Transport truck carries stereo computer and television parts
. The mass of the truck and the parts is 28 t
. The mass of the empty truck is 6 t
. The mass of the computer parts is 2 t less than the mass of television parts
. The mass of stereo parts double the mass of television parts

What is the mass of each type of parts?

Answers

Answer 1

The mass of television is 6t, the mass of computer is 4t and the mass of stereo is 12t.

We have to determine the mass of each type of parts.

A transport truck transports television, computer, and stereo components

1. The mass of the truck and the parts is 28t.

2. The mass of the empty truck is 6t.

3. The mass of the computer parts is 2t less than the mass of television parts.

4. The mass of stereo parts double the mass of television parts.

truck = 6t

part = stereo + television + computer

computer = television - 2t

stereo = television × 2

truck + parts = 28t

part = 28t - 6t

part = 22t

part = computer + television + stereo

part = television - 2t + television + television × 2

part = 4 × television - 2t

22t = 4 × television - 2t

4 × television = 24t

television = 6t

computer = 6t -2t = 4t

stereo = 6t × 2 = 12t

television = 6t

computer =4t

stereo = 12t

To learn more about mass link is here

brainly.com/question/15959704

#SPJ4


Related Questions

I need help im begging yall to help the question is which graph represents the solution to the given system y=-3x-4 and y+4-3x? A. infinit many solutions B no solutions C.(0.-4) D.(0,4) im in the last test of the semester

Answers

Answer:

D is the one trust me man I do this all the time and good luck on your exam

an insured has chosen joint and 2/3 survivor as the settlement option. what does this mean to the beneficiaries?

Answers

Joint and 2/3 survivor means that if the insured passes away, two of the beneficiaries will receive two-thirds of the insurance benefits, and the remaining third will be divided among all three beneficiaries.

Understanding Joint and 2/3 Survivor Settlement Option

Joint and 2/3 survivor is a settlement option for life insurance policies which means that when the insured passes away, two of the beneficiaries will receive two-thirds of the death benefits, while the remaining third will be divided equally among all three beneficiaries. This is beneficial because it ensures that two of the beneficiaries will receive the majority of the death benefits, while the remaining third will be split equally among all three. This provides a more secure financial future for the two beneficiaries receiving the most money as well as allowing the remaining third to be split equally, providing more financial security for all beneficiaries.

Learn more about Finance: https://brainly.com/question/26499492

#SPJ4

Steve is constructing a
triangle from scrap wood.
He has one piece that is
20 inches and a second
piece that is 15 inches
When he is looking for
a third piece, what range
of sizes should he try
to find?

Answers

Answer:

Step-by-step explanation:

the new one will tell you be

PLEASE HELP I HAVE A 46 IN MATH RN...

Answers

C is the right answer. it would be x and then y so the closest answer would be c with 12 for x and 2 for y

log₂ 3+ log₂ (x-4)= 4

Answers

Answer:

In Explanation

Step-by-step explanation:

To solve for x in the equation log₂ 3+ log₂ (x-4)= 4, we can first use the logarithm identity: log₂ a + log₂ b = log₂ (ab)

So, we can rewrite the equation as:

log₂ (3(x-4)) = 4

Then we can use the definition of logarithm to find the value of x:

2^4 = (3(x-4)) = 3x-12

16 = 3x - 12

28 = 3x

x = 9 + 4 = 9

Therefore, x = 9 is the solution of the equation log₂ 3+ log₂ (x-4)= 4

(Please give brainlist)

Which i a better cheme a ingle dicount of 45%or ucceive dicount of 30%and20%on the ame article

Answers

The single discount of 45% is better than the successive discount of 30% and 20%.

Let us assume that the Maximum retail price = 100x

As in case 1,

The percentage discount is given as 45%

So, the value of the selling price of the item will be = (100-45)% of 100x

=55% of 100x = 55x ------(i)

Now in case 2,

The successive discount of 30% and 20% is given.

