the 3rd consumer level in the food chain is never normally eaten explain what usually becomes of them.​

Answers

Answer 1

Answer:

Plants and algae make their own food and are called producers. Level 2: Herbivores eat plants and are called primary consumers. Level 3: Carnivores that eat herbivores are called secondary consumers. Level 4: Carnivores that eat other carnivores are called tertiary consumers.

Explanation:

.....


Related Questions

Please explain what osmosis is?

Answers

movement of a solvent (such as water) through a semipermeable membrane (as of a living cell) into a solution of higher solute concentration that tends to equalize the concentrations of solute on the two sides of the membrane.

(hope this helped)

Answer:

osmosis is a special type of diffusion that is the movement of WATER particles from an area of high concentration to and area of low concentration across a semi-permeable membrane

Explanation:

Transcribe the following DNA strand into mRNA and translate that strand into a polypeptide
chain, identifying the codons, anticodons, and amino acid sequence.
DNA: CGATACAATGGACCCGGTATGCGATATCC

Answers

I don’t feel like answering all that but....
C=G G=C T=A A=U
C=G A=T dont know the rest have a gcodocododd dday

The air in the thermosphere is composed of atoms of _____ that are very far apart from each other.

Answers

Answer:

Explanation:

In the upper thermosphere, atomic oxygen (O), atomic nitrogen (N), and helium (He) are the main components of air.

Energetic ultraviolet and X-ray photons from the Sun also break apart molecules in the thermosphere. In the upper thermosphere, atomic oxygen (O), atomic nitrogen (N), and helium (He) are the main components of air there ya go son

What is a society that is able to survive and function over a specified time?​

Answers

Answer:because time and society are different

Explanation:

Plant cells are classified as

pluripotent
omnipotent
multipotent
totipotent

Answers

Answer:

pluripotent i think sorry if I'm wrong

People are more likely to seek treatment if they
A. are in a minority
B. live in a rural community
C. have medical insurance
D. have a diagnosis

Answers

Answer:

C. have medical insurance

Explanation:

People are more likely to seek treatment if they D. have a diagnosis as it helps in the treatment of disease.

The clinical diagnosis lets in a clinical expert chart a listing of clinical signs after which evaluate them to different data. A high-quality fitness final result is primarily based totally one scale of being alive and not using a long-time period results to death.

What is the diagnosis?

The act of spotting a disorder from its symptoms and symptoms and signs the realization this is reached following and trying out .The prognosis turned into pneumonia.

Thus it is well explained.

To learn more about the medical insurance refer to link :

https://brainly.com/question/1941778

Someone smart PLS HELP!!!!!!!!!!!!! Uranium-235 is a popular choice of fuel for nuclear reactors. But U-235 doesn't always fission the same way. Below are three ways it can split. Complete the nuclear equations so they balance.
fill in the blank line(s) pls pls pls pls pls pls help!!!!!!!

Answers

I’m 90% this is right

Sorry if I’m wrong

Phenotypes are the
observable characteristics of an individual (ex:
curly hair)

or

genetic representation of a an individual (ex: Hh)

Answers

Answer:

phenotype are the observable characteristics of an individual (ex:curly hair)

compare the chemical equations for photosynthesis and cellular respiration explain how the two processes are interrelated

Answers

Answer: Photosynthesis makes the glucose that is used in cellular respiration to make ATP. The glucose is then turned back into carbon dioxide, which is used in photosynthesis. While water is broken down to form oxygen during photosynthesis, in cellular respiration oxygen is combined with hydrogen to form water

Explanation:

Peoples choices can sometimes have negative effects on their own health as well as the health of your well-being of others describe to these choices explain how they can impact the individual and others

Answers

Answer

a good environment could mean better people better love and kindness bad environment could mean problems in your future and/or daily life this can affect everybody and anybody

Explanation:

Is the troposphere high or low and what is the temperature there only answer if you know it

Answers

Answer: High

Explanation:

The average temperature of the troposphere is 62°F (17°C), Pls give thanks because I got hack

BRAINLIEST:
in which month is a hurricane most likely to occur: October or December? explain

Answers

Answer:

October

Explanation:

October is one of the hurricane season months

What is the electrical charge of the nucleus of an atom that has 11 protons , 12 neutrons , and 11 electrons ?

