Throughout the reflection, make sure you have a copy of the Student Guide and your data tables. Fill in the terms
that complete the statements.
In this lab, you observed how changes in the environment can affect the health of a watershed. You saw how two
y entered and flowed through the watershed. You also predicted how y activity affected
food chains, diagrams that show how energy is passed from one biotic factor to another through the foods they
eat.
types of

Answers

Answer 1

Answer:

1000 thats all theres to it

Explanation:

i checked

Answer 2

A space where water from various sources drains is called a watershed. The water from streams and rivers gets drained to a common outlet. The answer should be blank 1 factors, blank 2 human and blank 3 is food web.

What is a watershed?

A watershed is a section of drainage basin or "sheds" water into a particular body of water.

A watershed exists for every body of water. Rainfall and snowmelt are channeled into streams and rivers by watersheds.

These smaller bodies of water drain into larger bodies of water, such as lakes, bays, and oceans.

Abiotic and biotic factors enter and flow through the watershed. These can include plants, small microorganisms, soil, small rocks, and so on.

Human impacts have an impact on the food chain because activities such as deforestation, industrial emissions, and fuel combustion cause environmental changes that harm animals and plants in the ecosystem.

The food web depicts the energy flow in an ecosystem from producers to consumers and represents how energy is passed from plants to consumers as well as their interdependence.

Thus, it can be concluded that the blanks are factors, human and food web respectively.

To learn more about watershed, visit:

https://brainly.com/question/13313239

#SPJ2


Related Questions

What are the impacts of genomic era on microbial phylogeny systematics​

Answers

provide a platform for current research on archaea, bacteria, microbial eukaryotes and viruses.

Natural gas drilling locations are determined by
a random drilling
b. seismic surveys
C. natural gas dogs
d satellite surveys

Answers

Answer:

The answer is b. seismic surveys.

Answer:

B - SEISMIC SURVEYS

Explanation:

How have hominid skulls changed over time? What are some of the reasons for those
changes?

Answers

Answer:

The change from the oblong skull and protruding face of ancient humans (right) to the modern rounder skull and retracted face is associated with a sharper bend in the floor of the brain case (lower left), thought to be caused by increased brain size.

Explanation:

Give brainlist me please

Skull and face changes define modern humans - Harvard Gazette

The change from the oblong skull and protruding face of ancient humans (right) to the modern rounder skull and retracted face is associated with a sharper bend in the floor of the brain case (lower left), thought to be caused by increased brain size.

Name the five carbon sugar in a DNA neucleotide

Answers

deoxyribose is the 5carbon sugar found in DNA nucleotides

Describe the different internal and external factors that affect human health.

Answers

Answer: Biology, psychology, emotions, spirit, energy, lifestyle, culture, economic and political influences, social interactions in family, work, living area and the possibilities to expresses oneself and live full life with a sense of well-being have influence on people appearances.

Explanation:

VIDA chart for biology

Answers

Answer:

Yes you are right I didn't get the question too.

T A C G T G G A C T G A G G A C T C C T C is this a 'sense' strand or 'antisense' strand?

Answers

The information provided is NOT sufficient to indicate if the TACGTGGACTGAGGACTCCTC sequence is a 'sense' strand or 'antisense' strand.

What is a sense DNA strand?

DNA is a double helix molecule composed of two long chains of nucleotides linked by hydrogen bonds.

During transcription, the sense DNA strand is actively used as template to produce a complementary RNA molecule.

In consequence, it is required to know the sequence of the resulting RNA to determine if the sequence above belongs to a 'sense' strand or 'antisense' strand.

Learn more about transcription here:

https://brainly.com/question/1048150

Answer:

C

Explanation:

Examine the words and/or phrases below and determine the relationship among the majority of words/phrases. Choose the option that does not fit the pattern.

A. ash
B. dissolved gases
C. silica content
D. temperature

Answers

The only word among the available words that do not fit the pattern would be temperature.

Words and relationship

Ash, dissolved gases, and silica content are similar in the way that all of them are made up of matter.

Matter refers to any substance with weight and is able to occupy space. Ash is made from solid particles. dissolved gases are gases, and silica contents are also from solids.

Temperature, on the other hand, is a scalar quantity. It is not something that can be held or seen. It has no weight and neither does it occupy space.

More on matter can be found here: https://brainly.com/question/4513444

Which would have a bigger effect on an organism, an error during transcription or a missense mutation? Explain in one or two sentences. (

Answers

How does a missense mutation affect the function of a protein?