So, let us assume that the Maximum retail price = 100x

So, after giving the discount of 30%

The value of the selling price will be = (100-30)% of 100x

=70% of 100x = 70x

Now again giving the discount of 20%

Then the value of new selling price will be = (100-20)% of 70x

=80% of 70x = 56x ------(2)

In case (1) the selling price is 55x while in case 2 the selling price is 56x.

For more questions on Maximum retail price

https://brainly.com/question/26304378

#SPJ4

It depends on the price of the article. A 45% single discount will always result in a larger price reduction than a 30% discount followed by a 20% discount on the same price.

However, the overall savings from the two different discount schemes may be the same if the price of the article is high enough. To determine which discount scheme is better, it is necessary to know the price of the article and calculate the total savings under both schemes.

For instance: For example, if we are considering the price of an article is Rs 100, then the successive percentage would be 30% and 20% for the discount, the price falls to Rs 56, whereas with a single 45%discount, the amount comes to Rs55.

To learn more about discount, visit here

https://brainly.com/question/3541148

#SPJ4

Debts, or other outstanding bills or loans that must be repaid are called:

A) Assets
B) Liabilities
C) Net Worth

I add this to math but it's actully personal finance sorry i couldnt find it on pick a subject my bad

Answers

Debts, or other outstanding bills or loans that must be repaid are called option B: Liabilities.

What is Debt?

Debt can be defined as the sum that the borrower owes the lender. A debt is an amount of money that has been borrowed for a set period of time and must be repaid, plus interest.

A liability is a debt that a person or business has, typically in the form of money. Through the transmission of economic benefits like money, products, or services, liabilities are eventually satisfied.

Liabilities are items that are listed on the balance sheet's right side and consist of debts including loans, accounts payable, mortgages, deferred income, bonds, warranties, and accumulated expenses.

Therefore, debts are a form of liability.

To learn more about Debt from the given link

https://brainly.com/question/11556132

#SPJ1

Gordon irons some shirts for staff at a hotel.

The total weight of these shirts is 9. 5 kg.

Each shirt weighs 190 g.

Gordon charges £38 to iron these shirts.

He sees this advert for ironing in a newspaper.

Ironing Palace

Shirts

90p each

Gordon thinks he charges less to iron these shirts than the Ironing Palace would

charge.

Is Gordon correct?

Answers

As per the unitary method, Gordon is correct because the Gordon would charge more than Ironing Palace

In math the term unitary method is defined as the value of a single unit and then find the value of more or fewer units by multiplying their quantity with the value of a single unit.

Here we have given that the total weight of these shirts is 9. 5 kg.

And here we have also given that each shirt weighs 190 g.

And Gordon charges £38 to iron these shirts.

And the charges in the Ironing Palace is 90p for each.

Here we have to use the unitary method to calculate the values for each of them,

The Total cost for Gordon is calculated as,

=> 38 x (9.5 / 0.19)

=> 1900

And the total cost for Ironing Palace is calculated as,

=> 90 x 9.5

=> 855

Therefore, while we looking into the values we have identified that Gordon is correct.

To know more about Unitary method here

https://brainly.com/question/28276953

#SPJ4

What’s the slope and y-intercept of 3x-4y=20

Answers

Answer:

Slope:3/4

y-int: (0,5)

Step-by-step explanation:

Slope:

3x-4y=20

-3x        -3x

-4y=-3x+20

/-4     /-4

y=3/4x+5

So 5 would be y-int

what is the solution to the inequality?

Answers

The solution to the inequality |2x + 3| < 7 is x < 2 or x > -5.

What is inequality?

An inequality is a statement that compares two expressions and asserts that one is greater or less than the other. It can be represented using mathematical symbols such as <, >, ≤, ≥, ≠.

|2x + 3| < 7 is a type of absolute value inequality. The absolute value of a number is its distance from zero on the number line, and is always positive. So, |2x + 3| is the absolute value of 2x + 3, which is always greater than or equal to zero.

