Geoff works at a warehouse , earning $17.50 per hour plus a $200 what’s the equation?
Answer:
P = 17.50x + 200
Step-by-step explanation:
x is the number of hours worked
P is how much money Geoff earns
line passes through the points (4,-2) and the slope is 5/4 write an equation in slope intercept form
Answer:
y=5/4x -7
Step-by-step explanation:
Hope this helps!
To get to the next term in this sequence, multiply the last term by 2.5. What is the value of the next term?
1, 2.5, 6.25, 15.625, ...
HELP ASAP WILL GIVE BRAINLIEST
Answer:
39.0625
Step-by-step explanation:
15.625 times 2.5= 39.0625
You're just multiplying each value by 2.5
1 times 2.5= 2.5
2.5 times 2.5= 6.25
6.25 times 2.5= 15.625
and then 15.625 times 2.5= 39.0625
To bring a "carry-on" bag onto an airplane the bag needs to weigh less than 25 pounds. Right now Julie's carry-on bag weighs 32 pounds. How much weight must Julie remove from her bag?
My answer needs to be 32-25=7
Jamal has a plan to save money for a trip. Today, Jamal deposits $8.00 into the savings account. Each week, Jamal will add $5.00 to the amount that is deposited into the savings account. The table below shows the relationship between the number of weeks and how much money, in dollars, Jamal deposits into the savings account. Week 0 1 2 3 4 Deposit (Dollars) 8 13 18 23 28 Let f(x) represent the amount of money Jamal deposits into saving account at the end of x weeks. Based on the table, what is f(8)?
Answer:
f(8) = $48
EQUATION
f(x)= 8+5(x)
Step-by-step explanation:
initial value = $8
every week there is an additional $5 added.
f(x) = 8+5x
f(8) = 8+ 5(8) = 8 + 40 = 48.
At the end of week 8 (x=8) , Jamal has $48 (y=48) saved.
Four times a number is equal to the number increased by 24 find the number
Answer:
8Step-by-step explanation:
Let the number is x.
Translate the given into equation and solve for x:
4x = x + 244x - x = 243x = 24x = 8Activity 1.
Direction. Using the diagram below, form ratios. Express them in lowest term to
To form a proportion
Answer:
6:3 =2:12:2=1:16:13:24:14=2:7Is this table proportional?
XY
1 3 3
4 12
5 15
7 21
How do I multiply a fraction and a whole number? Please explain step by step to get marked
Any whole number can be written as a fraction. All we do is place the number over 1.
For example, the whole number 7 is the same as the fraction 7/1.
If we wanted to multiply the whole number 7 with the fraction 2/3 then...
[tex]7 * \frac{2}{3}\\\\\frac{7}{1} * \frac{2}{3}\\\\\frac{7*2}{1*3}\\\\\frac{14}{3}\\\\[/tex]
In the jump from the second step to the third step, we multiply straight across. The numerators multiply together. The denominators multiply together. The fraction 14/3 cannot be reduced because 14 and 3 don't have any factors in common other than 1.
can you help me solve 4x - 15 = 17 - 4x
[tex]4x-15 = 17-4x\\\\\implies 4x +4x = 17 +15\\\\\implies 8x = 32\\\\\implies x = \dfrac{32} 8\\\\\implies x = 4[/tex]
When Hugo puts a book and a candle on a scale, the scale reads 8.705 lbs. When he removes the book, the scale reads 4.93 lbs. How much does the book weigh?
Answer:
8.705-4.93=3.775
Hope This Helps!!!
Classify the Triangle by its sides and angles. 140° Right Scalene Right Isosceles Equilateral Obtuse Isosceles Acute Isosceles Obtuse scate Acute Scalene
Answer: Obtuse Isosceles.
Explanation: Two angles are congruent, which means the triangle is isosceles. One angle is over 90°, which means the triangle is obtuse.