A missense mutation will change the amino acid sequence. This may alter the function of the protein, usually negatively, but sometimes positively. This later case may be favored by evolution, as the change is heritable.

At each link of the food web, approximately_________
percent of the energy is passed on to the consumer and
approximately_________
percent of the energy is lost as
heat.

Answers

Approximately 10 percent of the energy is passed on to the consumer and approximately 90 percent of the energy is lost as heat.

What is a Food web?

This refers to an interconnecting diagram that shows the overall food relationships between organisms in a particular environment.

90 percent of energy is usually lost as heat thereby allowing for the transfer of only 10 percent of energy to the consumers.

Read more about Food web here https://brainly.com/question/2179

Which of these is a benefit of fish farming?
A. It poses a risk of disease for wild stocks.
B. It depletes fish populations.
C. It eases the demand on commercial fisheries.
D. It pollutes natural bodies of water.

Answers

Answer:

C

Explanation:

It's pretty simple really, just find the Benefit. Pollution is definitely a harmful effect, disease is also not a benefit, and depletion of fish population is bad, so easing demand on commercial fisheries is the answer

Why is over farming a threat to the health of humans?

A.
It decreases the use of fertilizer.

B.
It increases the production of food.

C.
It adds too many new nutrients to the soil.

D.
It removes too many nutrients from the soil.

Answers

Answer:

it removes too many nutrients from the soil.

Explanation:

Explanation:

it can increas the health risk

What is black soil best for?
O constructing buildings
O having a wildlife environment
O having a desert environment
O farming land

Answers

Answer:

I believe the answer is farming

Answer:

having a wildlife environment

Explanation:

I took the test and this was the correct answer so your welcome

Look at the tropical grassland ecosystem.

Picture of tropical grassland with zebras and wildebeests feeding on grasses. Giraffes are in the background, along with bush trees.
Picture of tropical grassland with zebras and wildebeests feeding on grasses. Giraffes are in the background, along with bush trees.

There are more zebra than the carrying capacity of the pictured ecosystem. This represents a

climax community
biological surplus
peak phenomenon
sigmoid phenomenon

Answers

Answer:

It is B Biological Surplus

Explanation:

Biological Surplus means that a species population has grown too big, above carrying capacity

What changes occur in the atmosphere as you go higher?.

Answers

Answer:

Air pressure drops, and temperatures get colder.

Explanation:

Hope this helps!!

Which object measures atmospheric pressure?
a ballast tank
a barometer
a thermometer

Answers

Answer:

A barometer

Explanation:

It is commonly used to measure atmospheric pressure

Evaluate the role of media in addressing substance abuse with special reference to the following . 1television 2.social media platforms​

Answers

Social media help in addressing substance abuse through awareness and sensitization are going on to make know of the harm and danger in substance abuse.

What is social media?

Social media are online platforms that allows the user to create, write or display content and share with viewers and it also helps to access information and participate in many social networking.

Socal media campaigns have been done on television programs and other social media platforms to prevent the illicit use of drug by young and old people. This is because most young people visit the online platforms more and awareness and sensitization are going on to make know of the harm and danger in substance abuse.

Therefore, media help in addressing substance abuse through awareness and sensitization are going on to make know of the harm and danger in substance abuse.

Learn more on social media here,

https://brainly.com/question/3653791

Human Use of Land
Journal Activity Active
Prompt
How has human land use impacted the environment?
Read More >>

Answers

Decreased water quality, increased pollution, depletion of natural resources and global climate change are the results of human land use.

How human impacted the environment?

Humans impact the environment in many ways such as overpopulation, pollution, burning fossil fuels, and deforestation. Human activities triggered climate change, soil erosion, poor air quality, and undrinkable water.

So we can conclude that reduction of water quality, increased pollution, depletion of natural resources and global climate change are the results of human land use.

Learn more about environment here: https://brainly.com/question/17413226

Which is NOT an example of leaves humans commonly eat?

Spinach
Zucchini
Kale
Field greens

Answers

zucchini is an example of leaves that humans don’t commonly eat.

Zucchini is a squash not a leaf.

Answer:

zucchini

Explanation:

Different________show very different characteristics or variations, however you can also have_______within the same species.
A. Evolutionary animals, major differences
B. Species, variation
C. Animals, subspecies
D. Evolutionary animals, subspecies

Answers

I think B makes the most sense but I’m not too sure

At the molecular level, how do scientists know a new species has arisen?