To solve this inequality, we need to consider two cases:

If 2x + 3 is greater than or equal to zero, we can drop the absolute value bars and solve the inequality as is:

2x + 3 < 7

2x < 4

x < 2

If 2x + 3 is less than zero, we need to reverse the inequality sign:

-2x - 3 < 7

-2x < 10

x > -5

Hence, the solution to the inequality |2x + 3| < 7 is x < 2 or x > -5.

To learn more about inequality, visit:

https://brainly.com/question/24372553

#SPJ1

the median of a sample will always equal the . a. mode b. mean c. 50th percentile d. 75th percentile

Answers

The median of a sample will always equal the 50th percentile.

What is median?

The median is the value in the middle of a data set, which means that 50% of the data points have a value less than or equal to the median, and 50% of the data points have a value greater than or equal to the median. The statistical median is the number in the middle of a series of numbers. To find the median, sort each number by size; the number in the middle is the median. The median is the value in the middle of a set of data. First, organize and sort the data in ascending order from smallest to largest. Divide the number of observations by two to find the midpoint value. If there are an odd number of observations, round that number up to the nearest whole number, and the value in that position is the median.

Here,

A sample's median will always equal the 50th percentile.

To know more about median,

https://brainly.com/question/29156884

#SPJ1

The image of a trapezoid is shown.

An isosceles trapezoid with a short base of 3 meters and a height of 5 meters. The portion of the large base from the left vertex to the perpendicular is 4 meters. The portion of the large base from the right vertex to the perpendicular is 7 meters.

What is the area of the trapezoid?

Answers

The area of the trapezoid is 42.5 m².

What is trapezium?

A trapezium is a quadrilateral with four sides where two sides are parallel to each other.

We have,

Trapezoid:

Short base = 3 m

Height = 5 m

Large base.

= 4 + 3 + 7

= 14 m

Now,

Area of a trapezoid.

= 1/2 x (Short base + Large base) x h

= 1/2 x (3 + 14) x 5

= 1/2 x 17 x 5

= 42.5 m²

Thus,

Trapezoid area is 42.5 m².

Learn more about trapezium here:

https://brainly.com/question/22607187

#SPJ1

The first three terms of a sequence are given. Round to the nearest thousandth

Answers

[tex]2~~,~~\stackrel{2\cdot \frac{5}{2}}{5}~~\stackrel{5\cdot \frac{5}{2}}{\cfrac{25}{2}}~~,~~...\hspace{5em}\stackrel{\textit{common ratio}}{r=\cfrac{5}{2}} \\\\[-0.35em] ~\dotfill\\\\ n^{th}\textit{ term of a geometric sequence} \\\\ a_n=a_1\cdot r^{n-1}\qquad \begin{cases} a_n=n^{th}\ term\\ n=\textit{term position}\\ a_1=\textit{first term}\\ r=\textit{common ratio}\\[-0.5em] \hrulefill\\ a_1=2\\ n=9\\ r=\frac{5}{2} \end{cases}[/tex]

[tex]a_9=2\left( \frac{5}{2} \right)^{9-1}\implies a_9=2\left( \frac{5}{2} \right)^8\implies a_9=2\left( \cfrac{390625}{256} \right) \\\\\\ a_9=\cfrac{390625}{128}\implies {\Large \begin{array}{llll} a_9=3051\frac{97}{128} \end{array}}[/tex]

2x+8=-3.5x+19 decide wether each question is true for all one, or no values of x

Answers

Answer:

x = 2

Step-by-step explanation:

2x + 8 = -3.5x+19

2x = -3.5x + 11

5.5x = 11

x = 2

Let's check

2(2) + 8 = -3.5(2) + 19

4 + 8 = -7 + 19

12 = 12

So, x = 2 is the only correct answer.

