Please Help!
The middle of an mRNA molecule contains the nucleotide sequence shown here. Much more of the mRNA is translated. Assume that the sequence is translated from left to right.

AUUUAACUGUUCUGUCUAGAG


1.

Construct an Explanation Based only on the information provided, why could the mRNA section be translated into three different sets of amino acids, instead of just one set?

2.

Use Models Use the genetic code to translate the sequence into each of the three possible sets of amino acids.

3.

Draw Conclusions Which of the three sets of amino acids is the most likely to be included in the polypeptide? Explain your reasoning.

Answers

Answer 1

Answer:

TAA ATT GAC AAG ACA GAT CTC

1. The more bases there are per codon the more information you can code for. There are only 22 different amino acids, in consequence we need minimum 3 bases per codon.

2. codon

three nucleotides—called a triplet or codon—codes for one particular amino acid in the protein. The nucleotide sequence in the DNA is first transcribed into a molecule of messenger RNA (ribonucleic acid).

3. Known as alpha helices and beta sheets, these stable folding patterns make up the secondary structure of a protein. Most proteins contain multiple helices and sheets, in addition to other less common patterns (Figure 2). The ensemble of formations and folds in a single linear chain of amino acids — sometimes called a polypeptide — constitutes the tertiary structure of a protein. Finally, the quaternary structure of a protein refers to those macromolecules with multiple polypeptide chains or subunits.

OKAY I THINK EVERYTHING IS RIGHT BUT SORRY IF WRONG ;)

Answer 2
The mRNA sequence could be translated into three different sets of amino acids because of the degeneracy of the genetic code.
Using the genetic code to translate the mRNA sequence, we get the following three possible sets of amino acids:Set 1: isoleucine-phenylalanine-leucine-serine-valine-arginineSet 2: isoleucine-asparagine-valine-leucine-serine-arginineSet 3: isoleucine-asparagine-leucine-serine-valine-arginine

3. It is not possible to determine which of the three sets of amino acids is the most likely to be included in the polypeptide based solely on the information provided.

What is a nucleotide sequence?

A nucleotide sequence is the order of nucleotides (the building blocks of nucleic acids) in a DNA or RNA molecule.

Nucleotides are composed of a sugar, a phosphate group, and a nitrogenous base, which can be adenine (A), cytosine (C), guanine (G), thymine (T) (in DNA) or uracil (U) (in RNA). The specific order of these nucleotides in a DNA or RNA molecule determines the genetic information that the molecule carries.

Learn more about nucleotide sequence, here:

https://brainly.com/question/30299889

#SPJ6


Related Questions

1. What are the four levels of organization in our bodies, from smallest to largest?
(smallest)
>
(largest)

Answers

Answer:

Cells

<

Tissues

<

Organs

<

Organ system

Answer:

cell, tissue,organ, system,these are the four level of organization in our body,from smallest to largest

Cindy/was diagnosed with anemia recently, because her physician found that her blood contains a lower count of red blood cells than normal. 4 A) What is anemia's immediate impact on gas exchange?

Answers

Answer:

The correct answer would be - a decrease in the numbers of RBCs will lead to a decrease in the ability for gas exchange in a person.

Explanation:

In the case of anemia, there would be a decrease in the number of RBCs that might be due to increased destruction of these cells, or low production of RBCs, that transporting oxygen and carbon dioxide affects the ability for gas exchange in an individual.

RBCs carry and transport oxygen to various body parts and then carry back carbon dioxide from different parts of the body to the lungs for gaseous exchange but with less number of RBCs leads to impair or decreased gas exchange in the case of anemia.

Choose all the answers that apply.

Chromosomes _____.

are tight coils of DNA
are carried on genes
always occur in pairs
can be analyzed in a karyotype
carry thousands of genes

Answers

Answer:

are tight coils of DNA

carry thousands of genes

Explanation:

Answer:

1,5

Explanation:

What was the name of the supercontinent 2million years ago?

Answers

Pangaea

Explanation:
2 million ya all land masses were connected into a single form of land called Pangaea.

Choose THREE human activities that have a negative impact on the
biodiversity within Amazon rainforests.
A
captive breeding of organisms
B
change in the land-use pattern
С
exploitation of available resources
D
Introduction of conservative measures
E
introduction of invasive species
restoration of degraded land

Answers

Answer:

The 3 would be the following:

A

captive breeding of organisms

E

introduction of invasive species

restoration of degraded land

1) In pea plants, purple flowers are dominant to white flowers. If two white flowered plants are crossed,
what percentage of the plants will be purple?
Explain your reasoning using a punnett square and a short written explanation.