Answers

Answer:

The 11 positive protons cancel out the 11 negative electrons, and the overall charge of the atom is zero. So it neutral

Explanation:

I hope this helps!!

The nucleus of an atom has only protons and neutrons. Since the neutrons are neutral, the charge on the nucleus, in this case, would be +11.

What is the atomic charge?

The difference between the number of electrons and protons in an atom is defined as the charge on that particular atom. An atom has three sub-atomic components. These are electrons, protons and neutrons.

The electrons are negatively charged, the protons are positively charged and the neutrons are neutral.

Because the neutrons are neutral, the increase or decrease in the number of electrons or protons affects the charge on an atom. If the number of protons is higher, the atom will be positively charged. If the number of electrons is higher, the atom will be negatively charged.

The protons and neutrons are present in the nucleus of an atom and the electrons are present in atomic shells.

Therefore, in a nucleus with 11 protons, and 12 neutrons, the charge will be +11

Read more about atomic charge, here https://brainly.com/question/5308494

#SPJ6

A 100 kg box is initially at rest on a level surface. One 10 N force acts on the box , directed toward the right. A second 10 N force acts simultaneously on the box , directed toward the left , as shown.

Answers

The box would stay at rest where it lies since the same amount of force is pulling it in opposite directions :)

Since 10 N forces are acting from both sides, these are balanced forces and the box will not move because balanced forces are acting on it. So the correct option is D.

What are balanced forces?

Forces that are equal in magnitude and opposing in direction are said to be balanced forces. Equilibrium is seen as a condition of balanced forces. There is no shift in direction when the forces are in balance.

Balanced combined forces have always been equal to zero. These are vectors for merging. Balance forces cannot alter an object's momentum or direction.

An item is kept traveling at a constant speed by a balanced force. In it, Newton's First Law of Motion is explained. A good illustration of a balanced force is a book on the table. The normal force (support force) of the table balances out the weight of the book. The two forces are exactly equal and opposed to one another.

While forces that are balanced can keep an item at rest or move at a steady speed, unequal forces can cause things to accelerate.

Therefore the correct option is D.

Read more about balanced forces, here

https://brainly.com/question/19127263

#SPJ5

In a chemical analysis of a sample of animal tissue, which element would most likely be found in the smallest quantity?

Answers

Answer:

Iodine

Explanation:

Iodine is needed by animals because the body's metabolic rate is controlled by the action of an iodine hormone, called thyroxine, which is secreted by the thyroid gland in the neck.

If the animal fails to supply enough iodine through food to be able to make a normal amount of this compound, then the thyroid gland enlarges or expands trying to create enough, resulting in a common type of goiter.

Helpp mee please and thankss!!

Answers

D. Radioactive decay

Hope it helps

Answer:

B. Solar Radiation

Explanation:

Which of the following statements regarding prokaryotic and eukaryotic cells is true

Answers

Answer:

I would need the statements to answer that. however prokaryotic cells are plant cells and eukaryotic cells are animal cells

Answer:

They are typically smaller than eukaryotic cells. The DNA of a prokaryotic cell is contained in the nucleoid. There are several ways in which prokaryotic cells are different from eukaryotic cells. Firstly, they are generally smaller in size, their organelles are not membrane bound, and they have no nucleus. They, however, share commonalities with eukaryotic cells including the presence of a bilipid plasma membrane, presence of ribosomes and DNA.

Hope this helps, have a great day/night, and stay safe!

Bone is not a solid matter.
OA
True
O B. False

Answers

Answer:

FALSE

Explanation:

commen sense

Hello,

The answer is True.

Further explaining:

Bones are actually hollow tubes, if they were solid it would be a lot heavier. A adult usually has 206 bones which are hollow.
Hope this helps!
Brainliest?

Compare asexual and sexual reproduction. Place each statement into the correct box.

Answers

Answer:

Explanation:

asexual doesn't require a mate or another thing to reproduce. sexual requires another thing to reproduce like a male and female

Answer:

During asexual reproduction, the organism that is reproducing spits in two.

A sea anemone reproduces asexually.

During sexual reproduction, there are two organisms(male and female) that are part of the reproductive process.

Humans reproduce sexually.