12
Enter the statement, with the values in the same order, but with parentheses so that the statement is true.
7x5-4x5+16÷4=26 when
(select) (select)
-
(select) (select)+(select) (select)=26

Answers

The expression using brackets is (3x)(x⁴) + (2)(2) = 26

How to determine the equivalent expression

From the question, we have the following parametes that can be used in our computation:

7x5-4x5+16÷4=26

Express the superscripts in the expression properly

So, we have the following representation

7x⁵ - 4x⁵ + 16 ÷ 4 = 26

Evaluate the like terms

3x⁵ + 16 ÷ 4 = 26

Divide 16 by 4

3x⁵ + 4 = 26

Factorize and use brackets

(3x)(x⁴) + (2)(2) = 26

Hence, the expression is (3x)(x⁴) + (2)(2) = 26

Read more about expression at

https://brainly.com/question/29988917

#SPJ1

Help please!
select all the equations with the same slope​

Answers

Answer: the second, third and fifth options.

Step-by-step explanation:

When an equation is set up in a y=mx+b format, the slope is always equal to the value m.

Gabriella has a loyalty card good for a discount at her local hardware store. The item she wants to buy is priced at $34, before discount and tax. After the discount, and before tax, the price is $27. 88. Find the percent discount

Answers

The percent discount is 18%.

Now, According to the question:

Based on the given condition:

Formulate:

(34 - 27.88) ÷ 34

Calculate the sum or difference:

= 6.12/34

Convert decimal into fraction:

[tex]=\frac{612}{\frac{100}{34} }[/tex]

Divide a fraction by multiplying its reciprocal:

[tex]\frac{612}{100}[/tex] × [tex]\frac{1}{34}[/tex]

Write as a single fraction:

= 612/ (100 × 34)

Cross out the common factor:

= 18/100

= 9/50

Multiply a number to both numerator and denominator:

[tex]\frac{9}{50}[/tex] × [tex]\frac{2}{2}[/tex]

= 18/100

Rewrite a fraction with denominator equals 100 to a percentage: 18%

Hence,  the percent discount is 18%.

Learn more about Percentage at:

https://brainly.com/question/15808538

#SPJ4

PLEASE HURRY, TEST QUESTION, LIMITED TIME!

Question- Write the standard form equation of the circle given the center of (-3, -8) and the circumference of 14π. Show all work using the equation editor to calculate the missing pieces of the equation.

Answers

Answer: (x + 3)^2 + (y + 8)^2 = 14pi^2

(x-h)^2 + (y-k)^2 = r^2

Baumgartner, Prosser, and Crowell are grading a calculus exam. There is a true-false question with ten parts. Baumgartner notices that one student has only two out of the ten correct and remarks, "The student was not even bright enough to have fipped a coin to determine his answers. " "Not so clear," says Prosser. "With 340 students I bet that if they all ?ipped coins to determine their answers there would be at least one exam with two or fewer answers correct. " Crowell says, "I’m with Prosser. In fact, I bet that we should expect at least one exam in which no answer is correct if everyone is just guessing. " Who is right in all of this?

Answers

According to Bernoulli's theorem, the success rate for the situation is 0.7173.

In math Bernoulli's theorem is states that that random experiment with exactly two possible outcomes, "success" and "failure" in which the probability of success is the same every time the experiment is conducted.

In order to calculate p we must sum the possible permutations of getting 0 success of 10 trials, 1 success of 10 trials, and 2 successes of 10 trials, and divide this sum by the total possible subsets from 10 elements, then it can be written as,

=> P = (10 1) (10 2) (10 1) / 2¹⁰

When we simplify this one, then we get,

=> P = 56/1024

=> P = 0.0547

When we apply the value on Bernoulli's theorem, then we get,

=> B(340, 0.0547, 0) = ( 340 0 ) x (1/1024) x (1023/1024)³⁴⁰

When we simplify this one then we get,

=> B = 0.7173

To know more about Bernoulli's theorem here.

https://brainly.com/question/24232842

#SPJ4

(a) Find the first four terms, in ascending powers of x, of the binomial expansion of
(1+12x)^1/2
giving each term in simplest form.