Answers

Answer:

all white

If students are stuck on this one, advise them to make a "key" to help them sort it out.

PP = purple, Pp = purple, pp = white

Explanation:

Please help me I promise to mark u the brainiest and give you 40 points please can somebody help me!!


How does genetic variation allow humans to survive long-term?
Which type of reproduction is responsible for genetic variation?

Answers

Answer:

Because natural selection acts directly only on phenotypes, more genetic variation within a population usually enables more phenotypic variation. Some new alleles increase an organism's ability to survive and reproduce, which then ensures the survival of the allele in the population. Sexual reproduction promotes genetic variation by producing different gene combinations. Meiosis is the process by which sex cells or gametes are created. Genetic variation occurs as alleles in gametes are separated and randomly united upon fertilization.

Bromine is a liquid at room temperature. The volume of a sample of bromine is measured in a 50 ml beaker and a 100 ml beaker. How will the two
measurements compare?
A. The volume of bromine will be larger in the 100ml beaker.
B. The volume of bromine will be smaller in the 50ml beaker,
C. The volumes will be the same.
D. Both A and B

Answers

I think it’s D bye have a nice day

The actual volume of bromine in each beaker will be same only the difference in height will be comparable. Therefore, option (C) is correct.

What are the properties of liquid ?

A liquid's attributes are;

1) Compared to the volume occupied by a gas, the volume of a liquid is relatively stable at conditions that allow it to remain in the liquid state.

2) A liquid will take the form of the container it is placed in.

3) A liquid's surface in a container must be flat for the attraction forces between its molecules to be in equilibrium both at the liquid's surface and within its body.

Therefore, there will be variations in the measured height of the same volume of bromine in each beaker given that the volume of the bromine is measured in a 50 ml beaker and a 100 ml beaker.

Learn more about Liquids, here:

https://brainly.com/question/13279941

#SPJ5

____ are unicellular organisms with no nucleus that can cause diseases and pain with toxins.


word bank: protists, antibiotics, infectious, bacteria, pathogen, viruses, fungi, vector, vaccine.

Answers

Bacteria are unicellular organisms with no nucleus

Urea diffused in all regions of the filter during countercurrent flow. Using what you know about the sizes of urea and potassium, which graph shows what would happen to potassium during countercurrent flow?

Answers

Answer:Diffuse in all regions of the filter

Explanation:The potassium level in dialysis is often lower than usual because of incomplete equilibration

One biotic factor of a freshwater pond would include the

A) temperature of the water

B) algae growing in the water

C) mud on the bottom of the pond

D) amount of light penetrating the water
(First person who answer’s gets brainly plz answer quickly, and no trolling.)

Answers

Answer:

B. algae

Explanation:

biotic factor means something alive is in the factor. all the others are abiotic factors

The biotic factor is a living factor providing a source for ecosystem development, hence option b algae in the water are the correct option.

What is a biotic factor of a freshwater pond?

A biotic factor is a live entity that influences its surroundings. Aquatic plants, fish, amphibians, and algae are all examples of freshwater ecosystems.

A biotic factor is a live entity that influences its surroundings. Aquatic plants, fish, amphibians, and algae are all examples of freshwater ecosystems.

Turbulence, temperature, water clarity, habitat size, and water depth all influence the structure and function of ponds and lakes. Temperature interacts to affect lake stratification and water circulation.

Therefore algae that balance the aquatic ecosystem is a major abiotic factor, hence option b  in water-growing algae is correct.

Learn more about the biotic factors of a freshwater pond, here:

https://brainly.com/question/20257543

#SPJ2

Whats the name of this flower?​

Answers

I think it’s an African lily.

Answer:African lily

Explanation:

Just searched it

3. Which tool do scientists use to classify plants that is based
on a series of paired characteristics?

observation power

dichotomous key

sketch book

plant classification

Answers

dichotomous key is the answer to your question
Dichotomous key is the answer

definition of biotechnology​

Answers

Answer:

definition

Explanation:

the exploitation of biological processes for industrial and other purposes, especially the genetic manipulation of microorganisms for the production of antibiotics, hormones, etc.

PLS HELP!!!!!!!!!!!!!!!!!!!!!!!