Explanation:

What do the enzymes in excision repair systems do?

A destroy cancer cells
B cut off telomere sections
C replace dna damaged by chemicals
D replace rna primers with dna

Answers

B would be the answer I think

what are the inputs and outputs of the reaction

Answers

Answer:

The inputs are carbon dioxide from the air and the ATP and NADPH produced by the light reactions. The cycle's output is an energy-rich sugar molecule. The Calvin cycle uses carbon from the carbon dioxide, energy from the ATP, and high-energy electrons and hydrogen ions from the NADPH.

Explanation:

The light reactions, which occur during photosynthesis, have specific inputs and outputs. The inputs of the light reactions include light energy and water. The outputs of the light reactions are ATP (adenosine triphosphate), NADPH (nicotinamide adenine dinucleotide phosphate), and molecular oxygen.

Light energy is absorbed by the chlorophyll pigments in the thylakoid membranes, while water molecules serve as a source of electrons for the photosynthetic electron transport chain.

ATP is a high-energy molecule that serves as the primary energy source for cellular processes. NADPH is a coenzyme that carries energized electrons and plays a role in the synthesis of carbohydrates during the subsequent dark reactions of photosynthesis. Molecular oxygen is a byproduct of light reactions and is released into the atmosphere as a waste product. Together, these outputs provide the energy and reduce the power needed for the synthesis of organic molecules during photosynthesis.

Therefore, the inputs of the light reactions include light energy and water. The outputs of the light reactions are ATP (adenosine triphosphate), NADPH (nicotinamide adenine dinucleotide phosphate), and molecular oxygen.

For more details regarding light reactions, visit:

https://brainly.com/question/13349357

#SPJ6

has anyone done this worksheet? i need help with it. thanks:)

Answers

I have done it I think
try scanning it with the google app with text and usually answer keys pop up good luck!

Luke travels 50km in 2.5 hours on his bike. What is his velocity?

Answers

Answer:

20 km/hour

Explanation:

d/m=V

50 km / 2.5 hours = 20 km/hour

Explain how diffusion and osmosis are related to the symptoms of cystic fibrosis

Answers

Answer:

Answer D

Explanation:

just took the test.

Which of the following processes begins when a star enters the main sequence?
a


Nuclear fission
b


Nuclear fusion
c


Condensation of a nebula
d


Appearance of a supernova

Answers

Answer:

i believe it is B: Nuclear Fusion

Explanation:

Answer:

C. Nuclear Fusion

Explanation:

I am 1000000000% sure this is correctamundo, stay cool, and have a great day!

when benedicts solution is added to a sucrose solution and put into a boiling water-bath , no change in color is observed

state why no color change is observed

Answers

Answer:

b

Explanation:

Use chromosomes 11 and 17 to answer the following questions. Chromosome Map Chromosome 17 is made of over million base pairs. Approximately how many genes are found on chromosome 17? List the genetic disorders found on chromosome 17. What do you know about any of those disorders?

Answers

Answer:

Hello!

Chromosome 17 is made of over 80 million base pairs.

Approximately how many genes are found on chromosome 17? 1600

Explanation:

Chromosome 17 is made up of more than 80 million base pairs. Approximately, 1600 genes are found on chromosome 17. The genetic disorders found on chromosome 17 are as follows:

Breast cancer.Neurofibromatosis.DNA damage response in individuals.Scoliosis.Congenital heart anomalies.

What are Chromosomes?

Chromosomes may be defined as thin, thread-like structures that may appear in the nucleus of the cell during the process of cell division. These structures may contain DNA, RNA, histones, and non-histone proteins. Chromosomes may be discovered by E. Strasburger in 1875.

Human chromosome 17 is implicated in a wide range of human genetic diseases. It is home to genes involved in many genetic disorders that may affect the physiology of an individual. They are very severe to organisms.

Mosaic trisomy 17 is a rare chromosomal anomaly syndrome, with a highly variable clinical presentation, mostly characterized by growth delay, intellectual disability, body asymmetry with leg length differentiation, scoliosis, and congenital heart anomalies.

To learn more about Genes and chromosomes, refer to the link:

https://brainly.com/question/29393001

#SPJ2

Describe some of the properties of water and explain how the structure of water is responsible for these properties.

