solve for [tex]tan\frac{17\pi }{12}[/tex]

Answers

Answer 1

After calculating , The value of given expression is -3.73

What is Tanx in terms of sinx and cosx?

Tanx can be defined as the ratio of sinx and cosx or tanx also can be defined as the ratio opposite side and adjacent side.

Given

expression,

tan(17pi/12)

The value of pi = 180

so by putting the value we get,

tan(17*180 / 12 )

tan ( 3060 / 12 )

as we know the value of 3060/12 = 255.

tan(255)

= -3.73

so we got the value of tan(255) is -3.73 approximately

Hence, The value of given expression is -3.73

To learn more about Tanx from the given link.

https://brainly.com/question/13329070

#SPJ1


Related Questions

The perimeter of an isosceles trapezoid is 40 ft. The bases of the trapezoid are 11 ft and 19 ft. Find the area of the trapezoid. Hint: Think characteristics of isosceles trapezoid

Answers

The area of an isosceles trapezoid is 45 square ft.

We have to evaluate the area of trapezoid.

The perimeter of an isosceles trapezoid is 40 ft.

The bases of the trapezoid are 11 ft and 19 ft.

The perimeter of an isosceles trapezoid = a + b + c + d

a, b, c and d all are sides of an isosceles trapezoid.

a + b + c + d = 40

According to question, c = d

11 + 19 + c + c = 40

30 + 2c = 40

Subtract 30 on both side, we get

2c = 10

Divide by 2 on both side, we get

c = 5 = d

The formula of area of an isosceles trapezoid is

A = [tex]\frac{1}{2}[/tex](a+b)h, where a and b are bases and h is the height.

We can see on the diagram that we can use Pythagorean theorem to find the height.

According to theorem;

[tex]c^2=a^2+b^2[/tex]

[tex](5)^2 = h^2+(4)^2[/tex]

25 = [tex]h^2[/tex] + 16

Subtract 16 on both side, we get

[tex]h^2[/tex] = 9

Taking square root on both side, we get

h = 3

The height of an isosceles trapezoid is 3 ft.

Now, the area of an isosceles trapezoid is

A = [tex]\frac{1}{2}[/tex](11+19)×3

A = [tex]\frac{1}{2}[/tex] × 30 × 3

A = 15 × 3

A = 45 square ft

To learn more about area of an isosceles trapezoid link is here

brainly.com/question/16379260

#SPJ4

i need help please i have been stuck on this problem for 2 months

Answers

Answer:

$8

Step-by-step explanation:

As part of a project about response bias, Ellery surveyed a random sample of 25 students from her school. One of the questions in the survey required students to state their GPA aloud. Based on the responses, Ellery said she was 90% confident that the interval from 3. 14 to 3. 52 captures the mean GPA for all students at her school.


Required:

a. Interpret the confidence level.

b. Explain what would happen to the length of the interval if the confidence level were increased to 99%.

c. How would a 90% confidence interval based on a sample of size 200 compare to the original 90% interval?

d. Describe one potential source of bias in Ellery's study that is not accounted for by the margin of error

Answers

It should be emphasized that this suggests that we are 90% certain that the mean GPA for all students at the institution is between 3.14 and 3.52

Sampling

If the confidence level were raised to 99%, something would happen to the interval's length, increasing it.

The difference between a 90% confidence interval based on a 200-person sample and the original 90% interval is that the latter is narrower.

Last but not least, having the students say their grades aloud could have introduced bias into Ellery's study, which is not taken into account by the margin of error. Some of them with lesser grades will start to lie as a result.

Learn more about sampling on:

brainly.com/question/17831271

#SPJ4

URGENT!!

Which of the 3 graphs to the left best models the path
of a firework given it didn't explode?
Note: The path may be going in a different direction,
perhaps reflected or translated vertically or horizontally
while maintaining the same shape.
Linear
Quadratic
Exponential

Explain your thinking.

Answers

The path may be Quadratic in nature.

What is a graph?

The path of a firework is modeled by a quadratic function. The firework ascends from point of launch with decreasing speed (negative acceleration due to gravity) until it reaches its maximum height and then starts dropping back to the ground at increasing speeds due to positive acceleration exerted by the force of gravity.