(b) Explain how you could use x=1/36 in the expansion to find an approximation for √12

There is no need to carry out the calculation.

Answers

a) The binomial expansion of (1+12x)^1/2 is given by:

(1+12x)^1/2 = 1^1/2 + (1/2)(1^-1/2)(12x) + (1/2)(1^-1/2)(-1/2)*(12x)^2 + ...

Binomial expression: what is it?

A polynomial with only terms is a binomial. An illustration of a binomial is x + 2, where x and 2 are two distinct terms. Additionally, in this case, x has a coefficient of 1, an exponent of 1, and a constant of 2. As a result, a binomial is a two-term algebraic expression that contains a constant, exponents, a variable, and a coefficient.

The first four terms, in ascending powers of x, are:

1, (1/2)(12x), (1/8)(12x)^2, (1/16)*(12x)^3

b) To use x=1/36 in the expansion, you would substitute x=1/36 into the expansion, and keep only the terms up to x^3 (the fourth term in the expansion). This will give an approximation of the value of (1+12x)^1/2 when x=1/36.

This will be an approximation of √12 because x=1/36 corresponds to 12x = 1 and the initial value of the expansion is 1 + 12x .

We can use this approximation to approximate square root of 12 and also for other square roots by using appropriate x values.

Learn more about Binomial expression

https://brainly.com/question/13672615

#SPJ1

2 of 4
Workers in an office of 40 staff were asked their favourite type of take-away.
The results are summarised in the table.
Take-away
Pizza
Curry
Fish & chips
Kebab
Other
Work out the size of each angle to draw a pie chart.
Od
a=
b 0
C=
Frequency
5
4
10
12
9
e=
Angle
a
b
C
d
el

Answers

The size of each angle to draw the pie chart is given as follows:

Angle a: 45º.Angle b: 36º.Angle c: 90º.Angle d: 108º.Angle e: 81º.

How to obtain the size of each angle?

The size of each angle in this problem is found applying the proportions.

First we obtain the relative frequency of each item, dividing the absolute frequency by 40.

Then we obtain the angle size, multiplying the relative frequency by 360º, which is the angle measure of the entire circumference of the pie chart.

Then the angle measures are obtained as follows:

Angle a: 5/40 x 360 = 45º.Angle b: 4/40 x 360 = 36º.Angle c: 10/40 x 360 = 90º.Angle d: 12/40 x 360 = 108º.Angle e: 9/40 x 360 = 81º.

More can be learned about proportions at https://brainly.com/question/24372153

#SPJ1

Suppose 0 is an angle in the standard position whose terminal side is in quadrant IV and cot 0 = -9/18. Find values of five remaining trigonometric functions of 0. ​

Answers

The values of five remaining trigonometric functions of θ.

sinθ = 1/√5, cosθ = 2/√5, tanθ = 2, secθ = √5/2, cosecθ = √5

We have to determine values of five remaining trigonometric functions of θ. ​Suppose θ is an angle in the standard position whose terminal side is in quadrant IV and cot θ = -9/18.

The ratio of trigonometry is:

sinθ = Perpendicular/Hypotenuse

cosθ = Adjacent Side/Hypotenuse

tanθ = Perpendicular/Adjacent Side

cotθ = Adjacent Side/Perpendicular

sec = Hypotenuse/Adjacent Side

cosec = Hypotenuse/Perpendicular

We know that;