Answers

Answer:

Other organisms were another factor. What kinds of changes in other populations of organisms could be affecting the moths?

Explanation:

umm.

4. Which of the following would be the best control sample for the study?
A)
A sample of water collected just downstream of the southern forest
(B) A sample of water collected just downstream of the housing development
C)A sample of water collected just downstream of the northern forest
D)A sample of distilled water

Answers

Answer:

D. A sample of distilled water

Explanation:

You need to have a control sample that hasn't been messed with to see what would happen if you had no reaction to your experiment

A sample is the smaller set of data which a researcher makes use of to complete a research.

As a result of this, we can see that a sample study is the use of these samples to come to a conclusion about the investigation or research which is going on.

Some examples of a sample study include:

Simple random sampling. Systematic sampling.  Stratified sampling, etc

Please note that your question is incomplete so i gave you a general overview which would help you get a better understanding of the topic.

Read more here:

https://brainly.com/question/21977459

Why can smaller cells diffuse oxygen and nutrients at a faster rate?
small surface area to volume ratio
large surface area to volume ratio
large surface area
more volume than surface area

Answers

Answer:

A further increase in the size of a cell could result in a surface area too small for adequate exchange of materials.: A large surface to volume ratio means that a small amount of living matter has a large surface through which nutrients, oxygen and wastes can diffuse.

It’s b. Large surface area to volume ratio

Scientists believe the inner core of the earth is...

A. Liquid metal

B. Somewhat melted rock

C. Solid iron and nickel

Answers

The answer is C. solid iron and nickel

What types of sources are reliable?

Answers

Answer:

A reliable source is one that provides a thorough, well-reasoned theory, argument, discussion, etc. based on strong evidence. Scholarly, peer-reviewed articles or books -written by researchers for students and researchers. Original research, extensive bibliography.

Explanation:

Hope this helps! Please mark brainiest!

Reliable  sources are usually sources that end in .org Im not sure about other sources but the most reliable ones would be the .org However, there are some .com sources that are reliable, Dont use Wikapedia, this website is a place where anyone and everyone can edit what the facts say.

I hope that this helps you out ^-^

In "gastrulation" cells begin to differentiate. They form different types of tissues so they can accomplish different purposes in the body.

True or False?

Answers

Answer:

The statement that says that In "gastrulation" cells begin to differentiate and they form different types of tissues so that they can accomplish different purposes in the body, is true.

Explanation:

Gastrulation involves a process of cell division, migration and differentiation, being one of the stages of embryonic development.

Cell differentiation and migration in gastrulation leads to the formation of germ layers, which are responsible for forming different tissues and fulfilling different functions in the body:

The outermost lamina is called the ectoderm, which can give rise to nerve tissue and part of the skin tissue. The mesoderm is the middle lamina, and from it vascular, bone, muscle, and joint tissue can develop, as well as tissues of excretory and reproductive organs.  Endoderm corresponds to the internal lamina, forming in great part the mucous membrane of the organs of the digestive system.

It is true, then, that In gastrulation cells begin to differentiate and form different types of tissues so they can accomplish different purposes in the body.

As a frog develops from a tadpole into an adult frog, it goes through changes that are signaled by hormones within the body. Which best describes the role hormones play in changing a tadpole to a frog?

Answers

Answer: In amphibians, metamorphosis is generally associated with the changes that prepare an aquatic organism for a primarily terrestrial existence In  (frogs and toads), the metamorphic changes are more dramatic, and almost every organ is subject to modification Regressive changes include the loss of the tadpole's teeth and internal gills, as well as the destruction of the tail. At the same time, constructive processes such as limb development  are also evident. The means of locomotion changes as the paddle tail recedes while the hind limbs and forelimbs develop. The tadpole's cartilaginous skull is replaced by the predominantly bony skull of the frog. The teeth used for tearing pond plants disappear as the mouth and jaw take a new shape, and the tongue muscle develops. Meanwhile, the large intestine characteristic of herbivores shortens to suit the more carnivorous diet of the adult frog. The gills regress, and the gill arches degenerate. The lungs enlarge, and muscles and cartilage develop for pumping air in and out of the lungs. The sensory apparatus changes, too, as the lateral line system of the tadpole degenerates, and the eye and ear undergo further differentiation The middle ear develops, as does the tympanic membrane characteristic of frog and toad outer ears. In the eye, both ingratiating membranes and eyelids emerge.

pls mark me as brainliest

I NEED HELP IN ENVIRONMENTAL SCIENCE PLEASE

Answers

The answer would be B.