Answers

Answer:

DNA sequencing has brought us the genetic species concept. In this model, species are defined by genetic isolation rather than reproductive isolation. Species may be more or less identical morphologically, but differences in DNA determine whether or not a population is a new species.

Explanation:

? :-)

What is the great pacific trash gyre?

Answers

Answer:

The Great Pacific garbage patch (also Pacific trash vortex) is a garbage patch, a gyre of marine debris particles, in the central North Pacific Ocean. It is located roughly from 135°W to 155°W and 35°N to 42°N.

Which compounds are not soluble in water?

Answers

answer :

All salts of : carbonate, CO3 2- phosphate , PO4 3- oxalate, C2O4 2- chromate, CrO4 2-sulfide, S 2- most metal hydroxides and oxides (OH-)

Exceptions :

Salts of NH4 +, and the alkali metal cations

Answer:

All salts of : carbonate - phosphate - oxalate, chromate,- most metal hydroxides and oxides

Explanation:

the autonomic nervous system controls
A. tying your shoes
B. Heart Rate
C. chewing a bite of food
D. using a fork

Answers

The answer will be :

B. Heart Rate

the answer is B heart rate

11
12
13
14
15
16
17
18
19
20
Air pollution affects everyone equally.
Please select the best answer from the choices provided
OT
OF

Answers

Answer:

16

Explanation:

Air pollution affects everyone equally is true statement.

What is Air pollution?

When pollutants are released into the atmosphere, they endanger both human health and the health of the entire planet. The World Health Organization (WHO) estimates that air pollution causes close to seven million deaths worldwide each year.

Currently, nine out of ten people breathe air that contains more contaminants than the WHO's recommended levels, with those in low- and middle-income nations suffering the most.

The 1970-established Clean Air Act gives the U.S. Environmental Protection Agency (EPA) the power to protect public health by controlling the emissions of certain dangerous air pollutants.

Therefore, Air pollution affects everyone equally is true statement.

To learn more about Air pollution, refer to the link:

https://brainly.com/question/18951513

#SPJ7

So basically how do i ask my best friend out?

Answers

Answer:

Explain

well just do it i belive in you dont try to act all diffrent or cool that makes people not like u just be yourself

The Earth’s rotation is the only thing that impacts wind

Answers

Answer:

false

Explanation:

While the Earth's rotation does play a role, it is a somewhat indirect one. The primary factor that affects the formation of winds is differences in atmospheric pressure. As is true throughout nature, any fluid will try to move from a region of high pressure to a region of low pressure.

Answer:

False

Explanation:

This is false because the earth goes one way but the wind can go all kinds of ways

Which type of rock would most likely be found near the landform shown in the picture? ​

Answers

Answer:

Igneous rock because it forms when hot molten rock (lava) crystallizes and solidifies .

Explanation:

Have a Nice day!!  :D

Can someone PLease help me with these questions?!

Answers

Answer:

I can't read it. It is too small

Explanation:

It is too small for me to read

What is salinity and how does it change?.

Answers

A balance between water withdrawn by evaporation and freshwater added by rivers and rain controls salinity. The Mediterranean Sea in Europe has a salinity of 38 parts per million or more. It's nearly cut off from the main ocean, and there's more evaporation than rain or additional freshwater from rivers.