The flight path of the parabola can thus be modeled by height as a function of elapsed time

h = f(t) where f(t) is a quadratic equation in t with the general form being

a · t² +b · t  + c

We can easily eliminate the linear model since that implies the firework will ascend at a constant speed forever

The exponential model indicates that at the moment of launch the speed of the firework is constant and then it suddenly accelerates. However, we know from observation that the firework has the highest speed at the moment of launch

Do not be confused by the shape of the graph - it seems to indicate the firework shoots down and up.

Note: The path may be going in a different direction, perhaps reflected or translated vertically or horizontally while maintaining the same shape.

Indeed the actual path of the firework is a reflection of the graph about the x-axis. so that it is a downward-facing parabola. The vertex of the parabola is the highest y-value which is the maximum height the firework would reach.

The height would be the y-axis and the time t the x-axis.

To know more about the graph follow

https://brainly.com/question/15222840

#SPJ1

16 - x + x + 19 - x = 31

Answers

Answer:

X = 4

Step-by-step explanation:

We have to add like variables, so all the x variables will be added together. We get this:
-x + 35 = 31

Get x by itself.
-x = -4

Get rid of the negatives since what you do on one side you do to both sides.

x = 4

I hope this was able to help you out :D

16 (-x +x ) +19 + x = 31

16+19+x = 31

35+x = 31

x= -4

hey buddy i hope uh got an answer

How do I find the median of this trapezoid?

Answers

The median of the trapezoids is given by QR = 23.5 and VW = 15.2

What is a trapezoid?

The Trapezoid is a 4 sided polygon. Two sides of the shape are parallel to each other and they are termed as the bases of the trapezoid. The non-parallel sides are known as the legs or lateral sides of a trapezoid.

There are three types of trapezoids , and those are given below:

a) Isosceles Trapezoid

b) Scalene Trapezoid

c) Right Trapezoid

The area of the Trapezoid is given by

Area of Trapezoid = ( ( a + b ) h ) / 2

where , a = shorter base of trapezium

b = longer base of trapezium

h = height of trapezium

Given data ,

Let the first trapezoid be represented as A

Let the second trapezoid be represented as B

Now , the median of the trapezoid M = ( 1/2 ) ( sum of longer base and shorter base )

Substituting the values in the equation , we get

a)

The length of longer base = 35.6

The length of shorter base = 11.4

So , the median of A is QR = ( 1/2 ) ( 35.6 + 11.4 )

On simplifying the equation , we get

The median of trapezoid QR = ( 1/2 ) 47

The median of trapezoid QR = 23.5

b)

The length of longer base = 19.1

The length of shorter base = 11.3

So , the median of B is VW = ( 1/2 ) ( 19.1 + 11.3 )

On simplifying the equation , we get

The median of trapezoid VW = ( 1/2 ) 30.4

The median of trapezoid VW = 15.2

Hence , the median of trapezoid is solved

To learn more about trapezoids click :

https://brainly.com/question/12221769

#SPJ1

what is statistical risk? a board game in which you attempt to conquer the world by strategically positioning your armies to destroy your enemies so you can rub it in the face of your brothers or sisters for the rest of the vacation or weekend the long run probability that you will make a particular kind of mistake the prbability that a single flip of a coin will come up 'tails' none of the above

Answers

Statistical risk refers to the likelihood of an adverse event occurring, as determined through statistical analysis. This can include events such as financial loss, injury, or death. It is typically measured using probability, which is a value between 0 and 1 that represents the likelihood of an event occurring.

For example, in finance, the risk of an investment is often measured by the standard deviation of the returns over time. In healthcare, the risk of a particular treatment or procedure is often measured by the rate of complications or adverse events.

The board game you described, where the goal is to conquer the world, does not involve statistical risk. It is a game of strategy, and the outcome is determined by the players' decisions and actions, rather than by chance.

The long-run probability of making a particular kind of mistake is an example of statistical risk. For example, if a pilot has a history of making landing errors, we can use statistical analysis to determine the probability that they will make a similar mistake in the future.

The probability that a single flip of a coin will come up 'tails' is also an example of statistical risk. In this case, the probability of the coin landing tails is 0.5 or 50%.

In summary, Statistical risk is the likelihood of an adverse event occurring, as determined through statistical analysis. It is measured using probability, and it is used to understand and manage the risk in various fields such as finance, healthcare, and engineering.

