Scientific investigations often lead to the formulation of new scientific questions. The observations Charles Darwin's work after he returned home from his voyage and studying the selective breeding of pigeons prompted him to ask which question?

A) Do living things change over time, and if so, how?
B) Are the Galapagos finches and those on the mainland the same species?
C) Are pigeons related to the Galapagos finches?
D) Can selection in nature also lead to a new species over time?

Answers

Answer 1

Answer: D. Can selection in nature also lead to a new species over time?

Explanation:

Answer 2

Answer:

Can selection in nature also lead to a new species over time?

Explanation:

Correct on edge 2021 hope this helps :)


Related Questions

Which is required for sexual reproduction

Answers

Answer:

meiosis

Explanation:

meiosis is used to produce gametes for sexual reproduction

Answer:

Meiosis, and female and male

Explanation:

Sexual reproduction is a reproduction that requires a male and a female of the same species to contribute genetic material. Special cells called gametes are produced through meiosis, which halves the number of chromosomes in each resulting cell. These cells are called haploid gametes.

What is the function of a phospholipid bilayer

Answers

Answer:

Phospholipid bilayers create a selectively permeable barrier to the movement of ions and molecules important for cellular function.

Answer: The phospholipid bilayer acts as a barrier to the passage of molecules.

4) After a horrible car wreck, Jamie had a broken ankle, a few minor cuts, scratches, and a
large bruise across her chest from the seatbelt. While at the hospital, they kept checking her left
lung because it kept collapsing.
What systems are affected?
Why?

Answers

I think the respiratory bc of her lungs collapsing or maybe the cardiac one bc her oxygen could be blocked

What are the locations and end products for the processes of transcription and
translation?

Answers

Transcription is the synthesis of RNA from DNA. Occurs in the nucleus. Translation is the synthesis of a protein from RNA. Occurs in the cytoplasm.

The cytoplasm is the site of translation, the next process that converts a gene into a protein. In order to “read” the sequence of mRNA nucleotides, the ribosome, a specialized complex, interacts with the messenger RNA.

What is role of gene expression in an organism?

It serves as both a volume control that raises or lowers the level of proteins produced, and an on/off switch to regulate when proteins are created.

Because a particular protein can only be made when its gene is turned on, gene expression is significant.

But the process of turning a gene into a protein involves numerous steps, and one of these phases—the production of proteins—is essential for the gene expression pathway that can be altered in cancer.

Therefore, transcription occur at nucleus and translation take place in cytoplasm.

Learn more about gene expression here:

https://brainly.com/question/14182257

#SPJ6

What are the advantages and disadvantages of a honey bees sexual reproduction

Answers

Answer:I just learned this.

Explanation: The Advantage is that they have plant pollination and honey.

what would be the most beneficial towards maintaining equilibrium in an ecosystem over a long period of time?
a)organisms imported by humans from other environments
b)a sudden change in climate
c) a diversity of organisms
d)predators eliminated from the food chains

Answers

Answer:

c) a diversity of organisms

Explanation:

Biodiversity refers to the number of different species of animals,plants and microorganisms.Biodiversity increases ecological stability in changing environments.Biodiversity reduces competition ,provide more food resources,increases ecosystem productivity etc.

what is the atmosphere for gas essential for animal life?

Answers

Answer: oxygen

Explanation:

All living organisms store genetic information that can be passed on from parent to offspring. How does the biomolecule responsible for storing this information differ from other biomolecules?

Answers

Answer:B

Explanation:

What is the difference between a detritivore and a decomposer?
A.While detritivores consume animals, decomposers only consume plants.
B. While detritivores feed on dead organic matter, decomposers actually break down dead or decaying organisms.
C. While detritivores consume both plants and animals, decomposers only consume dead animals.
D. While detritivores are heterotrophic, decomposers are autotrophic.

Answers

What are detrivores?

Detritivores are organisms that feed on the organic waste of dead plants and animals

What are decomposers?

Decomposers are organisms that break down dead or decaying organisms; they carry out decomposition, a process possible by only certain kingdoms, such as fungi. Decomposers are the organisms that decompose dead plants and animals.

Difference between detrivores and decomposers

Option C is the the correct answer

While detritivores consume both plants and animals, decomposers only consume dead animals.

Read more about organisms

https://brainly.com/question/25832580

Answer:

While detritivores feed on dead organic matter, decomposers actually break down dead or decaying organisms.

Explanation:

The answer explains itself. It is accurate information. :) Have a good day!

which describes a eukaryotic cell,but not a prokaryotic cell?

Answers

Answer is c it is surrounded by cell membrane

Which model below shows a prokaryotic cells?

Answers

Answer:

Modle two as it is singular, simple with a flagellum

Explanation:

please answer asap! anatomy final exam!! thanks:)
Describe what lymph is and how it travels throughout the body. What would happen if the lymphatic system did not drain interstitial fluid from the body?