Salinity is controlled by a balance between water removed by evaporation and freshwater added by rivers and rain. changes in evaporation and rainfall, ocean currents, melting ice, and freshwater influx from rivers or streams can influence patterns of sea surface salinity, making some regions saltier and other regions fresher over time.
Other Questions
write a letter to your friends in another school Which is better wrist or arm blood pressure monitor HELP ASAPPPPIn two sample surveys, 125 people were asked about their favorite fruit. In the first survey, 40 people chose apples, 64 chose oranges, and 21 chose bananas. In the second, 43 chose apples, 63 chose oranges, and 19 chose bananas. Marianne inferred that most people prefer oranges. Is this inference true based on the data? Explain. If you know your rsum will be scanned, which of the following formatting options should be removed? a. underlines b. italics c. bullets d. all of the above Is ABC~ DEF? If so, identify the similarity postulate or theorem that applies. Starlings produce an average of five eggs in each clutch. If there are more than five, the parents cannot adequately feed the young. If there are fewer than five, predators may destroy the entire clutch. This is an example of. Suppose that 25 students in an AP Statistics class independently do this exercise for homework and that all of their calculators are working properly. Find the probability that at least one of them makes a Type I error. Can I pleae get some help i dont get it What caused relations between the united states and the soviet union to begin to change in the early 1980s? select two answers. jimmy carter became president. leonid brezhnev died. the soviet union invaded afghanistan. ronald reagan became president. the united states withdrew from vietnam. richard nixon resigned as president. What's the primary difference between a manager and leader? who can be titled the brianlistanswer thisName one organism that is selectively bred. The lifting force, F, exerted on an airplane wing varies jointly as the area, A, of the wing's surface and the square of the plane's velocity, v. The lift of a wing with an areaof 280 square feet is 27,800 pounds when the plane is going 220 miles per hour. Find the lifting force on the wing if the plane slows down to 130 miles per hour.(Leave the variation constant in fraction form or round to at least 5 decimal places. Round off your final answer to the nearest pound.) Solve (images attached) can u check if correct How can you best describe a stop sign using polygons? the sign has sides, so it is . it appears to be because the sides and angles appear to be congruent. Aaron has $25 to spend at the carnival. Admission is $4.00 and the ride tickets are $1.25 each. What is the maximum number of ride tickets that Aaron can buy? Write and solve the inequality. Work out the bearing of B from A. Which principle does the U.S. Supreme Court apply when it declares an act of Congress unconstitutional? A. Advice and ConsentB. Checks and BalancesC. Separation of PowersD. Executive Privilege You took a picture of the beach, and there's a seagull sitting in the sand that you want to remove. What do you use to draw and AUTOMATICALLY remove the seagull, replacing it with more sand? A thin 1.5 mm coating of glycerine has been placed between two microscope slides of width 0.8 cm and length 3.9 cm . Find the force required to pull one of the microscope slides at a constant speed of 0.28 m/s relative to the other. 1) The five basic elements of fiction include:setting, characters, plot, theme, and point of view. characters, resolution, realism, rising actions, and falling actions. flashback, subplots, stereotypes, realism, and naturalism. resolution, introduction, crisis, rising actions, and falling actions. plot, flashback, crisis, stereotypes, and naturalism2) An author relates via a(n) _____ what happens to characters in a fictional story. chronologyeraepochplotnarrative3) Answer True or False. If fictional character Joe Brown creates a community garden in a neighborhood to both beautify it and provide fresh vegetables and fruits for residents and fictional character Charlie Alton tramples all of the emerging plants one night, Joe is the antagonist and Charlie is the protagonist. FalseTrue4) Answer True or False. Since Charlie makes a turnabout, he is a static character. TrueFalse5) Answer True or False. At the beginning of the story, Joe believes in the goodness of other humans and even after Charlie ruins his garden, he does not change his mind-Joe is a dynamic character. FalseTrue6) Answer True or False. Though the readers know all about Joe and Charlie and what they think, they know little about Cathy, a neighborhood girl who helps with the garden. Cathy is a flat character. FalseTrue7) Both Joe and Charlie are ____ characters, or ones that are the most critical to the story. secondarymainabsentminorstereotype8) Answer True or False. If in a fictional story about Joe's attempt to create a successful community garden, the author writes, "Generations later, residents of Oak Cliff sang the praises of Joe Browne for his heroic efforts to improve the lives of the locals,"a reader might recognize the sentence as the resolution or denouement. FalseTrue9) Answer True or False. If the author chose to open his fictional story with the scene in which Charlie is stomping on the fledgling plants before relating how Joe planted the garden, he used in media res. FalseTrue10) Answer True or False. Joe's struggles with Charlie are an example of internal conflict, while Charlie's thoughts about why he wants to destroy the plants that will give hope to others are an example of external conflict. FalseTrue11) Answer True or False. If Charlie makes a turnabout during the resolution and begins helping Joe with the community garden, then the author has written a deus ex machina. TrueFalse12) The buildup of tension in fiction is termed ______________. universal themecrisisflashbackmilieususpense13) If at the beginning of the story about Joe and his garden, you read the sentence, "Though Joe had no doubt that he would be successful in his work to create a success," you could say that the author was employing ___________. a cliffhangera themeimpressionismflashbackforeshadowing14) If you read the sentence, "Joe's community garden was beautiful-it was like an oasis in a desert of defeat and destruction surrounded as it was by a burned building and stores and homes imprisoned by their burglar bars," you could say that the author was employing ___________. expressionismromanticismresolutionimpressionismclimax