To learn more about statistical risk

Visit; brainly.com/question/12934942

#SPJ4

Does someone mind helping me with problem? Thank you!

Answers

The number of people that attended the school play is given as follows:

Adults: 325.Students: 612.

How to model the situation?

The situation is modeled by a system of equations, for which the variables are given as follows:

Variable a: number of adults.Variable s: number of students.

There was a total of 937 people, hence:

a + s = 937.

s = 937 - a.

The total sales were of $1,109, hence:

2a + 0.75s = 1109.

Replacing s = 937 - a in the second equation, the number of adults is obtained as follows:

2a + 0.75(937 - a) = 1109

1.25a = 406.25

a = 406.25/1.25

a = 325.

Then the number of students is obtained as follows:

s = 937 - a

s = 937 - 325

s = 612.

More can be learned about a system of equations at https://brainly.com/question/13729904

#SPJ1

Create a proportion for each set of similar triangles, that can be used to find the missing side lengths indicated. Then solve the proportion.

Answers

Using the created proportion for each set of similar triangles, the missing side lengths are 3√29 units and 24 units respectively

How to create a proportion for a set of similar triangles?

Similar triangles are triangles that have the same shape, but not necessarily the same size. Two triangles are similar if and only if they have the same shape, meaning they have the same angle measures.

For the 1st triangles, we can write the proportion as follows:

proportion = (√29)/5

(√29)/5 = x/15

x = 15 × (√29)/5

x = 3√29 units

Thus, the missing side length is 3√29 units

For the 2nd triangles, we can write the proportion as follows:

proportion = 12/13

12/13 = x/26

x = 26 × (12/13)

x = 24 units

Thus, the missing side length is 24units

Learn more about similar triangles on:

brainly.com/question/14285697

#SPJ1

What is the slope of the line shown in the graph?
Someone please help me :/

Answers

Answer: It's the third down. (-1/-2) - PLEASE TAKE THIS WITH A GRAIN OF SALT. I'm not very good at this type of math.

Step-by-step explanation:

Need help please !!

Ian often takes his dog to the park. He estimates that 30% of the other dogs he sees are retrievers, 20% are terriers,and 20% are German shepherds. He designs a simulation.


Let 0,1, and 2 represent retrievers.

Let 3 and 4 represent terriers.

Let 5 and 6 represent German shepherds.

Let 7,8, and 9 represent other dogs.

The table shows the simulation results

Answers

The probability that at least one of the next five dogs he sees is a German shepherd is 0.75.

We have from the question.

0,1, and 2: retrievers

3 and 4: terriers

5 and 6: German shepherds

7,8 and 9: other dogs

In these results, 5 and 6 represent a german shepherd "at least one of the next five dogs he sees is a German shepherd." this means that at least one of the five numbers is 5 or 6.

There are a total of 20 results among them; 12 results include at least one 5 or 6.

∴P = 12/20 = 0.75

Hence, the correct option is B.

--The given question is incomplete; the complete question is

"Ian often takes his dog to the park. He estimates that 30% of the other dogs he sees are retrievers, 20% are terriers, and 20% are German shepherds. He designs a simulation.  Let 0,1 and 2 represent retrievers. Let 3 and 4 represent terriers. Let 5 and 6 represent German shepherds. Let 7,8, and 9 represent other dogs. The table shows the simulation results. According to this simulation, what is the probability that at least one of the next five dogs he sees is a German shepherd?

A. 0.70

B. 0.75

C. 0.65

D. 0.60"--

To know more about probability, here

https://brainly.com/question/11034287

#SPJ4

What will be the length of the south, west and north side of the scale drawing?

Answers

Answer:

See below

Step-by-step explanation:

North, 50

West, 28

South, 71

Answer: i got North, 50

West, 28

South, 71

but have a good day

Step-by-step explanation:

−n + (−3) + 3n + 5
please help its due tmrw

Answers

2n + 2 is the answer

Ella went on a walk that was 12/5 miles long. She
stopped to have lunch when she had walked 15/16 of
the way.
How far, in miles, did Ella walk before lunch?
Give your answer as a fraction in its simplest form.

Answers

Answer:

12/5 = 2.4 miles

2.4 x (15/16) = 2.25 miles.