Answers

Answer:

A fluid that flows through the lymphatic system is called lymph. it travels when you breathe and move your muscles the lymph continuously get pushed towards the heart from the outer reaches of your body. if the lymphatic system didn't drain interstitial fluid then the lymph fluid would build up in the body's tissues, making them swell.

Fossil remains of Glossopteris (an extinct plant with large leaves) have been discovered in India and Australia. When they were living, all the Glossopteris were located together on land, but now the Glossopteris fossils are separated by an ocean. What could explain how these fossils got so far apart?

Answers

Answer:

Due to splitting of lands.

Explanation:

These Glossopteris fossils got so far apart from each other because of the splitting of super continent about 175 million years ago. Before 175 million years, India and Australia are attached to each other and these Glossopteris plants are present on these lands but with the passage of time, the lands of India and Australia split and go far away from each other so due to splitting of lands, these fossils got so far apart from each other.

how does water pollution harm water ecosystems?

Answers

Answer:

the animals die due to the chemicals and stuff in the water

Explanation:

Animals that live in a water ecosystem could get poisoned and die of all the pollution in the water, and all the trash that enters the waters.

An_____is a variation of a gene

Answers

Answer:

allele

Explanation:

The genetic variation of an entire species is often called genetic diversity. Genetic variations are the differences in DNA segments or genes between individuals and each variation of a gene is called an allele.

Answer:

An allele is a variation of a gene.

What is the energy source that allows photosynthesis to occur?

Answers

Answer:

[tex]\boxed {\boxed {\sf The \ sun }}[/tex]

Explanation:

Photosynthesis is a special process that certain organisms (plants, algae, and some bacteria) undergo to create "food".

This turns light energy, carbon dioxide, and water into glucose and oxygen. The glucose becomes the food for the organism, because it is turned into ATP during cellular respiration. The ATP is energy that fuels the processes, like growth, repair, and transport.

This process occurs because of the sun. It provides the light energy needed for the reaction. Organelles inside of the cells, called chloroplasts, contain a pigment (chlorophyll) that captures this energy.

List some animals affected by soda cans and plastic bottles

Answers

Answer:

turtles, fishes, birds, whales, cats, dogs, really any animal can be affected

Explanation:

(any animal in the ocean) mark as brainliest plz

During which phase of mitosis do the chromosomes pull away from the middle of the cell?

Answers

In Anaphase of mitosis chromosomes pull away from the middle of the cell.

During this period the replicated chromosomes are split and moved to the opposite poles of the cells.

What is mitosis?

It is the process by which cell replicates its chromosomes and then segregates them, producing two identical nuclei in preparation for cell division.

What are chromosomes?

It is along DNA molecule with part or all of the genetic material of an organisms.

To know more about mitosis here

https://brainly.com/question/26678449

#SPJ2

when you breathe in air you bring oxygen into your lungs and blow out. A.Carbon dioxide B.oxygen C.carbon monoxide D.hydrogen​

Answers

Answer:

Carbon dioxide

Answer:

Carbon Dioxide

Explanation:


Poly" means many and "saccharide" means sugar.

Why is polysaccharide a good name for the picture on the right above
!

Answers

I can’t see the picture...

at which temperature would air hold the least water vapor?

Answers

Answer: I believe it's 60 degrees Fahrenheit or less, Since heat is required to have proper evaporation, then this will only be leading to a portion of the water condensed leading to a half condensation

Explanation:

Answer:

the coldest temp in F holds the least amount of water vapor..

A student states that petrification occurs when pore spaces in an organism's remains are filled with minerals that precipitate out of solution. What is wrong with this statement?

A.
Permineralization occurs when pore spaces in an organism's remains are filled with minerals that precipitate out of solution.
B.
Petrification occurs when once-living tissues are replaced by minerals, preserving the organism's structure.
C.
Both A and B describe errors in the statement.
D.
Nothing, this statement is correct as is.

Answers

Answer:

C. Both A and B describe errors in the statement.

Explanation:

In fossilization i.e formation of fossils, two terms are used as follows: permineralization and petrification.

- Permineralization is a process whereby the pore spaces of an organism's remains are filled with mineral matter that precipitates from lake and ocean solutions.

- On the contrary, petrifaction or petrification is the process whereby a once-living tissue (matter) are REPLACED by minerals, hence, preserving the organism's structure by turning it into a stone (petros).

According to this question, the student mixed up their definitions by giving the definition of permineralization instead, however, options A and B have described the errors associated with the statement.

In what ways is the composition of the sun different from the Earth? Choose all that apply.
The Sun does not have continents.
O The Sun has a thick, solid core.
O The Sun does not have a solid surface
The Sun does not have a solid core.
The Sun has continents known as plasma zones.

Answers

Answer:

1,3,4

that's my answerrrr

Atmospheric nitrogen, in its gaseous form, is useful to plants. *
True
False

Answers

Answer:

true

Explanation:

Answer:

False.

Explanation:

Atmospheric Nitrogen, in its gaseous form, is harmful to Plants and Animals.

Have a great day! (:

The table below shows the initial and final masses of a radioactive material whose half-life is 15 years.