Adjacent Side = 9, Perpendicular = 18

Now finding the value of Hypotenuse using the Pythagorean Theorem

(Hypotenuse)^2 = (Adjacent Side)^2 + (Perpendicular)^2

(Hypotenuse)^2 = (9)^2 + (18)^2

(Hypotenuse)^2 = 81 + 324

(Hypotenuse)^2 = 405

Taking square root on both side, we get

Hypotenuse = 9√5

Now finding the other trigonometry ratio:

sinθ = Perpendicular/Hypotenuse

sinθ = 9/9√5

sinθ = 1/√5

cosθ = Adjacent Side/Hypotenuse

cosθ = 18/9√5

cosθ = 2/√5

tanθ = Perpendicular/Adjacent Side

tanθ = 18/9

tanθ = 2

secθ = Hypotenuse/Adjacent Side

secθ = 9√5/18

secθ = √5/2

cosecθ = Hypotenuse/Perpendicular

cosecθ = 9√5/9

cosecθ = √5

To learn more about ratio of trigonometry link is here

brainly.com/question/30339626

#SPJ4

please help!!
Examine the two news headlines from real observational studies and determine at least one plausible lurking variable that could explain the cause and effect. Remember, do not argue about the link expressed in the headline, but rather accept the association as true. Your task is to determine the other variable(s) that could be the actual cause(s). b. “Is Gluten the Culprit in Our Fight Against Obesity?”

Answers

A plausible lurking variable that could explain the cause and effect in the headline "Is Gluten the Culprit in Our Fight Against Obesity?" is overall diet.

It's possible that individuals who consume a diet high in gluten also consume a diet high in overall calories and processed foods, leading to weight gain and obesity. This would mean that it is not specifically gluten causing the obesity, but rather a combination of factors in the individual's diet.

What is a lurking variable?

A lurking variable is a variable that has a connection (e.g., may be correlated) with the response and the explanatory variable but is neither the explanatory variable nor the response variable.

Although it is not taken into account in the study, it might affect how the variables are related.

Learn more about variables on:

https://brainly.com/question/28248724

#SPJ1

the last 2 are so difficult help?

Answers

The two mathematical expressions can be written as:-

2) . [ 23 + ( 14 ÷ 2 ) - 20 ] = 5

3) . [ 9² - ( 8 x 4 ) + 26 ] = 75

What is an expression?

The mathematical expression combines numerical variables and operations denoted by addition, subtraction, multiplication, and division signs.

Mathematical symbols can be used to represent numbers (constants), variables, operations, functions, brackets, punctuation, and grouping. They can also denote the logical syntax's operation order and other properties.

The two expressions will be solved as:-

For the first problem, the numbers are 23,2,14, and 20. The expression will be written as:-

[ 23 + ( 14 ÷ 2 ) - 20 ] = 5

[ 23 + 2- 20 ] = 5

[ 25 - 20 ] = 5

5 = 5

The numbers for the second expression are 8,26,9 and 4. The expression can be written as:-

[ 9² - ( 8 x 4 ) + 26 ] = 75

[ 81 - 32 + 26 ] = 75

[ 49 + 26 ] = 75

75 = 75

To know more about an expression follow

https://brainly.com/question/25968875

#SPJ1

Given point M and plane α such that M ∉ α. MO is perpendicular to plane α. MP and MQ are inclined to α which make 30° and 60° with plane α, respectively. Find the length of PQ in terms of

MO if ∠POQ = 120°

Answers

The length of PQ in terms of MO if ∠POQ = 120° is PQ = -x * √3/3.

Let MO = x.

Since MO is perpendicular to plane α, MP and MQ form right angles with MO.

Using the Pythagorean Theorem, we have:

MP = x * tan(30°) = x * √3/3

MQ = x * tan(60°) = x * √3

Since ∠POQ = 120°, we have:

PQ = MP * 2 * cos(120°)

= 2 * x * √3/3 * -1/2

= -x * √3/3

Therefore, the length of PQ in terms of MO is PQ = -x * √3/3.

To learn more about length here:

https://brainly.com/question/30100801

#SPJ4

*

The endpoints of AB are A(-7, 0) and B(7, 7).Find the coordinates of the midpoint M.