2.25, or 9/4 miles

the time t needed to paint a fence varies directly as the length L and inversely as the number of workers w if it takes 10 hours to paint 400 feet of fence with six workers how long it will take for 10 workers to paint 1000 ft fence

Answers

Using the direct and inverse variations, the time taken by 10 workers to paint a fence of 1000 ft is 15 hours.

What is proportionality constant?

The ratio between two proportional quantities' constant values is known as the constant of proportionality. When either their ratio or their product gives a constant, two changing values are said to be in a proportionate relationship. The Direct Variation and Inverse Variation types of proportions between the two provided values determine the proportionality constant's value.

Given that the time t needed to paint a fence varies directly as the length L and inversely as the number of workers w.

This is represented as follows:

t = k(l/p)

Where, k is the proportionality constant.

Given that, it takes 10 hours to paint 400 feet of fence with six workers.

Substitute the value of t = 10, l = 400 and w = 6 in the equation we have:

10 = k (400 / 6)

10 = k (66.66)

k = 10 / 66.66

k = 0.15

Now, for or 10 workers to paint 1000 ft fence, take l = 1000, w = 10, and k - 0.15:

t = (0.15) (1000 / 10

t = (0.15) (100)

t = 15

Hence, the time taken by 10 workers to paint a fence of 1000 ft is 15 hours.

Learn more about proportion here:

brainly.com/question/7096655

#SPJ1

Timmy buys four T-shirts costing t dollars. For buying four T-shirts he gets a 25% discount on each T-shirt. Write two expressions to represent the cost of the four T-shirts

Answers

Expression 1: 4t - (4t x 0.25) = 4t - (t) = 3t

Expression 2: 4 x (t - (t x 0.25)) = 4 x (t x 0.75) = 3t

where 't' is the cost of one T-shirt.

In expression 1, the original cost of the four T-shirts (4t) is multiplied by 25% (0.25) which is the given discount percent, and then subtracted from the original cost.

In expression 2, the original cost of one T-shirt (t) is multiplied by 25% (0.25) and subtracted from the original cost, and then the resulting cost (t x 0.75) is multiplied by four to represent the cost of four T-shirts.

Both expressions represent the cost of the four T-shirts after a 25% discount has been applied. they both yield the same result of 3t, which represents the final cost of the four T-shirts after the discount has been applied.

Read more about expressions:

brainly.com/question/28036476

#SPJ4

to write and solve each inequality.
and
9. Seven more than the quotient of a number b
and 45 is greater than 5..
+15
45
5
Multimedia
E
45

Answers

An algebraic equation which represents this word description "Seven more than the quotient of a number b and 45 is greater than 5" is b > -90.

What is a quotient?

In Mathematics, a quotient can be defined as a mathematical expression that is simply used to represent the division of a number by another number.

In order to translate this word problem into algebraic equation, we would assign a variable to the unknown number and then translate the word problem into algebraic equation as follows:

Let the variable b represent the unknown number.

Translating the word problem into an algebraic equation, we have the following;

7 + b/45 > 5

By collecting like terms, we have the following:

b/45 > 5 - 7

b/45 > -2

By cross-multiplying, we have the following:

b > -2 × 45

b > -90

Read more on quotient here: brainly.com/question/748723

#SPJ1

4x(5x+3)
Find the product

Answers

Answer:

[tex]20x^{2} + 12x[/tex]

Step-by-step explanation:

We can expand this equation:

(4x * 5x) + (4x * 3)

= [tex]20x^{2} + 12x[/tex]

If simplified/factored further, we can take out the common variable, x, as well as 4, which is a common number shared between 20 and 12:

4x(5x + 3)

Popcorn sales at a Saturday afternoon matinee were 108% of the sales at the 8:00 showing of the movie. Calvin expressed 108% as 10.8. is Calvin correct? Explain.

