Answer:
80
Explanation:
Answer:
120 hope this helps :)
Explanation:
Which sediment would have the slowest rate of deposition?
a round sediment
O a very large sediment
an irregularly shaped sediment
O a high-density sediment
Answer:
C. An irregularly shaped sediment
Explanation:
Deposition is the settling of sediments within respective basins of deposition.
Irregularly shaped sediments are the slowest to settle within a basin this is due to the frictional resistance of their surface.
As these particles hits the water, the liquid drag on their edges is very great and prevents swift settling.
A. A high density sediment and a large sediment will have a fast settling time.
B. Rounded sediments will impose no friction on the water and they fall through the liquid very fast.
Answer:
the answer is C. an irregulary shaped sediment
Explanation:
hope this helps!
Which of the following is true about moss sporophytes?
a. Sporophytes perform photosynthesis. C. Sporophyttes contain a single spore.
b. Sporophytes depend on the gametophyte for d. Sporophytes are very large.
nutrients.
Answer: sporophytes photosynthesise, particularly when immature, but depend on gametophytes for at least 50% of nutrient requirements
Explanation: In mosses, the gametophyte generation is the dominant generation unlike in higher plants. The diploid sporophyte generation produces several spores per capsule.
Answer:
c
Explanation:
During which phase of mitosis do centromeres, which are at the opposite ends of the cell, use spindle fibers to place the chromosomes in the proper place in the cell
A.)telophase
B.)anaphase
C.)prophase
D.)metaphase
Answer:
Metaphase
Explanation:
The metaphase is when chromosomes are lined up and each sister chromatid is attached to a spindle fiber, which will place all of the chromosomes in the proper place in the cell.
Answer:
D.) Metaphase i took the quiz
Explanation:
Please Help!
The middle of an mRNA molecule contains the nucleotide sequence shown here. Much more of the mRNA is translated. Assume that the sequence is translated from left to right.
AUUUAACUGUUCUGUCUAGAG
1.
Construct an Explanation Based only on the information provided, why could the mRNA section be translated into three different sets of amino acids, instead of just one set?
2.
Use Models Use the genetic code to translate the sequence into each of the three possible sets of amino acids.
3.
Draw Conclusions Which of the three sets of amino acids is the most likely to be included in the polypeptide? Explain your reasoning.
Answer:
TAA ATT GAC AAG ACA GAT CTC
1. The more bases there are per codon the more information you can code for. There are only 22 different amino acids, in consequence we need minimum 3 bases per codon.
2. codon
three nucleotides—called a triplet or codon—codes for one particular amino acid in the protein. The nucleotide sequence in the DNA is first transcribed into a molecule of messenger RNA (ribonucleic acid).
3. Known as alpha helices and beta sheets, these stable folding patterns make up the secondary structure of a protein. Most proteins contain multiple helices and sheets, in addition to other less common patterns (Figure 2). The ensemble of formations and folds in a single linear chain of amino acids — sometimes called a polypeptide — constitutes the tertiary structure of a protein. Finally, the quaternary structure of a protein refers to those macromolecules with multiple polypeptide chains or subunits.
OKAY I THINK EVERYTHING IS RIGHT BUT SORRY IF WRONG ;)
3. It is not possible to determine which of the three sets of amino acids is the most likely to be included in the polypeptide based solely on the information provided.
What is a nucleotide sequence?A nucleotide sequence is the order of nucleotides (the building blocks of nucleic acids) in a DNA or RNA molecule.
Nucleotides are composed of a sugar, a phosphate group, and a nitrogenous base, which can be adenine (A), cytosine (C), guanine (G), thymine (T) (in DNA) or uracil (U) (in RNA). The specific order of these nucleotides in a DNA or RNA molecule determines the genetic information that the molecule carries.
Learn more about nucleotide sequence, here:
https://brainly.com/question/30299889
#SPJ6
As DNA is unzipping this enzyme comes in and begins synthesizing mRNA
A. RNA primase
B. RNA polymerase
C. DNA primase
D. DNA polymerase
What is the relationship between a protein, the cell, and DNA?
A. DNA is produced by a protein which is produced in the cell
B. Protein is composed of DNA which is produced in the cell
C. A cell is composed of DNA and protein
D. DNA controls the production of protein in the cell
Answer:
B. Protein is composed of DNA which is produced in the cell
Explanation:
Answer:
B. Protein is composed of DNA which is produced in the cell
Explanation:
The option (B) is the relationship between a protein, the cell, and DNA.
Name the infection agent that can be good or bad for the human body and scan even live on skin?
A. Fungi
B. Bacteria
C. Viruses.
Answer:
fungi
Explanation:
creates lung disease,,, etc
hope it helps :))
Answer:
B. Bacteria
Explanation:
viruses in most cases are not good for the human body since they mutate so much. while most germaphobes hate bacteria it is really useful and needed in the body. for example the amount of bacteria in our body that keeps us alive. but of course there are bad types of bacteria. like E coli. which is found in under cook and contaminated food.