In the laboratory, yeast cells are usually grown at a temperature of 25oC. A scientist wanted to determine if yeast cells would reproduce faster or slower when the temperature was dropped to 15oC. The same number of yeast cells were placed in the same medium with the same amount of nutrients. One sample was kept at 25oC and the other one was kept at 15oC. The number of yeast cells was counted every hour for an eighteen hour period.

Answers

Answer:

This question is incomplete, however, it is asking to identify the following variables:

Independent variable: Temperature

Dependent variable: Number of yeast cells

Constants: same amount of nutrients, same number of yeast cells, same medium

Explanation:

- Independent variable is the variable that the experimenter changes or manipulates in order to bring about a measurable effect. In this experiment, the TEMPERATURE at which the yeast are kept is the independent variable.

- Dependent variable is the variable that responds to the changes made to the independent variable. It is the variable that is measured by the experimenter in the experiment. In this case, The NUMBER OF YEAST CELLS was counted, hence, it is the dependent variable.

- Constants are variables that are kept unchanged or same for all groups by the experimenter in order not to influence the experiment's outcome. In this case, the CONSTANTS are: same amount of nutrients, same number of yeast cells, same medium etc.

C. _____________________ store food or pigments.

Answers

Answer:

Plastids

Explanation:

A dog breeder is looking into purchasing a 3 year old male dog for her business. A breeder online is advertising purebred males for $700. What would you suggest the breeder do before she purchases this dog?

Answers

Answer:

The dog breeder to check for all the details that meets her requirement of dogs.

Explanation:

A dog breeding is the practice of mating dogs. In the context, it is given that a dog breeder wants to purchase a male dog of three year old for her business and she founds an advertisement on the net about a purebred males that costs $700. Now before buying this purebred male dog, the dog breeder should first of all check whether the seller who is selling online is a licence breeder or not.

The dog breeder should also check whether the dog is a purebred or not and should also find out the actual age of the dog. The health of the dog should be checked by an professional vet before buying the dog.

The selling of dogs, either a hybrid or a purebred costs differently. An individual should check the license and health of the dogs before purchasing.

In the given example, the dog breeder is trying to purchase a three-year male dog. She saw an advertisement that the male dog is available at the rate of dollars 700.

Before purchasing the dog, the breeder should check:

the authenticity of the advertisementrespective seller details and valid contact information the genotype of the dog as claimed purebred, and the health of the dog from a professional veterinarian.

Thus, the breeder should check all the authenticity of the dog and its health.

To know more about dog breeding, refer to the following link:

https://brainly.com/question/3242524

How does a crater formed by the impact of a meteorite differ from a crater formed by volcanism?

Answers

Answer: Whereas volcanic craters arise from deep inside the planet, impact craters originate in outer space.

Explanation:

Classify photosynthesis and cellular respiration as endergonic or exergonic. Explain how you know.

Answers

Explanation:

photosynthesis is an endergonic process as it involves the absorbtion of energy (in the form of sunlight), while cellular respiration is an exergonic process as it involves the release of energy in the form of ATP molecules-the energy currency of the cell.

What is the graphical representation of age structure known as?
OA.
age group
OB. age graph
Oc. age scale
OD
age pyramid

Answers

Answer:

The graphical representation of the age structure is known as age pyramid (option D).

Explanation:

The age pyramid or more properly called population pyramid groups all the individuals of a population, distributing them by age and sex. The name is due to the fact that, in general, the bar graph resembles a pyramid.

The age groups are distributed in the pyramid by age from lowest (bottom) to highest (top), with the sexes forming the sides of the pyramid.

In emerging countries the population is relatively young, which makes the base of the pyramid wide, narrowing as it moves up to the upper age groups.

    Age group, age graph or age scale do not correspond to the population graph where the age and sex structure of a population are expressed.

Answer:

Option D (i just took the test)

Explanation:

What does atomic number tell you about an atom? * Number of electrons in the nucleus Number of protons and neutrons in the nucleus Number of protons in the nucleus Number of electrons in the electron cloud around the nucleus *NEED ANSWER QUICKLY*

Answers

Answer:

Number of protons in the nucleus

Answer:

Number of protons in the nucleus

Explanation:

Please help It is making me cry

Answers

Answer:

What are you supossed to be doing

Explanation:

Answer:

Can you give me the answers?