Answers

Calvin representation of 108% as 10.8 is incorrect

How to determine if the statement is correct

From the question, we have the following parameters that can be used in our computation:

Percentage increase = 108%

Express the percentage as a fraction

So, we have the following representation

Percentage increase = 108/100

Evaluate the quotient

This gives

Percentage increase = 1.08

Hence, the expression is 1.08 and Calvin is wrong

Read more about percentage at

https://brainly.com/question/843074

#SPJ1

3. Find the area of the circle below.
Help the circle is 3

Answers

Answer:

28.26 [tex]in^{2}[/tex]

Step-by-step explanation:

a = [tex]\pi r^{2}[/tex]

a = 3.14([tex]3^{2}[/tex])

a = 3.14(9)

a = 28.26

Find the perimeter of a rectangle measuring 4.1263cm long and 2.8315cm. Correct the answer to 3d.p and 3s.f​

Answers

The perimeter of a rectangle measuring 4.1263cm long and 2.8315cm is 13.9 cm

How to determine the perimeter of the rectangle

from the question, we have the following parameters that can be used in our computation:

Length = 4.1263 cm

Width = 2.8315 cm

The perimeter of a rectangle can be calculated using tge following equation

Perimeter = 2 x (Length + Width)

substitute the known values in the above equation, so, we have the following representation

Perimeter = 2 x (4.1263 + 2.8315)

Evaluate

Perimeter = 13.9156

Approximate

Perimeter = 13.9 to 3 significant figures

Perimeter = 13.916 to 3 decimal places

Read more about Perimeter at

https://brainly.com/question/24571594

#SPJ1

Please help me out on my homework

Answers

Answer: No Solution is the answer

Step-by-step explanation:

Have a photo attached with the work

need the answer asap ! thank you to anyone who helps !

Answers

Answer:

Step-by-step explanation:

D

In the graph, the area above f(x) is shaded and labeled A, the area below g(x) is shaded and labeled B, and the area where f(x) and g(x) have shading in common is labeled AB.

Graph of two intersecting lines. The line g of x is solid, and goes through the points 0, negative 2 and 1, 0 and is shaded in below the line. The other line f of x is dashed, and goes through the points 0, 3, 3, 0 and is shaded in above the line.

The graph represents which system of inequalities?

Group of answer choices

y > 2x − 3
y > −x − 3

y < 2x − 2
y < −x + 3

y ≤ 2x − 2
y > −x + 3

None of the above

Answers

The given graph is represented by the following inequalities (C) y ≤ 2x − 2, y > −x + 3.

What are inequalities?

An inequality in mathematics is a relation that compares two numbers or other mathematical expressions in an unequal way.

The majority of the time, size comparisons between two numbers on the number line are made.

If an inequality matching y > -ax + b is solved, area A will be shaded above a dashed line with a negative slope.

Such inequality exists between Options A and C.

The solution of an inequality that fits y ax + b will be below a solid line with a positive slope where region B is shaded (for some positive a).

The only option with the correct inequality symbol is Choice C.

We discover that choice C matches the graph when we closely examine it.

Region A matches y > -x+3 because the line with a negative slope has a slope of -1 and a y-intercept of 3.

Region B corresponds to y 2x -2 because the line with a positive slope has a slope of +2 and a y-intercept of -2.

Therefore, the given graph is represented by the following inequalities (C) y ≤ 2x − 2, y > −x + 3.

Know more about inequalities here:

https://brainly.com/question/24372553

#SPJ1

Correct question:

In the graph, the area above f(x) is shaded and labeled A, the area below g(x) is shaded and labeled B, and the area where f(x) and g(x) have shading in common is labeled AB.

Graph of two intersecting lines. The line g of x is solid, and goes through the points 0, negative 2 and 1, 0 and is shaded in below the line. The other line f of x is dashed, and goes through the points 0, 3, 3, 0 and is shaded in above the line.

The graph represents which system of inequalities?

Group of answer choices

a. y > 2x − 3

y > −x − 3

b. y < 2x − 2

y < −x + 3

c. y ≤ 2x − 2

y > −x + 3

d. None of the above

Select the correct answer

Consider this absolute value function.
f(x)=[x+3]
if function f is written as piece wise function which piece will include? ​

Answers

Absolute value function f(x) = | x + 3 | written in piece wise function includes the piece  given by option B . x + 3, x > -3.

Function f(x) is represented as absolute value function:

f(x) = | x + 3 |

Absolute function is always positive when the included variable is greater than zero.

| x + 3 |  > 0

⇒ ( x + 3 ) > 0

Subtract three from both the sides we get,

⇒ x + 3 - 3 > 0 - 3

⇒ x > -3

Here piecewise function incudes the piece :

x + 3,  x > -3.