Initial mass (in kilograms): 0.8
Final mass (in kilograms): 0.05

Based on the table, which of these conclusions is correct?

A.) The material decayed from 0.8 kilograms to 0.05 kilogram in 60 years.
B.) The material decayed from 0.8 kilograms to 0.05 kilogram in 30 years.
C.)The mass of the material was 0.1 kilograms after four half lives.
D.) The mass of the material was 0.1 kilograms after five half lives.

Answers

Answer:

A

Explanation:

1 half-life = .4 kg = 15 years

2 half-life = .2 kg = 30 years

3 half-life = .1 kg = 45 years

4 half-life = .05 kg = 60 years

Answer:

A

Explanation:

Initial mass is 8. The half-life is 15 years.

1st half life=.8/2=.4

2nd half life=.4/2=.2

3rd half life=.2/2=.1

4th half life=.1/2=.05

For each half life that it took it to go from .8 to 0.05, you add 15 years since that is the half life of the substance. 4*15=60.

So, the answer is A. The material decayed from 0.8 kilograms to 0.05 kilogram in 60 years.

⚠️Second time posting this⚠️
the factors that control genes are called "alleles".
True
or
false

Answers

Answer

Explanation:

I think its true

What two elements of weather are affected by air masses

Answers

Answer:

The air masses separated by a front usually differ in temperature and humidity. Cold fronts may feature narrow bands of thunderstorms and severe weather, and may on occasion be preceded by squall lines or dry lines. Warm fronts are usually preceded by stratiform precipitation and fog.

Cold fronts and warm fronts

How many chlorine atoms are there in the molecule NiCl2

Answers

Answer:

2, that’s what the 2 means.

Explanation:

A _______________ from the sun hits chlorophyll and excites an electron, known as __________________________________.

Answers

Answer:

Photon, light dependent reaction of photosynthesis

Explanation:

Photosynthesis is the process by which green plants make their own food in the presence of sunlight and water.

There are two steps of Photosynthesis that include light dependent reaction and light-independent reaction.

In light dependent reaction, a photon from the sun is absorbed by the green pigment in leaves called chlorophyll that allow the electron to excite from ground energy level to high energy level. It converts the solar energy into chemical energy and called light dependent reaction of photosynthesis.

Hence, the correct answer is "Photon, light dependent reaction of photosynthesis".

1. DNA: ATACGAAATCGCGATCGCGGCGATTCGG
mRNA:
Codon:
Anticodon:
Amino Acids:

Answers

Answer:
mRNA: UAUGCUUUAGCGCUAGCGCCGCUAAGCC

CODONS: AUG-GAA-AUG

AMINO ACIDS: METHIONINE-LEUCINE


Explanation: hope this helps
i am so confused is this an actual question or is it just random letters?-
Other Questions
Define the following key term: fertility rate plz help quick will give brainlyWhat is the difference between the opposite of 12 and the absolute value of 12? Use a number line to explain. 2) A sample of argon has a volume of 5.0 Land the pressure is 650 mm Hg If the final temperature is30. C, the final volume is 5.7 L, and the final pressure is 800. mm Hg, what was the initial temperatureof the argon? Please help, I have no clue what Im doing To achieve active managerial control through HACCP principles, food protection managers must do all except which one of the following?A. Implement practices and procedures to prevent, eliminate, or reduce food-borne illnessB. Determine steps to control hazardsC. Monitor employees hand-washing proceduresD. Identify food safety hazards by reviewing the menu and product lists for potentially hazardous foods I would thank u a bunch of u could help me with this! ASAP Solving Inequalities, HELP PLEASE.!!hjukhvfd81611/03/2017MathematicsMiddle SchoolansweredThe Latino Rams at Englewood High school are seeking to raise at least $750 in a fundraiser to pay for their end-of-the year field trip to Islands of adventures. which of the following is true GIVING BRAINLEST The freezing point of a mixture of water and salt isA. higher than that of pure waterB. the same as that of pure waterC. lower than that of pure waterD. none of the above Find the slope of the line that passes through the points (-2, 6) and (9, -5). I GIVEEEE BRAINLILST What kind of lenses have small maximum aperture, like f/4, f/4.5, f/5.6, or f/6.3? What is a global citizen and why are they important ? Use the elimination method to solve the system of equations. Choose the correct ordered pair - 3y = x - 5 x + 5y = 7 A. (- 1, 2) B. (2, 1) c. (5, 0) d. (- 4, 3) Which of the following technologies makes it possible for employees to stayin constant contact with the office?O A. Company letterhead and envelopesB. A list of all employee phone numbersC. The InternetD. A training manual about office policies what is 14x - 3x > 4x Someone help with this please ANSWER ME 2 QUESTION.....URGENT....SO PLZZ FASTLY SND ME THE ANSWER....FASTFASTFASTFASTFASTFASTFASTFASTFASTFASTFAST What was the cause of the trend in spending that the graph shows in the 1960s? what is the theme for chapter 10 dear martin ?