TACTTAGAGGCACCACATGGGCCTTGCACT to mRNA

Answers

Answer 1

Answer:

I don't know the answer

Explanation:

is is this even a question cos I don't think so.


Related Questions

Use the graph and the table above to complete the table by estimating the amount of energy transferred near location B.

A.
1600 kilojoules

B.
300 kilojoules

C.
800 kilojoules

D.
400 kilojoules

E.
3200 kilojoules

Answers

The answr is A
Step explain
The answer is A 1600 kilojoules

What is the definition of "earth overshoot day?"

Answers

Answer: Earth Overshoot Day is the calculated illustrative calendar date on which humanity's resource consumption for the year exceeds Earth’s capacity to regenerate those resources that year. The term "overshoot" represents the level by which human population overshoots the sustainable amount of resources on Earth.

What he saiddhdhshshshshdhdjdjdjdjdjd

Which circuit would have the most electrical power?

OA 12A

V0.14 V

oBi22A

0.19 V

O20A

V0.17V

O116A

V025y

025v

Answers

Answer:

the answer is oa 12a

\

Explanation:

SUBJECT SCIENCE: how could the rocks from the Rocky Mountains and the Great Plains have such similar composition? (WRITE AT LEAST 5 SENTENCE)

Answers

It might also be possible that the rock of the Rocky Mountains formed from the rock of the Great Plains if the Great Plains rock were somehow carried underground to where energy from Earth's interior could melt it into magma. Matter gets transformed by energy, but the same matter is still present.

name two types of silkworms that are fed on mulberry leaves​

Answers

Bombyx Mori L
It’s only one that I’m very sure of I hope this helps


Explain how the stomach Depends on other body systems to carry out its role in breaking down food molecules.

Answers

The whole body works together, as a “team.”If one of the parts of the body won’t work together as a team, everything will get messed up. The stomach muscles churn and mix the food with digestive juices that have acids and enzymes, breaking it into much smaller, digestible pieces. An acidic environment is needed for the digestion that takes place in the stomach.

Which of the following environmental parameters would be important to monitor in order to ensure sustainable logging?

A. The number of trees cut down versus number trees burned
B. The number of new trees planted to replace those removed
C. The number of trees needed to increase soil fertilization
D. The number of trees removed within a single species

Answers

Answer:

B. The number of new trees planted to replace those removed

Explanation:

Because to ensure that logging is sustainable, they have to sustain a certain ratio of trees cut down, to trees planted. D. The muber of trees removed within a single species could be right, but I think B is more right.

If you get this wrong you can blame it on me.

Answer:

The number of new trees planted to replace those removed

Explanation:

what is the dakota access pipeline

Answers

Answer: The Dakota Access Pipeline (DAPL) or Bakken pipeline is a 1,172-mile-long underground oil pipeline in the United States. It begins in the oil fields of the Bakken formation in northwest North Dakota and continues through South Dakota and Iowa to an oil terminal near Patoka, Illinois.

Explanation:

Plant cells are different from animal cells because they are usually -

Answers

A plant cell contains a large, singular vacuole that is used for storage and maintaining the shape of the cell. Animal cells have many, smaller vacuoles. Plant cells have a cell wall, as well as a cell membrane. Animal cells have a cell membrane, but NO CELL WALL.

Answer:

Plant cells have a large, singular vacuole that is used as a storage and to maintain the shape of the cell.  Even though animal cells have vacuoles, they are smaller.  Plant cells have a cell wall and a cell membrane.  Animal cells only have a cell membrane, and no cell wall.

Explanation:

Science. Help I really need this giving brainliest to the person with the correct answer, please explain your answer...........

Answers

Answer:

A and B

Explanation:

Fossil fuels, such as oil and natural gas, are primarily formed from the remains of what?
phytoplankton
mammals
bacteria
dinosaurs​

Answers

Answer:

phytoplankton

Explanation:

Answer:

Its phytoplankten.

Explanation:

I hope I spelled it right

Which individual's reasoning do you agree with more and why?

Answers

Answer:

Your question doesn't make sense. Who is the individual in question?

Explanation:

true or false:

Fish are considered carbon-based organism

Answers

Answer:

Its how you see it.

Explanation:

1.Life on Earth is based on carbon, likely because each carbon atom can form bonds with up to four other atoms simultaneously. This quality makes carbon well-suited to form the long chains of molecules that serve as the basis for life as we know it, such as proteins and DNA.

2.All life on earth can be thought of as "carbon-based." Just be careful about turning this around backwards. It is true that all living things contain carbon compounds... but the opposite is not true. Just because a certain material is referred to as organic does not mean it is or ever was alive.

PLS HELP!!!
During science class, Sofia drew a picture similar to the one above. Which phrase would appear in the caption box on the right side of the figure?

Group of answer choices

low sound

long wavelength

short wavelength

low frequency

Answers

Answer: low sound

Explanation:

explain the process of DNA extraction and gel electrophoresis

Answers

Answer:

The process of that same framework in question is defined below.

