The Fourth Amendment to the U.S. Constitution specifically addressed the colonists
grievance that
A. they had been forced to house soldiers
B. they had been subject to trials without a jury
C. their homes had been searched without warrants
D. the King had not respected their religious freedom

Answers

Answer 1

Answer:

your answer would be (C) as it is also a part of the bill of rights


Related Questions

The Shang dynasty's bronze casting was considered which of the following?
a.
primitive
c.
behind the Europeans
b.
the best in the world
d.
nonexistent



Please select the best answer from the choices provided


A
B
C
D

Answers

Answer:

b

Explanation:

It was an important role in the material culture of the time.

Answer:

b

Explanation:

What effect does the Sun’s gravity have on the Earth?

Answers

Answer:

the sun pi ulls our planet just as eart pulls it tobus

What are the terms for enlightenment in each religion?

Answers

Hindu-moksha; Buddhist-nirvana

why didn't' Georgians like the Georgia platform

Answers

They didn’t like their plat for because of low flood production

Answer:

Because they wanted to disrupt the interstate slave trade, weakening  the fugitive slave laws, or abolishing slavery in the district of Colombia.  

Explanation:

I am really into history/ social study's.

is the united states a constitutional republic true or false

Answers

Answer: True

Explanation:

hellp, what were the 4 major groups that lived in Greece?!?!?

Answers

Hello! I hope this helps, If it doesn’t.. then I’m sorry!

The art of ancient Greece is usually divided stylistically into four periods: the Geometric, Archaic, Classical, and Hellenistic. The Geometric age is usually dated from about 1000 BC, although in reality little is known about art in Greece during the preceding 200 years, traditionally known as the Greek Dark Ages.

Answer:

Minoans and the Mycenaeans.

Explanation:

Which of the following roads reached the Ohio River?
a.
the Mohawk Turnpike
the Nashville Road
b. the Wilderness Road
d. the Great Valley Road

Answers

C is the answer you’re needing

Why did the Age of Imperialism begin?

Answers

Answer:

In the Age of New Imperialism that began in the 1870s, European states established vast empires mainly in Africa, but also in Asia and the Middle East. European nations pursued an aggressive expansion policy that was motivated by economic needs that were created by the Industrial Revolution.

Explanation:

ASAP I need help like RN

Which characteristics are necessary for a society to be considered a civilization?

Select ALL correct answers.


more food than is needed for survival


division of labor


literature


a hierarchy of priests


organized schools

Answers

I think it's division of labour

Answer:

All of the above.

Explanation:

This is because division of labor allows different tasks to be preformed in a society, increasing its technology, its economy, and its ability to outpreform others in war. More food is needed for survival is also necessary for a society to be considered a civilization, because otherwise everyone would have to be a farmer, and division of labor would not be able to occur. Next, in order to be considered a civilization, you need literature. This is because without literature, you wouldn't be able to record history, and write down thoughts and ideas. You need organized schools in order to have a civilization because without them, your future generation of people would not be educated and would not be able to contribute to society, therefore decreasing progress. Lastly, you need a hierarchy of priests, because religion is needed in order to form a civilization. This is because without religion, there would be no such thing as bad or good, as well as social structure.

what is the shortest article in the US constitution not needed anymore? please help asap

Answers

Answer:

Article III - Judicial Branch | The National Constitution Center.

It was in ________ , countries with primarily agricultural economies, that many covert operation took place.

Answers

Answer:

your awnser is "military-industrial complex"

Explanation:

- What were three major events in order from beginning middle end of the War of 1812

Answers

Answer:

America declaration of war against the British is issued. The war is later known as “Mr Madison's War” or “The Second American Revolution.”

Answer:

Explanation:

Battle of Tippecanoe-1811-Ohio River Valley

Congress declares -"Mr. Madison's War"-June 18, 1812-Washington, D.C.

British capture Ft. Mackinac-August 16, 1812-Michigan

Invasion attempts of Canada-1812-U.S.--Canadian border

What factors led the founding fathers to create a constitutional democratic republic?

Answers

Answer:

The Founders were ever mindful of the dangers of a tyrannical government. So they built a system in which the powers of each branch would be used to check the powers of the other two branches. Additionally, each house of the legislature could check one another.

Explanation:

Hope this helped

10 points if someone answer this

Answers

Answer:

They were not taken care of.

Explanation:

In the image it looks like they are starving, and have no clothing on.

My personal opinion. Hope I could help:)

Answer:

the transportation of enslaved Africans were fairly cramped, and they had little to no space to move freely or stretch. But having them so close to one another, diseases and other illnesses would be able to spread rather quickly.

Explanation:

I hope this helps!

Give 3 reasons why the Western Empire failed. What were the reasons for its decline?
please help mehhh i don’t understandddd

Answers

Answer:

What were some reasons for the decline of the Roman Empire?