Which one is correct
3.Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5'
Mutated DNA sequence: 3' TACCGCTTATTATTACGTGCTGCTATCGCT 5'
Type of mutation (3pts):
Amino acid ( 3pts):
Type of mutation ( 3pts):
4. Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5'
Mutated DNA sequence: 3' TACCGCTAATTATTACGTGCTGCTATCGCT 5'
Type of mutation ( 3pts) :
Amino acid ( 3pts):
Type of mutation ( 3pts):
3. The original sequence
TAC - CGC - TTA - CGT - CTG - ATC - GCT
codes for
tyr - arg - leu - arg - leu - ile - ala
while the mutated sequence codes for
TAC - CGC - TTA - TTA - TTA - CGT - GCT - GCT - ATC - GCT
tyr - arg - leu - leu - leu - arg - ala - ala - ile - ala
There are several frameshift mutations involved here:
• the first inserts 6 bases (TTA - TTA)
• the second inserts 1 base (G) before the CTG triplet (underlined)
• the third inserts 2 bases (CT) after the CTG triplet
4. The original sequence is the same as before. The mutated sequence
TAC - CGC - TAA - TTA - TTA - CGT - GCT - GCT - ATC - GCT
codes for
tyr - arg - STOP - leu - leu - arg - ala - ala - ile - ala
Then
• there is a (nonsense) point mutation that swaps T for A in the original TTA triplet (nonsense since it produces a stop codon that would halt replication/expression)
• there is a frameshift mutation that inserts 3 bases (TTA)
as well as two other frameshift mutations that also occurred in the previous part.
Determine if the sequence below is arithmetic or geometric and determine the common difference/ ratio in simplest form
15, 11 ,7, …
Answer:
This is the arithmetic sequence which has a common difference that equals to -4.
Step-by-step explanation:
An arithmetic sequence is a sequence with common difference. A common difference can be found by subtracting previous term with next term.
A common difference can be expressed in [tex]\displaystyle \large{d=a_{n+1}-a_n}[/tex] where d stands for common difference.
________
Moving to the question given. We have a sequence with given 15,11,7, ... first subtract 15 with 11.
11-15 = -4
7-11 = -4
Therefore, we can conclude that the common difference is -4 thus making the given sequence an arithmetic.
Let me know if you have any question so regarding the sequence!
1) f(4) = g(4)
2) f(4) = g(-2)
3) f(2) = g(-2)
4) f(-2) = g(-2)
Answer: 4)
Step-by-step explanation:
f(4) = -14
g(4) = 10
g(-2) = 4
f(2) = -8
f(-2) = 4
The correct statement is 4) f(-2) = g(-2)
Or by inspection, we can see that the graph f(x) intersects g(x) at x = -2 and y = 4. So, f(-2) = g(-2) = 4 is true
Help me please i really need it
Answer:
Step-by-step explanation:
RSB is a right angle
12. RSB is 90 degrees
13. A right angle is 90 degrees
H is between P and S
14. PS + PH = HS
15. Deductive Reasoning
A desk drawer is shaped like a rectangular prism. The height of the drawer is 7 inches. The bottom of the drawer has an area of 210 square inches.
What is the volume of the desk drawer?
Enter your answer in the box.
Answer:
1470 inches cubed
Step-by-step explanation:
Vol=length × width × height
But ALSO,
length × width = Area,
So we find another Volume equation,
Vol = BaseArea × height
This is the information you are given in the question.
Vol = 210 × 7
Vol = 1470 inches cubed
Evaluate.
(jk−1)÷j when j=−4 and k=−0.7
Enter your answer as a decimal in the box.
Answer:
(jk - 1) / j
jk = (-4 x -0.7) = 2.8
(2.8 - 1) / - 4
1.8 / -4 = -0.45
Answer is -0.45 when j = -4 and k = -0.7
The impact on sampling of increasing the sample size is: There is no specific relationship between sample size and sampling error.
Using margin of error, it is found that increasing the sample size results in a smaller sampling error.
The equation for the margin of error is given by:
[tex]M = c\frac{s}{\sqrt{n}}[/tex]
In which:
c is the critical value according to the distribution used.s is the standard deviation, either of the sample or of the population.n is the sample size.From the equation, it can be noted that the margin of error is inversely proportional to the square root of the sample size, hence, increasing the sample size results in a smaller sampling error.
To learn more about margin of error, you can take a look at https://brainly.com/question/25821952
find the value of X in the following figures
Answer: 70
Step-by-step explanation:
Diagonals of a rhombus bisect each other at right angles, so
[tex]x+20=90\\\\x=\boxed{70}[/tex]
Find the equation of a line that intersects with y=2x-1 on the y-axis and is parallel to y=-x. Please explain.
Answer:
so where does that line intersect the y axis? just plug in x=0 and you see y= -1. so (0, -1)
y = -x -1 is parallel because it has the same slope and goes through the right point
Jose left the airport and traveled toward the mountains. Kayla left 2.1 hours later traveling 35 mph faster in an effort to catch up to him. After 1.2 hours Kayla finally caught up. Find Jose's speed.