Explanation:

The DNA was indeed prepared by mixing with either a dye as well as a radioisotope which enables the gel to have been recognized. The specific filaments would then be differentiated from one another DNA electrophoresis. The procedure occurs with the injection including its completely separate genetic code into boreholes that have already been reduced either at the final moment including its gel pavement.

Which two structures are found at the outside of the cell?

Answers

Answer:

All cells share common components: (1) a plasma membrane, an outer covering that separates the cell's interior from its surrounding environment; (2) cytoplasm, consisting of a jelly-like region within the cell in which other cellular components are found; (3) DNA, the genetic material of the cell.

Only answer if you know the answer

Answers

Answer:

B. A helicase enzyme unwinds the DNA molecule, then corresponding nucleotides are added to the separated original strand forming two separate semiconservative molecules

Explanation:

DNA Replication is an important phenomenon as far as cell division is concerned. It is the process whereby a DNA molecule doubles its content or forms two DNA molecules from one.

In the semi-conservative model of DNA replication, an enzyme called DNA helicase unwinds the double stranded DNA molecule into two single strands. The single strands are then used as template for DNA polymerase to synthesize another molecule of DNA. Hence, two separate DNA molecules comprising of one old strand and one new strand.

what happens to the chemical bonds during chemical reactions

Answers

During chemical reactions, the bonds that hold molecules together break apart and form new bonds, rearranging atoms into different substances. Each bond requires a distinct amount of energy to either break or form; without this energy, the reaction cannot take place, and the reactants remain as they were. Simplisticly said During chemical reactions, the chemical bonds between atoms are altered.

why does food get cold but drinks get hot​

Answers

Answer:

it might be because of the room temperature.

Explanation:

since drinks are colder than the room temperature they will get warmer to be the same as the room temperature and because food is hotter than room temperature it gets colder to be the same as the room temperature. dont quote me on that just a guess

5. The lion researchers in the film have studied 20% of the park and identified 41 lions. (Show your
work/justify your answer for each section.)
a. The entire Gorongosa park is 4,000 km². Approximately how large (in km) is the portion of
the park that has been studied?
ASAP PLSS

Answers

Answer:

800 km²

Explanation:

If the researchers have studied 20% of the 4000 km² park, to find out how much of the park in km they have studied, all you have to do is find 20% of 4000.

4000 x .20 = 800

800 km² is your answer.

If the area of the entire Gorongosa park is 4,000 km². Among which, 20% of the park is already studied, it means 800 [tex]km^2[/tex].

What do you mean by the researcher?

A researcher may be defined as a kind of person who significantly carries out academic or scientific research in order to find some unrevealed data and information.

According to the question,

The total area of Gorongosa park = Gorongosa park is 4,000 km²

The area which is already studied = 20%.

Now, you have to find the area that is already studied in km. So, you have to calculate the 20% of 4,000 km².

The area which is already studied = 4000 × .20 = 800 [tex]km^2[/tex].

Therefore, if the area of the entire Gorongosa park is 4,000 km². Among which, 20% of the park is already studied, it means 800 [tex]km^2[/tex].

To learn more about Researchers, refer to the link:

https://brainly.com/question/28136063

#SPJ2

What are the metric units for acceleration?

Answers

Answer:

meter per second squared

Complex food molecules that are consumed by organisms must be broken down in order to be used by cells to support growth or release energy.
True
False

Answers

Answer:True

Explanation:

The complex molecules are broken down by the digestive system. If the molecules were not to be broken down they would block the system

Answer:

TRue

Explanation:

explain the process of digestion abd absorption of carbohydrates.​

Answers

Explanation:

the food u eat will goes from oesophagus to ur stomach and then it is mixed by hcl present in your stomach that makes the medium acidic for pesin to digest protein and then bile juice from liver makes the medium alkaline and breaks the larger globules of carbohydrates for enzymes then the food goes goes to small intestine that secretes intestinal juice that converts carbohydrates into glucose

why are there so many stages in meiosis?

Answers

Answer:

In many ways meiosis is a lot like mitosis since cell division occurs twice during meiosis one starting cell can produce four gametes ( egg or sperm ) in each round of division cells go though four stages prophase, metaphase anaphase, and telophase

Explanation:

Select the group of organelles that is common to both plant cells and animal cells.
A.
cell wall, cell membrane, mitochondria
B.
cell membrane, mitochondria, cytoplasm
C.
cytoplasm, mitochondria, cell wall, nucleus
D.
nucleus, cytoplasm, chloroplasts

Answers

It would be B because both plants and animals both have that in their cells

Answer:

B

Explanation:

Both cells have cell membranes, mitochondria ( they both do cellular respiration), and cytoplasm for structure

PLEASE ANSWER.

Purple is dominant to white. A flower with the alleles PP (purple) is
crossed with a flower with alleles pp (white). What is the percent chance
that their offspring (babies) will be purple?