Therefore, the absolute function f(x) = | x + 3 | includes the piece after written in piecewise function form is equal to option B. x + 3,  x > -3.

The above question is incomplete , the complete question is:

Select the correct answer.

Consider this absolute value function.

f(x) = | x + 3 |

If function f is written as a piecewise function, which piece will it include?

A. x + 3, x > 3

B. x + 3, x > -3

C. -x + 3, x < -3

D. -x - 3, x < 3

learn more about function here

brainly.com/question/12431044

#SPJ4

I just don't understand any of this because I'm dyslexic.

Answers

Answer:

HI = 9

Step-by-step explanation:

      HJ = HI + IJ

2x + 10 = x + 9 + 1

 2x - x = 10 - 10

      ∴ x = 0

∴ HI = x + 9

       = 0 + 9

       = 9

A student is standing, with her arms outstretched, on a platform that is rotating at 1.6 rev/s. She pulls her arms in and the platform now rotates at 2.2 rev/s. Her original moment of inertia (I0) is 25 kg m2.
What is her final moment of inertia (If)?

Answers

The student's final moment of inertia is 18.18 kgm².

What is moment of inertia?

The moment of inertia of an objecr is the property of an object which shows its ability to rotate.

How to find the final moment of inertia?

Since a student is standing with her arms outstretched, on a platform that is rotating at 1.6 rev/s. She pulls her arms in and the platform now rotates at 2.2 rev/s. Her original moment of inertia (I0) is 25 kgm². To find the r final moment of inertia, we use the law of conservation of angular momentum.

What is the law of conservation of angular momentum?

The law of conservation of angular momentum states that for any rotation, angular momnetum is constant.

So, Iω = constant where

I = moment of inertia and ω = angular speed.

So, Iω = I'ω' where

I = initial moment of inertia of student = 25kgm²ω = initial angular speed of student = 1.6 rev/s I' = final moment of inertia of student ω' = final angular speed of student = 2.2 rev/s

Making I' subject of the formula, we have that

I' = Iω/ω'

So, substituting the values of the variables into the equation, we have that

I' = Iω/ω'

I' = 25 kgm² × 1.6 rev/s ÷ 2.2 rev/s

= 40 kgm²rev/s ÷ 2.2 rev/s

= 18.18 kgm²

So, the final moment of inertia is 18.18 kgm².

Learn more about moment of inertia here:

https://brainly.com/question/29471030

#SPJ1

If you work 32 hours cleaning, how many hours do you need to work babysitting to get $420 for the week?

Answers

13 I’m sure of it.
I’m sorry if I get it wrong

PLEASE HELP 100 POINTS!!



A line has a slope of 0 and a y-intercept of –5/3. Write its equation in slope-intercept form.
Write your answer using integers, proper fractions, and improper fractions in simplest form.

Answers

Answer:

the answer is 0= -5/3x + c

Answer: non

as a wordf 2 b geven

a smaller square of side length feet is cut out of a square board. what is the approximate area (shaded region) of the remaining board in square feet?

Answers

If a smaller square of side length 17 feet is cut out of a square board , then the approximate area of remaining board in square feet is x² - 289 square feet  .

le the side length of the big square board be = "x" ft ;

the side length of smaller square is = 17 ft ;

So , the area of the smaller square is = (side length) × (side length)

= 17 × 17

= 289 ft² .

and , the area of the larger square is = (x) × (x) ;

= x²  .

So , the approximate area of the remaining board is calculated as :

= x² - 289  ;

Therefore , area of remaining board is "x² - 289" .

The given question is incomplete , the complete question is

A smaller square of side length 17 feet is cut out of a square board. What is the approximate area of the remaining board in square feet ?

