Answer:
1000 thats all theres to it
Explanation:
i checked
A space where water from various sources drains is called a watershed. The water from streams and rivers gets drained to a common outlet. The answer should be blank 1 factors, blank 2 human and blank 3 is food web.
What is a watershed?A watershed is a section of drainage basin or "sheds" water into a particular body of water.
A watershed exists for every body of water. Rainfall and snowmelt are channeled into streams and rivers by watersheds.
These smaller bodies of water drain into larger bodies of water, such as lakes, bays, and oceans.
Abiotic and biotic factors enter and flow through the watershed. These can include plants, small microorganisms, soil, small rocks, and so on.
Human impacts have an impact on the food chain because activities such as deforestation, industrial emissions, and fuel combustion cause environmental changes that harm animals and plants in the ecosystem.
The food web depicts the energy flow in an ecosystem from producers to consumers and represents how energy is passed from plants to consumers as well as their interdependence.
Thus, it can be concluded that the blanks are factors, human and food web respectively.
To learn more about watershed, visit:
https://brainly.com/question/13313239
#SPJ2
What are the impacts of genomic era on microbial phylogeny systematics
provide a platform for current research on archaea, bacteria, microbial eukaryotes and viruses.
Natural gas drilling locations are determined by
a random drilling
b. seismic surveys
C. natural gas dogs
d satellite surveys
Answer:
The answer is b. seismic surveys.
Answer:
B - SEISMIC SURVEYS
Explanation:
How have hominid skulls changed over time? What are some of the reasons for those
changes?
Answer:
The change from the oblong skull and protruding face of ancient humans (right) to the modern rounder skull and retracted face is associated with a sharper bend in the floor of the brain case (lower left), thought to be caused by increased brain size.
Explanation:
Give brainlist me please
The change from the oblong skull and protruding face of ancient humans (right) to the modern rounder skull and retracted face is associated with a sharper bend in the floor of the brain case (lower left), thought to be caused by increased brain size.
Name the five carbon sugar in a DNA neucleotide
Describe the different internal and external factors that affect human health.
Answer: Biology, psychology, emotions, spirit, energy, lifestyle, culture, economic and political influences, social interactions in family, work, living area and the possibilities to expresses oneself and live full life with a sense of well-being have influence on people appearances.
Explanation:
VIDA chart for biology
Answer:
Yes you are right I didn't get the question too.
T A C G T G G A C T G A G G A C T C C T C is this a 'sense' strand or 'antisense' strand?
The information provided is NOT sufficient to indicate if the TACGTGGACTGAGGACTCCTC sequence is a 'sense' strand or 'antisense' strand.
What is a sense DNA strand?DNA is a double helix molecule composed of two long chains of nucleotides linked by hydrogen bonds.
During transcription, the sense DNA strand is actively used as template to produce a complementary RNA molecule.
In consequence, it is required to know the sequence of the resulting RNA to determine if the sequence above belongs to a 'sense' strand or 'antisense' strand.
Learn more about transcription here:
https://brainly.com/question/1048150
Answer:
C
Explanation:
Examine the words and/or phrases below and determine the relationship among the majority of words/phrases. Choose the option that does not fit the pattern.
A. ash
B. dissolved gases
C. silica content
D. temperature
The only word among the available words that do not fit the pattern would be temperature.
Words and relationshipAsh, dissolved gases, and silica content are similar in the way that all of them are made up of matter.
Matter refers to any substance with weight and is able to occupy space. Ash is made from solid particles. dissolved gases are gases, and silica contents are also from solids.
Temperature, on the other hand, is a scalar quantity. It is not something that can be held or seen. It has no weight and neither does it occupy space.
More on matter can be found here: https://brainly.com/question/4513444
Which would have a bigger effect on an organism, an error during transcription or a missense mutation? Explain in one or two sentences. (
A missense mutation will change the amino acid sequence. This may alter the function of the protein, usually negatively, but sometimes positively. This later case may be favored by evolution, as the change is heritable.
At each link of the food web, approximately_________
percent of the energy is passed on to the consumer and
approximately_________
percent of the energy is lost as
heat.
Approximately 10 percent of the energy is passed on to the consumer and approximately 90 percent of the energy is lost as heat.
What is a Food web?This refers to an interconnecting diagram that shows the overall food relationships between organisms in a particular environment.
90 percent of energy is usually lost as heat thereby allowing for the transfer of only 10 percent of energy to the consumers.
Read more about Food web here https://brainly.com/question/2179
Which of these is a benefit of fish farming?
A. It poses a risk of disease for wild stocks.
B. It depletes fish populations.
C. It eases the demand on commercial fisheries.
D. It pollutes natural bodies of water.
Answer:
C
Explanation:
It's pretty simple really, just find the Benefit. Pollution is definitely a harmful effect, disease is also not a benefit, and depletion of fish population is bad, so easing demand on commercial fisheries is the answer
Why is over farming a threat to the health of humans?
A.
It decreases the use of fertilizer.
B.
It increases the production of food.
C.
It adds too many new nutrients to the soil.
D.
It removes too many nutrients from the soil.
Answer:
it removes too many nutrients from the soil.
Explanation:
Explanation:
it can increas the health risk
What is black soil best for?
O constructing buildings
O having a wildlife environment
O having a desert environment
O farming land
Answer:
I believe the answer is farming
Answer:
having a wildlife environment
Explanation:
I took the test and this was the correct answer so your welcome
Look at the tropical grassland ecosystem.
Picture of tropical grassland with zebras and wildebeests feeding on grasses. Giraffes are in the background, along with bush trees.