7 Reasons Why Rome Fell

1 Invasions by Barbarian tribes.

2 Economic troubles and overreliance on slave labor.

3 The rise of the Eastern Empire.

4 Overexpansion and military overspending.

5 Government corruption and political instability.

6 The arrival of the Huns and the migration of the Barbarian tribes.

7 Christianity and the loss of traditional values.

Explanation: 7 answers

military why was it important to sparta?

Answers

Answer:During the 5th century BC Sparta was very powerful. This was due to her army, which was feared by other Greeks. Sparta focused on producing good soldiers and all Spartan male citizens were part of the army. The Spartan army played an important role in the Greek victory over the Persians, in 480-479 BC.

Explanation:May i plz have brainlist hope this helped u and have an nice day

Why did the Visigoth general Alaric invade Rome? (1 point)

Question 22 options:

1)

to build the Visigoth empire

2)

to re-establish the pagan religion

3)

to escape the Huns

4)

to merge with the Ostrogoths

Answers

Answer: To escape the Huns

Explanation: He feared the Huns and fled into Italy he ran into Rome and crushed it.

Answer:

huns

Explanation:

3) The center of life in Athens was...*
A) The Parthenon
B) The Acropolis
C) The Agora
D) None of the Above

Answers

I think it is number B........

PLESS HELPPP MY GRAED IDPANES ON ITTTT
Why do you think the memoir is called Night? Why does he keep saying: “Night was falling?” “Night fell?” “Night had fallen.” "My life had become one giant night", etc. Write about the difference between day and night, light and darkness, good and evil, spring and winter .

Answers

maybe because it changed the mood and character of the story, maybe it changes the prespective, maybe the author of anted to create a visualization for the mind

how was the upper class viewed in the past?

Answers

In the past past, during Great Depression no one liked them because they had a whole bunch of rights and things that the poor/ lower class didn’t. Also in 1800s the upper class was the kings and rich men of the world, no one liked them because they were greedy and didn’t care for others but themselves

Make b the subject of the formula a = Vb+ 6​

Answers

Answer:

b = (a - 6)/V

General Formulas and Concepts:

Pre-Algebra

Order of Operations: BPEMDAS

Brackets Parenthesis Exponents Multiplication Division Addition Subtraction Left to Right

Equality Properties

Explanation:

Step 1: Define

a = Vb + 6

Step 2: Solve for b

Subtract 6 on both sides:                     a - 6 = VbDivide V on both sides:                        (a - 6)/V = bRewrite:                                                  b = (a - 6)/V

Approximately how long ago was 1200 BC (or BCE)?

Answers

Answer: 3200 years ago

So 1200 BC was 3200 years ago !

Explanation:

So, approximately 822 years have elapsed between 1200 BC (or BCE) and the present day.

how long ago was 1200 BC (or BCE)?

To know the approximate time frame for 1200 BC (or BCE), we need to count backward from the present day.

The present year is 2023, so we can calculate the time elapsed by subtracting 2023 from 1200.

2023 - 1200 = 823 years

However, since the year 0 is not directly followed by 1 BC (there is no year 0 in the Gregorian calendar system), one need to account for the lack of a year 0 in our calculation.

Therefore, we subtract an additional 1 year to account for the transition from 1 BC to 1 AD.

823 - 1 = 822 years

Read more about  1200 BC here:

https://brainly.com/question/14265919

#SPJ6

What did Americans think Britain was doing with Native Americans?

Answers

The War of 1812 created a lasting impact on several tribes whose communities were involved. For Native Americans, the War of 1812 created Indian heroes, established historic places, and dispossessed ancient home areas.

Answer:

Conflicts between U.S. citizens and Native Americans were frequent in the years before the war and many in the United States blamed Great Britain and its colonies for helping to arm the Native Americans. Indeed, for British North America, maintaining positive relationships with Native Americans in the porous borderlands was a sensible means of guarding against incursions by the much more populous United States. Those in the United States who were eager to strip natives of their land were more likely to frame the situation as one of British aggression.  It is too much to say that territorial desires had a significant role in sparking the War of 1812, but the opportunities for national expansion were an important side issue of the conflict.

Territorial ambitions were not focused solely on lands held by Native Americans. Some American politicians felt that the conquest of Canada would complete the business of the American Revolution, and residents of British North America had been nervous for years with their southern neighbor’s growing size and power. Similarly, some in the south saw a war as one means to move in on Spanish Florida and its native allies.

In the years before the War of 1812, many Native Americans were joining the growing Pan-Indian movement. Led by Tenskwatawa, a spiritual leader also known as the Prophet, and his brother Tecumseh, the movement’s political and military head, the Pan-Indian movement sought political coordination between groups to combat the deceptive land agreements that whites struck with random tribal members.

The Battle of Tippecanoe, fought on November 7, 1811, is often viewed as a prelude to the War of 1812. Governor of the Indiana Territory William Henry Harrison marched 1,000 regulars and volunteer militia toward the native village known as Prophet’s Town with the intent to destroy it and deprive Native Americans of a suspected base of operations. Native Americans met the force and suggested a parley. Harrison’s forces camped some way outside the town. Native forces attacked at night, killing nearly two hundred soldiers, but Harrison’s forces rebounded and with their greater numbers dispersed the attackers and proceeded to advance and burn Prophet’s Town.  The battle further damaged Anglo-American relations, as Britain was castigated for supplying weapons to the Native forces.