I NEED HELP ITS DUE RIGHT NOW PLEASE ( biology question !!! )
Answer:
A is the correct answer.
Is sharks and crocodiles closely related
Answer:
More recent phylogenetic analyses, based on mitochondrial DNA, have suggested that the crocodile shark is closely related to either the megamouth shark or the sand sharks (Odontaspididae).
Answer:
yes??
Explanation:
look at the other answer
How will water volume, incline gradient, and temperature affect the energy
of a stream?
Answer: Water Volume: The volume of water(discharge) in a stream affects the energy(velocity) of that stream. As the volume of the water in the stream increases, the velocity increases. ... Incline gradient: The incline gradient is also known as the slope of the stream.
Explanation:
Methylmercury biomagnifies in an ecosystem, meaning its concentration __________ as it moves through each higher trophic level.
A. equalizes
B.does not change
C. decreases
D. increases
Answer:
D - Methyl Mercury Increases
Explanation:
The word Biomagnification has a simple explanation:
To magnify is to make bigger, meaning that the substance in question is becoming more abundant.
The "bio" part of this word is referring to the fact that it is a biological substance you are dealing with.
Question: "Methylmercury biomagnifies in an ecosystem, meaning its concentration __________ as it moves through each higher trophic level."
Answer: "The concentration of the methylmercury increases as it moves through each higher trophic level. Hence, the methylmercury biomagnifies in the ecosystem. So, based on the options given prior to the question above, Option D) increases would be your best bet."
what is the answer please let me know asap
Answer:
Explanation:
Unicellular organisms are made up of only one cell that carries out all of the functions needed by the organism, while multicellular organisms use many different cells to function. Multicellular organisms are composed of more than one cell, with groups of cells differentiating to take on specialized functions. pls mark brainliest plz plz
can someone pleasee answer thiiisss pleasee
Answer:
Hi how are you doing today Jasmine
Where will you find permafrost? tall grass prairie savanna chaparral tundra
Answer:
Where Is Permafrost Found? About a quarter of the entire northern hemisphere is permafrost, where the ground is frozen year-round. It's widespread in the Arctic regions of Siberia, Canada, Greenland, and Alaska—where nearly 85 percent of the state sits atop a layer of permafrost.
Explanation:
hope this helps
What causes the "plastic" nature of
the asthenosphere?
A. it is mostly water
B. it only found under the ocean
C. constant earthquake activity
D. heat from below
The heat from below causes the "plastic" nature of the asthenosphere. The correct option is D.
What is asthenosphere?The asthenosphere is the upper mantle's mechanically sluggish and ductile region.
It is located beneath the lithosphere, somewhere around 80 and 200 kilometers underneath the surface, and can extend up to 700 kilometers. However, the asthenosphere's lower boundary is not well defined.
Semi-plastic rock makes up the Asthenosphere. Because of Lithosphere has a lower density, it resides on top of the Asthenosphere, much like an iceberg or a block of wood does on water.
The lower mantle beneath the Asthenosphere is stiffer and less plastic. The outer core is located beneath the Mantle.
The "plastic" essence of the asthenosphere is caused by heat from below.
Thus, the correct option is D.
For more details regarding asthenosphere, visit:
https://brainly.com/question/7152935
#SPJ2
What type of variation is necessary for natural selection to occur? (3 points)
Group of answer choices
Artificial variation
Environmental variation
Genetic variation
Neutral variation
Answer:
Genetic
Explanation:
Can anyone give me two mineral feed ingredients for poultry birds ?! 20 points for it
Answer: aragonite oyster shell crab meal
Explanation: aragonite is for calcium and oyster shell also has calcium. Crab meal provides small amounts of protein and minerals
Describe a DNA molecule and its shape
Answer:
DNA is a long molecule, made up of two strands twisted together to make a spiral known as a double helix.
how does climate and vegetation vary with latitude and elevation?
Answer:
Climate and vegetation vary with latitude and altitude of an area. Latitude measures distance from the equator; altitude measures elevation above sea level. ... Deserts have little precipitation and little vegetation. They are found in tropical, temperate, and Polar Regions.
The climate and vegetation may significantly vary with the latitude and elevation. This is because as elevation increases the temperature decreases gradually that do not favor the actual growth of vegetation.
What is Climate?Climate may be defined as a type of weather conditions that are persuading in any geographical location for a long period of time. In a more simple sense, it is characterized as the long-term pattern of weather in a particular area.
Latitude estimates the distance from the equator part of the earth and goes through the tropical, temperate, and colder regions of the earth. The vegetation is typically reduced with increasing the altitude or elevation with respect to the sea level.
