Answer:
Sexual reproduction begins with sperm and egg cells, which are produced through a process called meiosis. ... In sexual reproduction, a haploid sperm from the male parent fertilizes the haploid egg from the female parent to produce what is called a diploid zygote. Zygote is the technical term for a fertilized egg.
!!pls help!!
taj incorrectly states that autographs are also known as consumers that need to feed on other organisms, including plants and animals, to gain energy. which of the following best describes consumers that feed on other organisms such as plants and animals for energy?
A. carnivores
B. trophic levels
C. heterotrophs
D. herbivores
Herbivores best describes consumers that feed on other organisms such as plants and animals for energy.
What do you mean by herbivores?A herbivore is an animal anatomically and physiologically adapted to eating plant material, for example foliage or marine algae, for the main component of its diet.
Many herbivores have large, dull, flat teeth. These teeth are excellent for chewing and breaking down tough plant material. Carnivores have sharp, narrow teeth that are better for biting and tearing flesh. However, some herbivores also have strong, sharp teeth.
Examples of large herbivores include cows, elk, and buffalo. These animals eat grass, tree bark, aquatic vegetation, and shrubby growth. Herbivores can also be medium-sized animals such as sheep and goats, which eat shrubby vegetation and grasses.
Learn more about herbivores:
https://brainly.com/question/16786804
#SPJ2
list one part of the cell theory in your own words, explain what it means
One part of the cell theory is that pre-existing cells can form more cells
This means that cells that currently exist are capable of creating more cells, however it’s a slow process
What determines which bases will be brought to the DNA strand during DNA replication?
Explain which processes take place during meiosis that lead to variation in inherited traits.
Answer:
We are left with four haploid cells; each one genetically different from each other and the parent cell. 8. Describe the three ways meiosis produces genetic variability. We have seen that meiosis creates variation three ways: crossing over, mutations caused during crossing over, and independent assortment.
.
Why are some sources of sugar better than others?
Explanation:
[tex]\huge{\underbrace{\overbrace{\mathfrak{\pink{Answer:❣}}}}}[/tex]
Whether an added sugar contains more or less fructose versus glucose has little impact on health. (An exception may be people with diabetes who need to control their blood glucose, in which case a higher-fructose, lower-glucose sugar may be preferable
Answer:
Some sugar that's made is usually take and unhealthy, but other sources can be purely made with no artificial s added to it making it fake.
multiple choice
Daytime temperatures on Mercury are extremely hot because:
1. it is close to the sun
2. it has long days
3. one side is facing the sun
4. it gives off internal heat
5. there are volcanoes
Answer: it has long days
Explanation:
explain in details the mechanism of transportation in plants
Answer:
Plant transport systems move energy from leaves and raw materials from roots to all their parts. The xylem (tissue) moves water and minerals obtained from the soil to all other parts of the plants.
Explanation:
I hope I helped:)
Select the correct bisector of the segment.
B
A
B
B
B
А
M
B
B
D
Answer:
C
Explanation:
it has the example figure number 7 and also it has the correct bisector
How is the rock in the deep mantle similar to the rock in the parts of the mantle nearest the surface? How is it different?
Answer:
Rocks within the mantle contain more magnesium and iron than the ones in the crust. Difference: Rocks in the deep mantle are under intense heat and pressure.
At which type of technonic plate boundary is a volcano least likely to occur
Answer: A
coz its just sliding one another
Hope it is correct
^_^
what direction was the texas annexation in?
Write any three differences between mass and weight
please its aurgent fast
Answer:
See explanation
Explanation:
There are a number of differences between mass and weight, they include;
Mass is a scalar quantity whereas weight is a vector quantity.
Mass is dependent on the quantity of matter present in a body whereas weight depends on the acceleration due to gravity in a particular location on the earths surface.
The SI unit of mass is kilogram whereas the SI unit of weight is Newton.
please help
Explain how an organ and organelles are related
Answer:
Just as organs are separate body parts that perform certain functions in the human body, organelles are microscopic sub-units that perform specific functions within individual cells. Organelles are specialized structures that perform various jobs inside cells.
Organelles are microscopic subunits that carry out certain tasks within individual cells, whereas organs are distinct body sections that carry out specialized tasks for the human body.
What is the relation between organ and organelles?Literally, the phrase refers to “tiny organs.” Organelles provide specialized functions to keep a cell alive, much like organs like the heart, liver, stomach, and kidneys serve specific functions to keep an individual alive.
Atoms, molecules, organelles, cells, tissues, organs, organ systems, and the human organism are the major levels of organization in the body, going from the simplest to the most complex.
Like an organ in the body, an organelle is a subcellular structure that performs one or more particular functions for the cell.
Therefore, organ and organelles differ in their functioning.
Learn more about organ and organelles here:
https://brainly.com/question/22911736
#SPJ2
What are the three main classifications that describe galaxies? By what one visible
characteristic do scientists categorize galaxies?
Answer:
Spiral Galaxies, Elliptical Galaxies & Irregular Galaxies
Explanation:
How did galaxies originate? Astronomers believe that after the big bang, the explosion which began the universe 10 billion to 20 billion years ago, gravity began to compress masses of free-floating gas. Two main theories, bottom-up and top-down, explain what happened next. According to bottom-up theories, clusters began to form and assembled together into the larger units we know as galaxies. Top-down theories suggest that galaxies formed first, and the stars and other objects within them were subsequently produced. They categorized different galaxies to maintain their tests from the other galaxies.