0%
50%
100%

Answers

Answer:

100% P is dominate there for all matches will be Pp this mean it will either be purple or a mixture of both (pink)

Explanation:

the chances will be 100% Purple flowers

Help me :(( please. It’s due soon

Answers

The answer is C barriers around mating

Answer:

I would guess B or C

Explanation:

I hope this helps

Evaluate the evolutionary benefits of regulating an internal variable, such as body temperature, versus the cost.

Answers

Answer:

The benefits of being able to regulate the internal body temperature are many and it is considered a beneficial evolutionary character, since in this way the living organism is better maintained in relation to the environment, and it achieves better balance.

Reptiles cannot control their internal temperature, it depends on the external one, that is why to warm their body they need to be in the sun, and to cool down in the shade or in temperate places.

This is a little evolutionary characteristic since the environment is very changeable and the right or ideal temperature for the organism could not be controlled.

Explanation:

Faced with climatic catastrophes or extreme situations, living organisms cannot depend on the great climatic variants, in very cold situations one enters hypothermia and in very hot conditions the proteins are systematically denatured, entering a thermal shock.

A species of elm has winged-seeds. How would biologists explain how a species of elm with winged-seeds evolved from an ancestral elm species without winged-seeds

Answers

Answer:

In an ancestral elm species, mutations gave rise to the phenotypic trait "winged-seeds". Subsequently, selection favored elm plants with winged-seeds that diverged over time to become a separate species

Explanation:

A mutation is a genetic change in the DNA sequence. In general, mutations have a negative impact on the fitness of the individual (i.e., mutations are generally deleterious) and therefore they disappear from the population. However, there are situations where mutations are beneficial and confer an adaptive advantage, thereby increasing their frequency in the population. In this case, mutations associated with the formation of winged-seeds conferred an adaptive advantage (i.e., higher seed dispersal capacity) to individuals who had this phenotypic trait, thereby these individuals had more chances to reproduce and pass their genes to the next generation. Eventually, Elm plants with winged-seeds accumulated sufficient genetic differences to prevent interbreeding, leading to the formation of a separate species.

Which statement best describes the overall chang
O One cell becomes two cells that have identical
OOne cell becomes two cells that have different
O Two cells become tWo cells that have identical
O Two cells become two cells that have different

Answers

Answer:number one

Explanation:

Other Questions
Solve for sss:-0.2=s+\left(-0.8\right)0.2=s+(0.8) Solve the equation: 2 (x + 2x) - 36A) X=-18B) x = 18cx = -6D) x = 6 Let T: P2 P3 be the transformation that maps a polynomial p(t) into the polynomial (t-2)p(t). a. Find the image of p(t) = 2-t + t^2 b. Show that T is a linear transformation. c. Find the matrix for T relative to the bases (1, t,t^2) and (1,t,t^2,t^3). Markers were placed at altitudes of 10 and 15 feet below sea level Enter the integer that represents the altitude closer to sea level 11.) Is the equation below linear or nonlinear?Y=9x-5 A train travels at a speed of 35 miles per hour. How far will the train travel in 5 hours?This is Math Survival Story Snap ShotDirection: Grab your "Mountain Chart Survival Story that you completed last class. Use the Mountain Chart to create a snapshot of your survival story. Be sure toinclude all of the actions listed on your Mountain Chart Each box should show a part of your story Be creativeEstablishInitial ActionRising ActionClimaxFating ActionResolution/Ending A video game store was getting rid of old games, selling them 5 for $73.50. If they sold 3 games, how much moneh would they have made? What is perspective about slavery, and does it still affect African-Americans in today's society? This is for English class. Would a ship in Lake Ontario (fresh water) float higher or lower in the water than in the Atlantic Ocean (salt water)? Calculate the volume, in liters, occupied by 1.80 moles of H2 gas at STP. Ammonite fossils are not found in the top two layers. What does this mean? I need help please n thanks write the equation in slope-intercept form of the following table If there were 1,593 Ronald McDonald's in the McDonald's, how many could fit? Which expression would be easier to simplify if you used the associative property to change the grouping?A.(160+40)+27(160+40)+27B.0.85+[0.15+(-\frac{1}{3})]0.85+[0.15+( 31 )]C.[(-\frac{1}{3})+(-\frac{2}{3})]+(-\frac{4}{5})[D.1 + ( 3/4 + ( - 3/4) brainliest if right and its on ap..ex Spencer is going to work for his first political candidate. The candidate he has chosen to back supports the idea that the national government should stay out of the business of the individual states and that states should have greater freedom to make laws and initiate programs that suit the needs of its citizens. To what political party does Spencers candidate belongRepublicanDemocraticState RightersIndependent the product (2x^4 y) (3x^5 y^8) is equivalent to: In order to justify your stance, you must _____A. develop an ideaB. provide evidenceC. make a predictionD. evaluate an argument 9. A cell phone can be purchased from the manufacturer for $160. The online retailer has astandard markup of 30%, and the store has a standard markup of 40%.(a)What is the price of the cell phone when purchased online?(b)What is the price of the cell phone when purchased at the store?(c) Which is the better deal?