Medicine High School

Use the drop-down menus to select the best
answers.
Some myocardial infarctions involve erratic heart
behavior, such as

1.creating more carbon dioxide.
2.missing beats.
3.producing more oxygen.
4.pumping more blood.

PLEASE HURRY

Answers

Answer 1
number two! good luck!
Answer 2

Answer:

Explanation:

the second part is cardiac arrest

Related Questions

What is the healthy percentage of body fat for men?

Answers

Answer:

The answer would be 18-24%.

Explanation:

The amount of essential fat differs between men and women, and is typically around 2-5% in men, and 10-13% in women. The healthy range of body fat for men is typically defined as 8-19%, while the healthy range for women is 21-33%.

How do blood types react in a transfusión ?

Answers

Answer:

person with type A blood receiving a transfusion of type B or AB blood would have an ABO incompatibility reaction. In an ABO incompatibility reaction, your immune system attacks the new blood cells and destroys them. If you have type AB blood, you have both A and B antigens.

Explanation:

person with type A blood receiving a transfusion of type B or AB blood would have an ABO incompatibility reaction. In an ABO incompatibility reaction, your immune system attacks the new blood cells and destroys them. If you have type AB blood, you have both A and B antigens.

What is the cause of the Carona Virus?
Or is the cause unknown.

Answers

The reason we have the Corona Virus is because some huh decided to eat a bat for some reason.

Answer:

Hi. Im just taking these points.

Explanation:

Which represents the order of increasing educational levels?
professional –assistant-technologist-technician
technologist –assistant-professional-technician
technician –professional-technologist-assistant
assistant –technician-technologist-professional

Answers

the fourth one is correct
The answer is D!!!!!!!!

Use the restriction enzyme EcoRi to cut DNAVictim DNA :
GGAAG ATTCTACATTACTGACGGACGTGACGTGA
CCTTCTTAA GATGTAATGACTGCCTGCACTGACT
Number of restriction fragments ( pieces of DNA after digestion) :
Size of restriction fragments ( count the number of bases on the top strand of each fragment , listed from largest to smallest ) :

Suspect 1 DNA :
GGAATTAAGCTTATTG AATTCTTATAG AATTCGGGGCCCAAGCTTATG AATTCAATT CCTTAATTCGAATAACTTAA GAATATCTTAA GCCCCGGGTTCGAATACTTAA GTTAA
Number of restriction fragments ( pieces of DNA after digestion) :
Size of restriction fragments ( count the number of bases on the top strand of each fragment , listed from largest to smallest ) :

Suspect 2 DNA :
CCATATAG AATTCAAGCTTAAG AATTCGGGGGAACGTTG AATTCAATTAATTGGG
GGTATATCTTAA GTTCGAATTCTTAA GCCCCCTTGCAACTTAA GTTAATTAACCC
Number of restriction fragments ( pieces of DNA after digestion) :
Size of restriction fragments ( count the number of bases on the top strand of each fragment , listed from largest to smallest ) :


PLEASE HELPPP!!!!
I WOULD APPRECIATE A LOT :)

Answers

Answer:

i put an answer but someone deleted it

Explanation:

The main idea behind Maslow’s hierarchy of needs is that
the most important needs must be met before the less important human needs can be met.
all needs are equally important and must be met simultaneously to achieve full health and success.
there are a few less important needs that must be met before the many important needs can be met.
all needs are equally important and their ability to be met can vary in timing.

Answers

first one fits best!

Answer:

It is A!!!!

Explanation:

Going about her cleaning routine as usual, Jayla sprays an aerosol bleach cleanser in her bathroom and then leaves to let it air out before she scrubs it down. Only two or three minutes later, she notices her cat, Grimaldi, fleeing the bathroom, coughing. Jayla hadn’t realized that Grimaldi was in the bathroom when she sprayed the chemical, so she rushes over to check on him. He seems to be wheezing and shaking a bit. Calling the vet, he asks Jayla to explain how Grimaldi was exposed to the chemical. Hearing Jayla’s explanation, which method of poisoning will the vet MOST likely assume Grimaldi is dealing with?

ingested poison

absorbed poison

injected poison

inhaled poison

Answers

Answer:

inhaled poison

Explanation:

Grimaldi was inside the bathroom when Jayla sprayed the aerosol bleach cleanser. The molecules of this cleanser spread quickly through the surroundings. Since the cat was inside the bathroom, it could have inhaled the bleach and the poison reached its lungs. This caused symptoms of wheezing, which is respiratory in nature, and shaking (seizures). Inhaling a poison leads to difficult in breathing among animals because it can cause the lungs to be inflamed.

Inhaled. This one was easy!

HELP PLEASE
Which would bring out the details in a tire track in mud?
A)casting an impression with dental stone
B)burning magnesium ribbon
C)casting an impression with putty
D)photography with direct lighting

Answers

i believe the answer is D. it seems like the most reasonable one

The correct option is D) photography with direct lighting because it clearly shows the path and details of the tiretrack.

Tire marks can be seen on snow, mud, soil, sand, and even victims of crime scenes. These traces can be collected by photographing, pouring, lifting, and collecting the victim's clothing.

What is evidence of the pattern?

Tire marks are classified as evidence of the pattern, as tire marks leave a unique pattern. Just as shoe marks help narrow down brands, styles and sizes so can tire trucks.

Thus it clearly concludes that photography with direct lighting can collect great evidence.

To know more about tire track evidence refer to the link :

https://brainly.com/question/13397634

Other Questions
ou've just taken on a new client, a small business owner, who was managing their books with spreadsheets. What's the recommended first step to begin working with this client in QuickBooks Online? True or FalseA short growing season made cotton difficult to grow. simplify (y) help me plz I'm noy good at maths What single percentage change is equivalent to a 7% increase followed by a 22% increase? When adjusting hue and saturation in an image during the editing process of photography, saturation refers to __________ . athe relative shade of colors ba "wet-look" filter cthe pixel differentiation filter dthe overall strength of colors Which number represents the BASE?42=16A. 4B. 2C. 16 help me please! thanks:) c+6 Convert 4.5 x 10-3 to standard NotationPosted today at 6:30 am1= Is Homework Good or bad????? This is a question I have been wondering about ever since I got into 3rd grade. Cell phones and the internet have both had the effect ofA) reducing poverty and malnutrition B) reducing trade barriers between nationsC) improving medical technology in developing countriesD) making the worlds a "smaller" place by increasing communications speeds A cable company charges 150 to install equipment. Then there is a $50 charge each month. Write an equation to express this relationship please help me with math ;-; QUESTION 6 of 10: Your staff consists of 7 cashiers, 3 stockers, and 5 salespeople. The cashiers are paid $12 per hour;paid $10 per hour; the salespeople are paid $15 per hour. What is the average hourly wage across all your workers? During a period of drought, members of a community may volunteer to water their lawns every other day, rather than daily. The most important benefit of this action is - It adds nitrogen to the soil It fertilizes the soil It reduces air pollution It conserves the groundwater supply select the three objectives mosquitoes hovered around the small puddle of still murky water in the background Which statement is true about fat loss?Most people with too much fat have glandular problems.Exercise does not help you lose fat because it increases your hunger and encourages you to overeat.You can spot-reduce fat by exercising a specific body part to lose fat in that area.Engaging in regular physical activity, including muscle fitness activity, will help you lose fat. Pls help ASAP its math the table shows the number of gold metals won by united states athletes during the summer olympics Write 6 wholes and 2 tenths as a decimal.