1. What is the pH range for an acid?
A. 0 - 7- 14
2. What is the pH range for a base
A. 0 - 7- 14
3. What are the products of an acid base reaction?
A. water and salt
B. acid and base
C. water and sugar
D. water
4. What substance has a neutral pH?
A. ammonia
B. water
C. sodium bicarbonate
D. vinegar
5. The negative ion found in bases is the ______________
A. hydrogen ion (H+)
B. hydroxide ion (OH-)
Answer:
0-7-14
0-7-12
c is correct water and suger
d is correct vinegar
b is correct (OH-)
Not all members of a species are the same. Every species exhibits (blank)
. For example, some beetles are green, while others are brown.
Not all individuals in a population will survive to reproduce. Those that do, pass their (blank)
to their offspring.
Answer:
Not all members of a species are the same. Every species exhibits
variation.
For example, some beetles are green, while others are brown.
Not all individuals in a population will survive to reproduce. Those that do, pass their traits, genes to their offspring.
Explanation:
Got it right. Hope it helps :)
when an experiment shows that two variable are closely related the experiment shows what
Answer:When an experiment shows that two variables are closely related, the experiment shows correlation between the two variables. Correlation helps to show how two variables are related and connected. Related variables are said to be correlated. For example, we can say, good health is correlated to daily exercise routine.
Explanation:
When covalent bonds form. the amount of energy present decreases. What happens to the stability of the atoms in the bond?
Identify the converted product of the photosynthesis process.
A student was asked the following question on her biology final exam
question : how do organisms grow in size
her answer : “organisms grow in size when the cells within the organism grow larger. As the cells grow larger the organism grows larger as well
Explain why her answer is not correct then explain how she should have answered the question
How do I calculate a heart rate?
Explanation:
To check your pulse at your wrist, place two fingers between the bone and the tendon over your radial artery — which is located on the thumb side of your wrist. When you feel your pulse, count the number of beats in 15 seconds. Multiply this number by four to calculate your beats per minute.
Identity Factors in an Experiment
WARM-UP
Consider what you already know about scientific design. To set up an experiment testing whether
students' grades are affected by their level of exercise, which factors do you think you would need to keep
in mind? Check all that apply.
student gender
vpe of exercise
amount of exercise
what grades are measured
how long the experiment will last
what time of day the students exercise
how much time the students spend studying
DONI
Answer:
Did you copy and paste this from somewhere because i want to help but i don't understand it at all.
Explanation:
I need help with this (last question I had had the picture all black)
Answer:
I only know A
I think it's the lap
construct a flowchart (using “->”) (or explain) that depicts all the energy transfers that occur from the sun to the milk of your cereal
Answer:
dragon warrior or whatever it is called I don't maybe I am right
All planets in the solar system have surfaces that are made up of either one of two materials. What are the two materials?
Answer:
are made of rock, containing common minerals like feldspars and metals like magnesium and aluminum.
Explanation:
Which of the following processes is NOT a physical or chemical change?
a. crushing
b. weighing
c. melting
d. passing electric current
Answer:
b
Explanation:
doesn't change anything
The function of mitochondria and chloroplasts is related to energy. In what way does their function differ?
A.
Mitochondria produce energy in prokaryotic cells, while chloroplasts produce energy in eukaryotic cells.
B.
Mitochondria produce energy from food, while chloroplasts produce food from the Sun’s energy.
C.
In plants, mitochondria provide energy in non-green cells, while chloroplasts provide energy to cells in parts of the plant that are green.
D.
Mitochondria provide energy in the night, while chloroplasts provide energy in the day.
E.
Mitochondria provide energy from food synthesized by organelles other than chloroplasts, while chloroplasts provide energy through photosynthesis using the Sun’s energy.
Answer:
The answer is option E- Mitochondria provide energy from food synthesized by organelles other than chloroplasts, while chloroplasts provide energy through photosynthesis using the Sun’s energy.Explanation:
16. In which of the following situations are the phenotypes of F2 offspring expected to follow
the ratio of 9:3:3:1?
a. monohybrid cross for two unlinked traits
b. a monohybrid cross for two closely linked traits
c. a dihybrid cross for two unlinked traits
d. a dihybrid cross for two closely linked traits
Answer:
C
Explanation:
The F2 offspring of a cross would follow the ratio of 9:3:3:1 only if the cross is a dihybrid for two unlinked traits.
There is nothing like a monohybrid cross for two traits. A cross involving two traits is a dihybrid cross. Hence, options a and b are out of the equation.
A dihybrid cross for two closely linked traits would produce F2 offspring in another ratio that is different from 9:3:3:1 depending on the linkage map.
Hence, the correct option is C.
what were some of the earliest life forms? and what were they like
decode CCGCTTTCGCTATTATAAAAAGGGCTATAACTA
Answer:
GGCGAAAGCGAUAAUAUUUUUCCCGAUAUUGAU. I think sorry if I'm wrong