Explanation:

Other Questions
How do you draw a lewis structure? Allows input/output of audio info to and from the computer.A. Central Processing UnitB. Sound CardC. Video CardD. Audio Player MiKiyah invested $2,500 in a simple interest account for 2 years. At the end of the 2 years, she has earned $75 in interested. What was the simple interest rate of the account? Bettner, Inc., is a calendar year corporation whose financial statements for 2015 and 2016 included errors as follows:Year Ending Inventory Depreciation Expense2015 $ 12,000 overstated $ 22,300 overstated2016 8,000 understated 6,000 understatedAssume that inventory purchases were recorded correctly and that no correcting entries were made at December 31, 2015, or December 31, 2016. The errors were discovered in 2017, after the 2016 financial statements were issued.Required:Ignoring income taxes, prepare the journal entry Bettner would make in 2017 to correct the errors. 13. Which equation has real, rational, and unequal roots?A) x2 + 10x + 25 = 0 B) 22 5x + 4 = 0C) x2 3x +1=0 D) 22 2x + 5 = 0Help I really need to finish this can somebody help an egg cell in a gorilla contains 24 chromosomes. When the egg cell is fertilized, which of the following occurs?A.The 24 original chromosomes replicate, resulting in 48 chromosomes in the fertilized egg.B.The 24 original chromosomes split at the centromere, resulting in 48 chromosomes in the fertilized egg.C.The nucleus of a sperm cell fuses with the nucleus of the original egg cell, resulting in 48 chromosomes in the fertilized egg.D.The nucleus of another egg cell pairs with the nucleus of the original egg cell, resulting in 48 chromosomes in the fertilized egg. A receiver catches a football on the 50.0 yard line and is tackled 5.42 seconds later on the 12 yard line. Whatwas the runner's average speed? . What number replaces to make the sentence true? 1 + 3 + 4 + 6 + 6 + 8 + 9 + 11 = 4 . Image P is shown in the coordinate grid Image P is translated 2.5 units to the right and 3.5 units up to create image P'.6Image P12 34Which rule describes this transformation? help me please !!!!! PLZ HELP! I WILL GIVE YOU BRAINLIEST!Read the excerpt from The Monsters Are Due on Maple Street.STEVE(raising his voice)There's something you can do, Charlie. You could go home and keep your mouth shut. You could quit strutting around like a self-appointed hanging judge and just climb into bed and forget it.CHARLIEYou sound real anxious to have that happen, Steve. I think we better keep our eye on you too!DON(as if he were taking the bit in his teeth, takes a hesitant step to the front)I think everything might as well come out now.(he turns toward Steve.)Your wife's done plenty of talking, Steve, about how odd you are!CHARLIE(picking this up, his eyes widening)Go ahead, tell us what she's said.58. LONG SHOT STEVE 58.As he walks toward them from across the street.STEVEGo ahead, what's my wife said? Let's get it all out. Let's pick out every idiosyncrasy of every single man, woman, and child on the street. And then we might as well set up some kind of a kangaroo court. How about a firing squad at dawn, Charlie, so we can get rid of all the suspects. Narrow them down. Make it easier for you.DONThere's no need gettin' so upset, Steve. It's just that . . . well . . . Myra's talked about how there's been plenty of nights you spent hours down in your basement workin' on some kind of radio or something. Well, none of us have ever seen that radioHow does Steves attempt to reason with his neighbors affect other elements of the story?The neighbors calm down and go home for a while.The neighbors become suspicious of him as well.The neighbors elect Steve their leader.The neighbors become a wild mob. Which statement describes the role played by the U.S. journalists during theSpanish-American war? need help plzzzzzxsss PLS PUT THE CORRECT ANSWER AND SHOW HOW YOU DID IT PLS :(5-7(9b-3d). D=3 b=9 the length of the hypotenus of a certain right triangle is 50 inches and the length of its legs is 40 inches . what is the length in inches of the other leg of the triangle How many sets do you have to win to win a match? A. 1 out of 2 B. 2 out of 3 C. 3 out of 4 D. 4 out of 5 (Its about tennis...) How were Native American tribes to be compensated for "moving" to the Indian Territory? 100 POINTS HELP ME PLEASEEEEEE what were the first reform of bolivar and miranda?