Learn more about Area here

https://brainly.com/question/17045325

#SPJ4

Other Questions
Someone Help me Please. Your friendfinds the sum. Is your friend correct?Explain your reasoning.-3.7 + (-0.25) = | 3.7 | + | 0.25 | = 3.7 + 0.25 = 3.95 ntsam ProctorQuestion 2Animals have albinism if they are unable to produce the molecule melanin. The protein responsiblefor making melanin is tyrosinase.If this is the normal sequence for a section of the mRNA transcript for tyrosinase:GCUGAUAGUCCUAnd a rat has this version of the sequence:GUGAUAGUCCUIs this rat likely to have albinism? How do you know?Second letterFirst letterUAUUC.UUG}LeuCUUCUCCUACUGUCUPheUCCLeuAUUAUC lleAUAUCAUCGCCUCCCCCACCGACUACCACAAUG Met ACGGUUGCUProUACJSerThrAUAU Tyr UGC CysUAA Stop UGA StopUAG Stop UGG TrpGCAUTCACJCGUHisCGCCAGGIn CGGAAUAsnArgAGC SerAAGLYS AGG ArgGAUR GGUUCAGDUA DUA D10 ptsThird letter (PLEASE HELP) At a local print shop, 15 copies can be made for $6. At this rate, how much would it cost to make 35 copies??? what significance does the slight overlap of the van der waals surfaces have with respect to the structural relationships of the catalytic triad residues? puck b has five times the mass of puck a . starting from rest, both pucks are pulled the same distance across frictionless ice by strings with the same tension. part a compare the final kinetic energies of pucks a and b . compare the final kinetic energies of pucks and . ka Charles Mann argues that when European settlers moved westward into the interiorof the Americas, they did so in two waves:a) Disease and ecological disturbance.Ob) Conquest and settlement.Oc) Ecological recreation and interaction.d) Disease and exchange. according to the proponents of the quantity theory of money, can a change in the money supply m cause a change in the level of real gross domestic product y? this graph shows merchandise export data for the years 2010 through 2012. a graph titled total merchandise exports from 2010 to 2012 has year on the x-axis and exports in trillions of u s dollars on the y-axis, from 0 to 2.5 in increments of 0.5. a line representing united notes exports is slightly lower than a line representing china exports. which statement most accurately describes the information presented on the graph? during the 21st century, the complexity of the challenges posed by disruptive, digital technologies and accelerating rates of change has encouraged companies to: In order to maintain compliance with standard precautions, a medical assistant should recognize that which of the following tasks requires the use of gloves despite the absence of any visible blood?a) Administering a nebulizer treatmentb) Performing a visual acuity testc) Obtaining a tympanic readingd) Removing a cyst italian sailor credited with the discovery of the americas in 1492. true or false The key idea of John Locke's Enlightenment theory was to protect and enhance the freedoms and rights of O the government. O the philosophers. O the law. O the individual. A group of four friends spends a day at a local theme park, which has just opened a new attraction with very popular rides featuring new technology. They board one of the rides after waiting for over an hour in line, but about five minutes into the ride the electricity fails, and they are stuck on the ride for a half hour. When the ride finally resumes and concludes, they go to the theme parks guest services department to complain. What are the facts?How does the guest feel?How would you acknowledge the guests feelings?What would be your solution?How would you follow up with the guest? Read this quotation from paragraph 10."What could happen if you allowed yourself to step outside the cages and breathe in the fresh air of your freedom?"Based on the quotation, the author views her high-school years as a source of - A. transitionB. confinementC. orderD. discipline all of the following statements regarding the gulf war of 1991 are true except that select one: a. the united states suffered relatively few casualties in the war. b. the allied ground offensive focused on dislodging iraqi forces dug-in along the kuwait border. c. almost all islamic and arab nations joined a trade embargo against iraq. d. the united nations voted in favor of american policies toward iraq. e. the allied forces ultimately numbered 690,000 troops. a network administrator notifies a technician that the company is experiencing a ddos attack. several internal windows pcs are the source of the traffic. the network administrator gives the technician the windows computer names and states they be scanned and cleaned immediately. with which of the following types of infections are the pcs most likely infected? (select two.) soapy's suds makes and sells root beer. its beginning work-in-process inventory was $12,000 and the ending work-in-process inventory was $10,000. during the year, soapy used $45,000 of direct materials and incurred $30,000 of direct labor in production. its cost of goods manufactured for the period was $97,000. how much manufacturing overhead did soapy incur during the period? Identify the bank reconciliation items that would require adjustments to the book balance.a. Collection of note by bankb. Interest earnedc. Outstanding checksd. Bank chargese. NSF checkf. Deposits in transit In the process of neurotransmission, the action potential causes neurotransmitters to be released from the ______________ into the _______________.soma; terminal buttonssynaptic vesicles; somasoma; synapsesynaptic vesicles; synapse