold are pathogens that produce toxins that can cause illness.
C. fungi are pathogens that need a living host to thrive and grow.
D. all pathogens grow rapid in foods with high moisture content.
E. all pathogens are invisible unless viewed under a microscope.​

Answers

Answer:

D is the answer as all others show properties of other fungi or bacteria

question 23. the way one deals with an uncomfortable or unbearable feeling or situation is called _____.

A. denial

B. anger managment

C. risk factor

D. coping strategies​

Answers

Answer:

The answer would be D.

Explanation:

Coping Strategies are a way of dealing with an uncomfortable or unbearable feeling or situation. A defense mechanism. And a coping strategy helps protect a person from difficult feelings.

I hope this helps!

On an average day, 80% of youth consume a sugary
drink.

Answers

Answer:

Dang I didn't know that!!!!

Explanation:

List and briefly describe the three ways that your body composition can affect your fitness

Answers

Answer: Physical activity and exercise are other crucial components for improving body composition. They not only increase the calories you use, but they are also necessary for optimal muscle growth. Since body composition can be improved by decreasing fat mass or increasing muscle mass, this is an important point.

Explanation:

When genes interact with the environment to produce observable characteristics, this is considered the ________________ of an organism.
A. Phenotype
B. Mutation
C. Genotype
D. Allele

Answers

Answer:

A

Explanation:

The term "phenotype" refers to the observable physical properties of an organism; these include the organism's appearance, development, and behavior. An organism's phenotype is determined by its genotype, which is the set of genes the organism carries, as well as by environmental influences upon these genes.

which organ circulates blood throughout the entire body?

Answers

The blood circulatory system (cardiovascular system) delivers nutrients and oxygen to all cells in the body. It consists of the heart and the blood vessels running through the entire body. The arteries carry blood away from the heart; the veins carry it back to the heart.

Compare and contrast the behaviors that are characteristic of anorexia nervosa, bulimia nervosa, and
binge-eating disorder.

Answers

The main difference between diagnoses is that anorexia nervosa is a syndrome of self-starvation involving significant weight loss of 15 percent or more of ideal body weight, whereas patients with bulimia nervosa are, by definition, at normal weight or above.

WHY is self-help care and coping strategies important to utilize in your mental/emotional health triangle?

Answers

Explanation:

It affects how we think, feel, and act as we cope with life. It also helps determine how we handle stress, relate to others, and make choices. Mental health is important at every stage of life, from childhood and adolescence through adulthood and aging.self-help makes you mentally, physically and emotionally strong for that to look for yourself for future grievances or unwanted events it helps you to care and protect your mentallity.

It affects how we think, feel, and act as we cope with life. It also helps determine how we handle stress, relate to others, and make choices. Mental health is important at every stage of life, from childhood and adolescence through adulthood and aging.

Which is an element of critical thinking?

A.
sharing decision making
B.
delegating responsibility
C.
drawing conclusions
D.
eliminating alternatives

Answers

Answer:

D.

eliminating alternatives

Explanation:

Pretty sure it's D, because decision making and analysis are elements of critical thinking and that's attached to eliminating alternatives.

Answer:

C. Drawing Conclusions

Explanation:

It's the only thing that truly makes sense. Plus the first answer was wrong on edmentum so I redid the test and it's correct. TRUST ME.

Losing weight slowly is the healthiest way.

True

False

Answers

Answer:

True

Explanation:

Answer:

True

Explanation:

When an organism reproduces asexually, the offspring are _____A_____ _____B_____ to the parent.

Answers

Answer:

a part of the parent

Explanation:

A part of the parent

Jim wants to start competitive bicycling. In order to do this he has created a list of skills he will need to improve which skill should get the most of his attention in order for him to excel at competitive bicycling?

●Agility
●Balance
●Power
●Coordination ​

Answers

Answer:

Balance

Explanation:

If you don't have balance you cant even stay up on the bike.