========================================================
Explanation:
x = Jose's speed in mph
x+35 = Kayla's speed since she drives 35 mph faster than Jose
Jose gets a 2.1 hour head start and it takes Kayla 1.2 hours to reach him. So this means Jose has been driving for 2.1+1.2 = 3.3 hours when Kayla reaches him. The distance he travels is
distance = rate*time
d = r*t
d = x*3.3
d = 3.3x
while Kayla's distance equation is
d = r*t
d = (x+35)*1.2
d = 1.2x+42
Since Kayla meets up with Jose at the 1.2 hour mark, this means the two distances they travel is the same. Set their distance expressions equal to one another. Solve for x.
3.3x = 1.2x+42
3.3x-1.2x = 42
2.1x = 42
x = 42/(2.1)
x = 20
Jose's speed is 20 mph, while Kayla's speed is x+35 = 20+35 = 55 mph.
Jose's fairly slow speed is probably due to a number of factors such as heavy traffic, icy roads, or poor visibility. Kayla probably got a bit of a break with more favorable conditions.
Since Jose travels at 20 mph and does so for 3.3 hours, he travels d = r*t = 20*3.3 = 66 miles. Kayla travels d = r*t = 55*1.2 = 66 miles as well. We get the same number each time to help confirm the answer.
A basket of fruit contains 6 apples, 5 oranges, 3 bananas, and 2 limes.Which of the following statements about the fruits in the basket are true?Select the two correct statements.
Answer:
[tex]6 + 5 = 11 + 3 = 14 + 2 = 16[/tex]
[tex]6 \div 5 \div 3 \div 2 = 0.2[/tex]
[tex] 6 \times 5 \times 3 \times 2 = 180[/tex]
Step-by-step explanation:
If its addition add them, multiplication multiply them, division divided them.
Answer:
Step-by-step explanation:
i need help sorry no answer got u
The table shows the final score of four golfers.
Golfer Final Score
Joe
-2
Allen
-5
Tara
-8
Violet
-4
Whose score was the lowest? Whose was the highest? Select your answers from the drop-down lists.
score was the lowest.
score was the highest.
Students, draw anywhere on this slide!
PER Deck eractive Skoe
Answer:
Joe score was the highest. Tara score was the lowest.
Step-by-step explanation:
What is an equivalent ratio
Answer:
Equivalent ratios (which are, in effect, equivalent fractions) are two ratios that express the same relationship between numbers. We can create equivalent ratios by multiplying or dividing both the numerator and denominator of a given ratio by the same number. Two ratios that have the same value are called equivalent ratios. To find an equivalent ratio, multiply or divide both quantities by the same number. It is the same process as finding equivalent fractions.
[tex]2 \frac{2}{3} + 3 \frac{1}{3} + 1 \frac{2}{3} [/tex]
aaaaaaaaaadddddddd
~nightmare5474~
[tex]2\frac{2}{3} + 3\frac{1}{3} + 1\frac{2}{3} = 7\frac{2}{3} [/tex]
let's convert each mixed fraction into improper fractions. Therefore,
What are Improper fractions:Improper fractions are fractions that has the numerator bigger than the denominator.
[tex]2\frac{2}{3} = \frac{8}{3} [/tex]
[tex]3\frac{1}{3} = \frac{10}{3} [/tex]
[tex]1\frac{2}{3} = \frac{5}{3} [/tex]
Therefore,
[tex]\frac{8}{3} + \frac{10}{3} + \frac{5}{3} [/tex]
[tex] \frac{8}{3} + \frac{10}{3} + \frac{5}{3} = \frac{8 + 10 + 5}{3} = \frac{23}{3} [/tex]
Let's convert our answer back to mixed fractions
[tex]\frac{23}{3} = 7\frac{2}{3} [/tex]
learn more on fraction here:https://brainly.com/question/25412?referrer=searchResults
Solve for x: one over eight 1/8(8x + 15) = 24
Answer:
22[tex]\frac{1}{8}[/tex]
Step-by-step explanation:
I hope this helps!!!
Let simplify :- 2 ⅓ ÷ 1 ⅛ ÷ 2 ¼
Step-by-step explanation:
7/2 ÷ 9/8 ÷ 9/4
7/2 × 8/9 × 4/9
= 112/81
= 1 ³¹/81
[tex]\large\huge\green{\sf{Question:-}}[/tex]
2 ⅓ ÷ 1 ⅛ ÷ 2 ¼[tex]\large\huge\green{\sf{Answer:-}}[/tex]
=2 ⅓ ÷ 1 ⅛ ÷ 2 ¼ =???
=7/2 ÷ 9/8 ÷ 9/4
=7/2 × 8/9 × 4/9
= 224/162
=112 /81
=1 ³¹/81
please help
step bu step
Answer:
what ang hirap nmn anong grade ka na ba