Picture of tropical grassland with zebras and wildebeests feeding on grasses. Giraffes are in the background, along with bush trees.
There are more zebra than the carrying capacity of the pictured ecosystem. This represents a
climax community
biological surplus
peak phenomenon
sigmoid phenomenon
Answer:
It is B Biological Surplus
Explanation:
Biological Surplus means that a species population has grown too big, above carrying capacity
What changes occur in the atmosphere as you go higher?.
Answer:
Air pressure drops, and temperatures get colder.
Explanation:
Hope this helps!!
Which object measures atmospheric pressure?
a ballast tank
a barometer
a thermometer
Answer:
A barometer
Explanation:
It is commonly used to measure atmospheric pressure
Evaluate the role of media in addressing substance abuse with special reference to the following . 1television 2.social media platforms
Social media help in addressing substance abuse through awareness and sensitization are going on to make know of the harm and danger in substance abuse.
What is social media?Social media are online platforms that allows the user to create, write or display content and share with viewers and it also helps to access information and participate in many social networking.
Socal media campaigns have been done on television programs and other social media platforms to prevent the illicit use of drug by young and old people. This is because most young people visit the online platforms more and awareness and sensitization are going on to make know of the harm and danger in substance abuse.
Therefore, media help in addressing substance abuse through awareness and sensitization are going on to make know of the harm and danger in substance abuse.
Learn more on social media here,
https://brainly.com/question/3653791
Human Use of Land
Journal Activity Active
Prompt
How has human land use impacted the environment?
Read More >>
Decreased water quality, increased pollution, depletion of natural resources and global climate change are the results of human land use.
How human impacted the environment?Humans impact the environment in many ways such as overpopulation, pollution, burning fossil fuels, and deforestation. Human activities triggered climate change, soil erosion, poor air quality, and undrinkable water.
So we can conclude that reduction of water quality, increased pollution, depletion of natural resources and global climate change are the results of human land use.
Learn more about environment here: https://brainly.com/question/17413226
Which is NOT an example of leaves humans commonly eat?
Spinach
Zucchini
Kale
Field greens
Answer:
zucchini
Explanation:
Different________show very different characteristics or variations, however you can also have_______within the same species.
A. Evolutionary animals, major differences
B. Species, variation
C. Animals, subspecies
D. Evolutionary animals, subspecies
At the molecular level, how do scientists know a new species has arisen?
Answer:
DNA sequencing has brought us the genetic species concept. In this model, species are defined by genetic isolation rather than reproductive isolation. Species may be more or less identical morphologically, but differences in DNA determine whether or not a population is a new species.
Explanation:
? :-)
What is the great pacific trash gyre?
Answer:
The Great Pacific garbage patch (also Pacific trash vortex) is a garbage patch, a gyre of marine debris particles, in the central North Pacific Ocean. It is located roughly from 135°W to 155°W and 35°N to 42°N.
Which compounds are not soluble in water?
answer :
All salts of : carbonate, CO3 2- phosphate , PO4 3- oxalate, C2O4 2- chromate, CrO4 2-sulfide, S 2- most metal hydroxides and oxides (OH-)
Exceptions :
Salts of NH4 +, and the alkali metal cations
Answer:
All salts of : carbonate - phosphate - oxalate, chromate,- most metal hydroxides and oxides
Explanation:
the autonomic nervous system controls
A. tying your shoes
B. Heart Rate
C. chewing a bite of food
D. using a fork
The answer will be :
B. Heart Rate
11
12
13
14
15
16
17
18
19
20
Air pollution affects everyone equally.
Please select the best answer from the choices provided
OT
OF
Answer:
16
Explanation:
Air pollution affects everyone equally is true statement.
What is Air pollution?When pollutants are released into the atmosphere, they endanger both human health and the health of the entire planet. The World Health Organization (WHO) estimates that air pollution causes close to seven million deaths worldwide each year.
Currently, nine out of ten people breathe air that contains more contaminants than the WHO's recommended levels, with those in low- and middle-income nations suffering the most.
The 1970-established Clean Air Act gives the U.S. Environmental Protection Agency (EPA) the power to protect public health by controlling the emissions of certain dangerous air pollutants.
Therefore, Air pollution affects everyone equally is true statement.
To learn more about Air pollution, refer to the link:
https://brainly.com/question/18951513
#SPJ7
So basically how do i ask my best friend out?
Answer:
Explain
well just do it i belive in you dont try to act all diffrent or cool that makes people not like u just be yourself
The Earth’s rotation is the only thing that impacts wind
Answer:
false
Explanation:
While the Earth's rotation does play a role, it is a somewhat indirect one. The primary factor that affects the formation of winds is differences in atmospheric pressure. As is true throughout nature, any fluid will try to move from a region of high pressure to a region of low pressure.
Answer:
False
Explanation:
This is false because the earth goes one way but the wind can go all kinds of ways
Which type of rock would most likely be found near the landform shown in the picture?
Answer:
Igneous rock because it forms when hot molten rock (lava) crystallizes and solidifies .
Explanation:
Have a Nice day!! :D
Can someone PLease help me with these questions?!
Answer:
I can't read it. It is too small
Explanation:
It is too small for me to read
What is salinity and how does it change?.
A balance between water withdrawn by evaporation and freshwater added by rivers and rain controls salinity. The Mediterranean Sea in Europe has a salinity of 38 parts per million or more. It's nearly cut off from the main ocean, and there's more evaporation than rain or additional freshwater from rivers.