Ecstasy, LSD, and PCP are all examples of opiate drugs

Answers

Answer:

Yes they are

Hope this Helpes : )

Explanation:

Why is it important not to let bullying continue for years without being effectively addressed?

Answers

Answer:

Someone is feeling hopeless, helpless, thinking of killing them self  sometimes  or

Someone is acting differently than normal, such as always seeming sad or anxious, struggling to complete tasks, or not being able care for themselves.

Excessive bullying can lead to degradation of mental health and excessive stress down the road. This can lead to further problems as well such as substance abuse. So in effect, it's like a possible chain reaction that could occur if the problem isn't dealt with right away. Plus, not addressing the issue just encourages the bully to keep going and possibly target others.

Can somebody read this and tell me your opinion on my paper before I submit it? Please.

Answers

Answer:

Really good but just add a little more detail.

Explanation:

There are four stages in the healing of a bone fracture. Which of the
following best illustrates the sequence of these stages: 1. bony callus
formation 2. bone remodeling 3. fibrocartilage callus formation 4.
hematoma formation
0 4,3,1,2
1,3,4,2
1,3,2,4
4,3,2,1
1,2,3,4

Answers

Answer:

4,3,1,2

Explanation:

The first stage is the bodies reaction to injury. The hematoma formation stops internal bleeding from the broken blood vessels of the fractured/broken bone.  

The fibrocartilage callus formation helps maintain the bones original form, helping in the overall healing process.

The bony callus is the hardening of the cartilage callus, and the final form remodels the bone to be as closely recovered as its original form

Which of these is an appropite treatment for a deep, open wound

Answers

Answer:

Antibiotics

Explanation:

This penalty in ice hockey is imposed when an offense is made by a team or when the actual offender is unknown.
A. bench minor penalty
B. major penalty
C. misconduct penalty
D. minor penalty
Substitution of the entire team at once is called a _________.
A. power play
B. takeover squad
C. team reverse
D. line change

Answers

Answer:

A. Bench Minor Penalty

D. Line Change

Explanation:

I majored in Health

4. There are six important things to keep in mind on your fitness journey. Please list and
define at least four of the things we should remember.

Answers

Consistency is key: In order to achieve your results, you have to maintain consistency for a long period of time.

Trust the process: If you don't believe in the process then the changes you may want to see could potentially not occur.

Don't play the comparison game: If you compare yourself with others, your body will feel down because you may feel that it is impossible to become like others however, you always need to keep in mind that each and every body is different and we all need to do different things to maintain our bodies. We can't always have the perfect body but in order to improve it, you can do various things.

Celebrate small victories and milestones: celebrating small goals is important because it gives you the initial surge of motivation and determination to continue your journey further in order to establish better results.

I hope this can help :)

What is the HIPAA Security Rule?.

A. It outlines standards for sharing health information verbally.
B. It outlines standards for storing and sharing paper files safely and
C. It outlines standards for allowing patients to view their health
OD. It outlines standards for storing and sharing electronic health
securely.
information.
information in a safe and secure manner.

Answers

Imma say D is the answer

Answer: It outlines standards for storing and sharing electronic health

information  in a safe and secure manner.

Explanation: a  p  e  x

Why "A big no to drug"?Explain in your own words.​

Answers

Answer:

Drugs are chemicals that affect the body and brain. Different drugs can have different effects.

Drug use can hurt the body and the brain, sometimes forever.Drug use can hurt the people who take drugs and the people around them. This includes families, kids, and unborn babies.Drug use can also lead to an addiction. An addiction is a long-lasting brain disorder. People with an addiction can't stop taking drugs on their own. They continue to use drugs even when they know that bad things can happen.