Answers

Step-by-step explanation:

( x1 + x2 /2 , y1 + y2 / 2 )

= ( -7 + 7 / 2 , 0 + 7 / 2 )

= ( 0, 3.5 )

The Formula for the volume, V , of a pyramid is V = 1/3Bh , where B is the area of the base of the pyramid and h is the pyramid's height. The base of the pyramid shown has a length of 9m and a width of 8m. The height of the pyramid is 12m.
What Is The Volume Of The Pyramid?
A. 136 m^3 B. 256 m^3
C. 288 m^3 D 324 m^3

Answers

288 m³ is The Volume Of The Pyramid.

What is volume?

The space occupied inside an object's borders in three dimensions is referred to as its volume. It is sometimes referred to as the object's capacity.

Given, The base of the pyramid shown has a length of 9m and a width of 8m. The height of the pyramid is 12m.

Since, The Formula for the volume, V , of a pyramid is V = 1/3Bh ,

where B is the area of the base of the pyramid and h is the pyramid's height.

Since, Area of rectangle = Width *height

Thus, Area of the base = 9 * 8

Area of the base = 72 m²

So, the volume of pyramid (V) =  1/3Bh

the volume of pyramid (V) = 1/3 * 72 * 12

the volume of pyramid (V) =  288 m³

therefore, The Volume Of The Pyramid is 288 m³.

Learn more about Volume here:

https://brainly.com/question/1578538

#SPJ1

Doctor Jones starts an appointment every 20 minutes.

Doctor Warholm starts an appointment every 35 minutes.


The first appointment for both doctors starts at 8. 30 am.


What is the next time that they have an appointment start at the same time?

Answers

The next time that they have an appointment start at the same time is at  10:50 a.m.

Now, According to the question:

Ist Step

For the same time, take LCM of 20 and 35.

20 = 2 × 2 × 5

35 = 5 × 7

IInd Step

HCF (20, 35) = 2 × 2 × 5 × 7

HCF (20, 35) = 140

Hence, it will take the appointment after 140 minutes which equals to 2 hours 20 minute.

Now, from 8.30 am, the addition of the 2 hours 20 minute gives us 10:50 a.m. which is the next time that they have an appointment start at the same time.

Learn more about LCM and HCF at:

https://brainly.com/question/17437347

#SPJ4

a truck is moving at the rate of 50 miles per hour, and the diameter of each wheel is 3 feet. what is the angualr speed of the wheels in raidans per minute

Answers

The angular speed of the wheels is approximately 1480 / π radians per minute.

We can start by converting the velocity of the truck from miles per hour to feet per minute, since the diameter of the wheels is given in feet.

50 miles/hour = 50 x 5280 feet/hour = 264,000 feet/hour

264,000 feet/hour / 60 minutes/hour = 4,400 feet/minute

Next, we can find the circumference of the wheel and then divide it by the velocity of the truck to find the angular velocity in radians per minute:

Circumference = 2 * π * r = 2 * π * (diameter/2) = 2 * π * (3 feet / 2) = 3π feet

Angular velocity (ω) = velocity / circumference = 4,400 feet/minute / (3π feet) = 1480 / π radians/minute

So the angular speed of the wheels is approximately 1480 / π radians per minute.

To learn more about speed here:

https://brainly.com/question/7359669

#SPJ4

the national center for health statistics (nchs) reports that 70% of u.s adults aged 65 and over have ever recieved a penumococcal vaccination. assume that the pneumococcal vaccination rate applies to an independent random sample of 20 u.s adults aged 65 and over who visit an emergency room (er). compute the probability that exactly 14 adults have been vaccinated. round your answer to three decimal places.