It may also be noticed that the vegetation may alter with respect to the geographical location of the whole earth. It was never found to be completely absent.
Therefore, the climate and vegetation may significantly vary with the latitude and elevation.
To learn more about Vegetation, refer to the link:
https://brainly.com/question/1032432
#SPJ2
Scientists are studying the bacteria living in termites because they want to
genetically engineer......
Bacteria that can resist pests on crops.
Bacteria that can create ethanol from left over plant material.
Bacteria that create a vaccine.
Bacteria that create antibiotics.
Answer:
B. this is why Those bacteria may contain genes that will help convert plant material to ethanol. so B. and if it's wrong then sorry but if it's right u welcome ;)
Bacteria that can resist pests on crops.
The following information should be considered:
In the case when the scientist should studying the bacteria that lived the termites so it should resisted the pest on the crops. These kind of bacterias should comprise of genes that would helps transform plant material to ethanol.Learn more: https://brainly.com/question/5303391?referrer=searchResults
True Or False urgebt
Answer:
The answer is true
Explanation:
true
Which of the following is an example of osmosis?
Movement of water into the roots of a plant
Movement of pottasium in to a cell
Movement of sodium through a channel protein
Movement of carbon dioxide into the leaf of a cell
Make a list of the energy carriers involved in the Krebs cycle. Include their names before and after they accept the electrons.
Thank you!
Answer:
12
Explanation:
what are cork tissues? how are they formed?
Answer:
Cork is a protective tissue that separates the living cells of the plant from the outside environment. The formation of cork in the periderm is the result of the activity of a secondary meristem, the cork cambium, or phellogen.
Explanation:
A doctor is diagnosing a patient with gigantism. Which of the following sources would be the least helpful in making
that diagnosis?
O growth chart
medical book
patient's family history
O patient's diet
Answer:
The answer is D, patient's diet.
Explanation:
As per the observation, it is clear that the correct answer is a medical book as it will have the medical history of the patient.
Gigantism is an extreme situation this is almost usually due to an adenoma, a tumor of the pituitary gland. Gigantism happens in sufferers who had immoderate boom hormones in childhood. The pituitary tumor cells secrete an excessive amount of boom hormone (GH), which main to many adjustments withinside the body.
How is gigantism diagnosed?If gigantism is suspected, the prognosis is commonly shown via way of means of taking blood assessments to degree the stages of boom hormone and insulin-like boom component 1 (IGF1) circulating withinside the blood. IGF1 is launched into the blood often via way of means of the liver in reaction to boom hormone.
Thus it is clear that medical books will have a medical history of patetint wityh gigantism.
To learn more about gigantism refer to the link :
https://brainly.com/question/7035609
Dr. Sanchez and her team have observed an unusual star in the Andromeda galaxy. Their data suggests that the star is being consumed by a nearby black hole. They write a scientific paper about their work and submit it to a scientific journal. Other scientists read their paper and look for the unusual star as well. The other scientists are participating in which activity?
Answer:
so the answer is peer review
Explanation:
Yes, other scientists are participating in this activity not in a direct way but in an indirect way. The scientists are participating in peer review.
What is galaxy?The scientific paper was written by scientists which provide the data and conclusion of entire experiments. To write scientific experiments we need to collect data, frame hypotheses, research methodology, and find out the conclusion are some of the steps to writing a scientific paper.
Testing hypotheses often involves designing experiments. In the given experiment Dr. Sanchez found that star is consumed by a nearby blackhole. But other scientist found the unusual star as well.
This suggests that both scientist thought on different aspect. This suggest peer review.
Therefore, Yes, other scientists are participating in this activity not in a direct way but in an indirect way.
To learn more about Scientific papers, refer to the link:
https://brainly.com/question/1716162
#SPJ2
What makes each of the mechanical layers different?
A. Whether the layer is rock or metal
B. Whether the layer is solid, liquid, or in between
C. Whether the layer is dense or thick
Use the following questions to write your conclusion to your lab report.
What did you learn from doing this lab? (Did the volcano have an effect on the ability of a predator to catch their prey? What might this mean for future generations? Include numbers from your data tables to show these changes.)
How could you make the lab better?
Answer:
WHat??
Explanation:
FILL IN THE BLANK!!!
genotype is the____pair of alleles (TT)____of an organism. And phenotype is the____apperence__of an organism
Answer:
THIS IS IT
Explanation:
The genetic makeup of an organism (ex: TT). Phenotype, The physical ... from each parent). This pair of alleles is called a genotype and determines the organism's appearance, or phenotype. ... A Punnett square can be used to predict genotype and phenotypes of offspring from genetic crosses
I was wondering if my answer was right ?
Explanation:
yes the 4th one is right so yes the one you have is right