Explanation:

please mark me as brainliest thank you

In 1550, which regions were colonized?

Answers

Answer:

Spain Portugal Netherlands France and England

What’s an example of mandate

Answers

Hello There!

Definition :

Mandate -

Is a command to do something.Is the power opposed by a governer.Mandate also relates to mandatory commands.Also referes to a head authorization or colony when it comes to governing and owning.

Examples :

1.Appointed, public teaching requirements.

2.A political command given by an authorization.

3.An order from the government.

Hope This Helps!!

Thank you!! Good Day! ♡

What is the area of the base of a cylinder with a volume of 174π in.3 and a height of 12 inches?

1. Apply the formula for the volume of a cylinder: V = Bh

2. Substitute the known measures into the formula: 174π = B(12)

3. Apply the division property of equality:
174π
12
= B
12
12

The area of the base of the cyclinder is
π in.2.

Answers

Answer:

14.5 in²

Explanation:

A cylinder is the locus of a line moving parallel to the axis and at a fixed distance from the axis.

The volume of a cylinder (V) is:

V = πr²h, where h is the cylinder height, r is the radius of the base.

But The base area (B) = πr², hence

V = Bh

Given that height (h) = 12 inches, volume (V) = 174π in³, the base area us gotten using:

V = Bh

174π = B(12)

Dividing both sides by 12:

174π / 12 = B(12) / 12

B = 14.5π in²

Hence the area of the base of the cylinder is 14.5 in²

George Washington talked about foreign alliances in his farewell address. How did George Washington feel about foreign alliances?
A.
He believed alliances were the best chance at protection.
B.
He did not want to see permanent foreign alliances.
C.
He only wanted the U.S. to form alliances with European nations.
D.
He did not want to form alliances with nations already at war.

Answers

Answer:

d because he did not like the war

Explain how the facts of Santa Fe Independent School District v. Doe and
Engle v. Vitale (1962) led to a similar holding in both cases

Answers

Answer:

Both cases established limits on public schools' actions based on the First Amendment. In both cases, the Supreme Court ruled in favor of limiting religious expression in public schools. C. In both cases, the Supreme Court ruled that the Bill of Rights does not apply to students in public schools.

Explanation:

helots why is it important to sparta?

Answers

Its important because it’s there land they wanted to defend themselves
They wanted too defend themselves


Which is the correct order for impeachment proceedings?
The Senate brings charges of misconduct; the official is removed.
The House brings charges of misconduct; the Senate holds an impeachment trial; the official is
removed if found guilty.
The Senate brings charges of misconduct; the House holds an impeachment trial; the official is
removed if found guilty.
The House brings charges of misconduct; the official is removed.

Answers

the second one, the house brings charges, then the senate votes on them, then (if the senate votes it) the official is removed. hope this helps!
Other Questions
which graph could represent a function ? ? The athletic departments at 10 randomly selected U.S. universities were asked by the Equal Employment Opportunity Commission to state what percentage of their nursing scholarships were presently held by women. The responses were 5, 4, 2, 1, 1, 2, 10, 2, 3, 5. what is the midrange Can someone answer these two problems?? Pls answer both I really need help... Can someone help me pleas Word count: 200+ wordsIntroductory sentencesConcluding sentencesSupporting details:Who was the inventor?What did he invent?Where did he invent it?When did he invent it?How does it work? Please help me ASAP Can anyone give me 1-2 sentences for an opening to a story relating to this picture? Will give brainliest for the best one:) 2 examples of peer pressure in The Sneetches How do the dwarfs react to Snow White's appearance in their home?A: The dwarfs demand that Snow White leave the cottage and return to the woods.B: The dwarfs are relaxed because they are used to visitors.C: The dwarfs admire her beauty and leave her undisturbed.D: The dwarfs are angry when they realize that their beds have been slept in. Find the value: 3/2 5/8 (write your answer as a fraction AND as a decimal number) decode CCGCTTTCGCTATTATAAAAAGGGCTATAACTA solve for z: -21 = z - (-6 - 2z) What evidence show that Judaism unified the Jewish A history question ????help Which graph represents all of the solutions of A delivery truck drove 52 miles per hour. It took 4 hours to travel between two towns. What is the distance between the two towns? Use the equation dert, where d is distance, r is rate, and t is time. The distance between the two towns is miles. PLEASE HURRY IM ON THE FINAL BEING TIMEDThe group of Muslims that believed in electing a new leader that would strictly follow Muhammads example were called __________.A.ShiitesB.SunnisC.AlisD.CaliphsPlease select the best answer from the choices providedABCD Energy that depends upon object mass and object height. How did African Americans take advantage of their new political rights, and what affect did this have on American politics