Other Questions
The wildflowers began blooming by my house at the beginning of March. The first week there were 72 blooms. After week two, there were 144 flowers in bloom. If the flowers continue to bloom at the same rate each week, how many flowers will there be after 7 weeks? Which of the following Indian commodities was essential to European diet, and a big lure of European action in the Indian Ocean basin A - Pepper B - Salt C- Paprika D - Corn Which graph shows the system of equations{2x+3y=5 4x5y=1 Solve the equation:8n8=72Select one:n=20n=2n=8n=17 anong mga salita ang maiugnay sa salitang plano 5c times 3c squared to the third power A similarity between Woodrow Wilson and Theodore Roosevelt was that bothO believed monopolies were bad for the country.O kept the United States out of foreign wars.O were candidates for two different parties.O were strong champions for the environment Select the sentence that contains a noun clause. BRAINLIST Leah spent three times the amount Damean spent on CDs. Damean spent $33.87. How much did Leah spend on CDs? 6 is 16% of what number? Choose one of the three themes (social oppression, greed, or good vs. Evil) and explain something you know about it in the real world OR explain where else you have seen the theme (a book, movie, show, etc.) Please help quick A 12,000-gallon pool is being filled at a rate of 40 gallons per minute. At this rate, how many minutes will it take to fill the pool 3/4 full? Explain the role that Benjamin Franklin played during the American Revolution.. After the government ordered the removal of all American Indians from Illinois, a. Black Hawk attacked a militia led by Isaiah Stillman. b. the Sauk fought until they ran out of supplies. c. Black Hawks followers killed three delegates of a peace convention sent under a white flag to Saukenuk. d. Sauk forces attacked U.S. troops as they attempted to retreat across a river. Read this excerpt from the Supreme Court's Hazelwood v. Kuhlmeier dissenting opinion: The state educator's undeniable, and undeniably vital, mandate to [teach] moral and political values is not a general warrant to act as "thought police" stifling discussion of all but state-approved topics. . . . Official censorship of student speech on the ground that it addresses "potentially sensitive topics" is . . . impermissible.4 The reasoning in this opinion is most similar to the reasoning in which other Supreme Court ruling? A. New Jersey v. T.L.O. B. Miranda v. Arizona C. Gideon v. Wainwright D. Tinker v. Des Moines 1. Many plants can reproduce asexually. How is this an advantage for the plant? Why can it sometimes be a disadvantagefor the plant? Use details to support your answer. PLS ANSWER ASAP. ILL GIVE BRAINLIEST! Match the system for each of the following bodily organs.1.Nose a. Skeletal System2.Skull b. Circulatory System3.Kidneys c. Urinary System4.Veins d. Respiratory System Fill in the blank with the appropriate preposition.Paris est _____________ New York.a.) prs deb.) loin dec.) surd.) dans plz help timed MATHHHH 12 pointes Use the restriction enzyme EcoRi to cut DNAVictim DNA :GGAAG ATTCTACATTACTGACGGACGTGACGTGACCTTCTTAA GATGTAATGACTGCCTGCACTGACTNumber of restriction fragments ( pieces of DNA after digestion) :Size of restriction fragments ( count the number of bases on the top strand of each fragment , listed from largest to smallest ) :Suspect 1 DNA :GGAATTAAGCTTATTG AATTCTTATAG AATTCGGGGCCCAAGCTTATG AATTCAATT CCTTAATTCGAATAACTTAA GAATATCTTAA GCCCCGGGTTCGAATACTTAA GTTAANumber of restriction fragments ( pieces of DNA after digestion) :Size of restriction fragments ( count the number of bases on the top strand of each fragment , listed from largest to smallest ) :Suspect 2 DNA :CCATATAG AATTCAAGCTTAAG AATTCGGGGGAACGTTG AATTCAATTAATTGGGGGTATATCTTAA GTTCGAATTCTTAA GCCCCCTTGCAACTTAA GTTAATTAACCCNumber of restriction fragments ( pieces of DNA after digestion) :Size of restriction fragments ( count the number of bases on the top strand of each fragment , listed from largest to smallest ) :PLEASE HELPPP!!!!I WOULD APPRECIATE A LOT :)