Answers

Answer:

The main properties of water are its polarity, cohesion, adhesion, surface tension, high specific heat, and evaporative cooling. A water molecule is slightly charged on both ends. This is because oxygen is more electronegative than hydrogen. ... The stream of water bends due to the polarity of water molecules.

Explanation:

Which of the following does not contribute to erosion?
O Lava
Olce
O Wind
O Water

Answers

Lava..

got it right on edge 2020

Chemicals and proteins in the cell read the DNA ___________ for building that make cells, tissue and organs.
(A.Instructions
(B.Genes
(C.Recipe
(D. Life manual

Answers

You answer will be B!! Good luckkk!

Genes of DNA can be read by chemicals and proteins for building that can make cells, tissue, and organs. Therefore, option "B" is correct.

What are genes?

Genes are composed of  DNA which is the genetic material. Gene is the functional unit of heredity. Chromosomes are comprised of multiple genes. Genes code for a particular trait. More than one gene can code for a particular trait.

The function of DNA and RNA is controlled by genes. There are more than 3000 genes present. Mutation can occur in genes. Deletion and insertion are some types of mutation genes. Transposomes are called jumping genes. Sickle cell anemia and cystic fibrosis are some examples of gene mutations.

Genes code for the traits such as the color of eyes, height quality of hair, and more.

Learn more about genes, here:

https://brainly.com/question/31121266

#SPJ2

Other Questions
Please help me with this question Which expression can be used to determine 50% of 42? 42 minus 2 42 divided by 2 42 divided by 10 42 minus 10 a researcher is studying the effects of playing chess on memory improvement. he identifies 50 people who play chess and 50 people who do not. each of the 100 people is given a questionnaire designed to determine memory level. none of the 100 people who participated in the study knew they were part of a study. which statement is true. 11Find the arc length of the semicircle.Either enter an exact answer in terms of toruse 3.14 form and enter your answer as a decimalunitsShow Calculator Solve this math problem first you get a free crown! 13/19 - (-1/9) A. -12/19B. -14/19 C. 14/19D. 12/19 6th grade math help me pleaseeee Dante wants to read a 425-page book in 3 days. He reads 178 pages on Monday and 146 pages on Tuesday. He wants to determine how many pages, p, he will have to read on Wednesday. what do immigrants have to do when they first come to america If u are at a store and the original price of a product is $28.95 and the sales tax is %6.5 what is the final price Which of the following is not a type of biological contamination?A)bacteriaB)protozoaC)virusesD)herbicides The admission booth at the show requires each person to enter their age. Then the following program executes (See image.): When age = 16, what action would the program execute?A. print 16 B. print Student price is $8. C. print 14 D. print Student price is $14. Please help meee (*^*)/ PLEASE HELP ASAPLouis earns a base monthly salary of $1,200 with 5% commission on sales. For a month with $25,000 in sales, what are Louis's total earnings? What can you say about the quotation "BROADENING YOUR PERSPECTIVE CAN BE LIFE-ENHANCING"?do you agree with this?rush lang po slamat Our towns Shade Tree Commission is responsible for the care and maintenance of trees growing on town property, including parks and recreational areas. The Commission also supposedly reviews and approves plantings around new construction and oversees tree removal at building sites. Something is going wrong, though. The trees are disappearing. Our town, once characterized by beautiful greenery, is beginning to look like a wastelandall for the sake of commerce.A new shopping area was just built on a wooded lot. The shade trees on the towns right-of-way should have been preserved. Instead, all 57 trees on the lot were taken down. The Shade Tree Commission demanded that the developer be fined and new trees be planted along the right-of-way. But perhaps the Commission should have paid attention in the first place! Our town is known for its tree-lined streets and park-like properties. Should we sit idly by while commerce is allowed to blight the landscape? 1. What is the writers claim in this argument? 2. What is one piece of evidence supporting the writers claim? identify and measure six items in the home that are measured in imperial units What is the endangered classification status of the Western Lowland gorillas? Magic Johnson my dad saw him play was born in 1959 in Lansing, Michigan.Where should the parentheses be placed? Find the equation of the axis of symmetry of the following parabola algebraically.y=-3x^2-6y=3x 2 6 Could someone help me with this?