Answers

The probability that exactly 14 adults have been vaccinated 0.49

Probability is a measure of the likelihood of an event to occur. Many events cannot be predicted with total certainty. We can predict only the chance of an event to occur i.e., how likely they are going to happen, using it. Probability can range from 0 to 1, where 0 means the event to be an impossible one and 1 indicates a certain event

the national center for health statistics (nchs) reports that 70% of us adults aged 65 and over have ever  vaccination

the pneumococcal vaccination rate applies to an independent random sample of 20 us adults aged 65

the probability that exactly 14 adults have been vaccinated

(14/20)*(70/100)

0.49

The probability that exactly 14 adults have been vaccinated 0.49

To know more about probability  visit brainly.com/question/30034780

#SPJ4

Other Questions
there are 10 employees in a particular division of a company. their salaries have a mean of $70,000, a median of $55,000, and a standard de?viation of $60,000. the largest number on the list is $ 100,000. by accident, this number is changed to $ 1,000,000. which nims structure develops recommends and executes public information Using y = 6 - 2x, plot the ordered pairs from the table. Then graph the function represented by the ordered pairs and tell whether the function is linear or nonlinear. Part 1 out of 3 Complete the table. Input, x Output, y Check -1 3 Next a client who is taking an oral hypoglycemic daily for type 2 diabetes develops an infection with anorexia. which advice will the nurse provide to the client? a solution is prepared at that is initially in dimethylamine , a weak base with , and in dimethylammonium bromide . calculate the ph of the solution. round your answer to decimal places. find the area of region s . find the volume of the solid generated when region s is revolved about the horizontal line y How were the civillzation of huang river valley and the nile river valley similar using defined inputs to ensure that an algorithm or program is producing the expected outcomes, in the development process. Someone Help me Please. Your friendfinds the sum. Is your friend correct?Explain your reasoning.-3.7 + (-0.25) = | 3.7 | + | 0.25 | = 3.7 + 0.25 = 3.95 ntsam ProctorQuestion 2Animals have albinism if they are unable to produce the molecule melanin. The protein responsiblefor making melanin is tyrosinase.If this is the normal sequence for a section of the mRNA transcript for tyrosinase:GCUGAUAGUCCUAnd a rat has this version of the sequence:GUGAUAGUCCUIs this rat likely to have albinism? How do you know?Second letterFirst letterUAUUC.UUG}LeuCUUCUCCUACUGUCUPheUCCLeuAUUAUC lleAUAUCAUCGCCUCCCCCACCGACUACCACAAUG Met ACGGUUGCUProUACJSerThrAUAU Tyr UGC CysUAA Stop UGA StopUAG Stop UGG TrpGCAUTCACJCGUHisCGCCAGGIn CGGAAUAsnArgAGC SerAAGLYS AGG ArgGAUR GGUUCAGDUA DUA D10 ptsThird letter (PLEASE HELP) At a local print shop, 15 copies can be made for $6. At this rate, how much would it cost to make 35 copies??? what significance does the slight overlap of the van der waals surfaces have with respect to the structural relationships of the catalytic triad residues? puck b has five times the mass of puck a . starting from rest, both pucks are pulled the same distance across frictionless ice by strings with the same tension. part a compare the final kinetic energies of pucks a and b . compare the final kinetic energies of pucks and . ka Charles Mann argues that when European settlers moved westward into the interiorof the Americas, they did so in two waves:a) Disease and ecological disturbance.Ob) Conquest and settlement.Oc) Ecological recreation and interaction.d) Disease and exchange. according to the proponents of the quantity theory of money, can a change in the money supply m cause a change in the level of real gross domestic product y? this graph shows merchandise export data for the years 2010 through 2012. a graph titled total merchandise exports from 2010 to 2012 has year on the x-axis and exports in trillions of u s dollars on the y-axis, from 0 to 2.5 in increments of 0.5. a line representing united notes exports is slightly lower than a line representing china exports. which statement most accurately describes the information presented on the graph? during the 21st century, the complexity of the challenges posed by disruptive, digital technologies and accelerating rates of change has encouraged companies to: In order to maintain compliance with standard precautions, a medical assistant should recognize that which of the following tasks requires the use of gloves despite the absence of any visible blood?a) Administering a nebulizer treatmentb) Performing a visual acuity testc) Obtaining a tympanic readingd) Removing a cyst italian sailor credited with the discovery of the americas in 1492. true or false