please help meeeeeeeeeee

Please Help Meeeeeeeeeee

Answers

Answer 1

Answer:

D

Explanation:

Answer 2
D like the person above

Related Questions

Which of the following processes is NOT a physical or chemical change?
a. crushing
b. weighing
c. melting
d. passing electric current

Answers

B. Weighing , because all its checking is the weight.

Answer:

b

Explanation:

doesn't change anything

when an experiment shows that two variable are closely related the experiment shows what

Answers

Answer:When an experiment shows that two variables are closely related, the experiment shows correlation between the two variables. Correlation helps to show how two variables are related and connected. Related variables are said to be correlated. For example, we can say, good health is correlated to daily exercise routine.

Explanation:

Write any three differences between mass and weight


please its aurgent fast ​

Answers

Answer:

See explanation

Explanation:

There are a number of differences between mass and weight, they include;

Mass is  a scalar quantity whereas weight is a vector quantity.

Mass is dependent on the quantity of matter present in a body whereas weight depends on the acceleration due to gravity in a particular location on the earths surface.

The SI unit of mass is kilogram whereas the SI unit of weight is Newton.

decode CCGCTTTCGCTATTATAAAAAGGGCTATAACTA

Answers

Answer:

GGCGAAAGCGAUAAUAUUUUUCCCGAUAUUGAU. I think sorry if I'm wrong

What are the three main classifications that describe galaxies? By what one visible
characteristic do scientists categorize galaxies?

Answers

Answer:

Spiral Galaxies, Elliptical Galaxies  & Irregular Galaxies

Explanation:

How did galaxies originate? Astronomers believe that after the big bang, the explosion which began the universe 10 billion to 20 billion years ago, gravity began to compress masses of free-floating gas. Two main theories, bottom-up and top-down, explain what happened next. According to bottom-up theories, clusters began to form and assembled together into the larger units we know as galaxies. Top-down theories suggest that galaxies formed first, and the stars and other objects within them were subsequently produced. They categorized different galaxies to maintain their tests from the other galaxies.

When covalent bonds form. the amount of energy present decreases. What happens to the stability of the atoms in the bond?

Answers

Covalent bonding occurs when pairs of electrons are shared by atoms. Atoms will covalently bond with other atoms in order to gain more stability, which is gained by forming a full electron shell. By sharing their outer most (valence) electrons, atoms can fill up their outer electron shell and gain stability.

Identify the converted product of the photosynthesis process.​

Answers

During the process of photosynthesis plants break apart the reactants of carbon dioxide and water and recombine them to produce oxygen (O2) and a form of sugar called glucose (C6H12O6).

How do I calculate a heart rate?

Answers

Explanation:

To check your pulse at your wrist, place two fingers between the bone and the tendon over your radial artery — which is located on the thumb side of your wrist. When you feel your pulse, count the number of beats in 15 seconds. Multiply this number by four to calculate your beats per minute.

Which is most likely the last to form

Answers

where’s the photo ? or answer choices?

list one part of the cell theory in your own words, explain what it means

Answers

One part of the cell theory is that pre-existing cells can form more cells

This means that cells that currently exist are capable of creating more cells, however it’s a slow process

Can you share some interesting information about HIV?​

Answers

HIV CAME FROM CHIMPS

Answer:

yes HIV can  be  transmitted  through  sex or already chewed food like your mom did for you when you were a baby it can also your mothers breast so i hope u drank out of a bottle

Explanation:

All planets in the solar system have surfaces that are made up of either one of two materials. What are the two materials?

Answers

Answer:

are made of rock, containing common minerals like feldspars and metals like magnesium and aluminum.

Explanation:

please help
Explain how an organ and organelles are related

Answers

Answer:

Just as organs are separate body parts that perform certain functions in the human body, organelles are microscopic sub-units that perform specific functions within individual cells. Organelles are specialized structures that perform various jobs inside cells.

Organelles are microscopic subunits that carry out certain tasks within individual cells, whereas organs are distinct body sections that carry out specialized tasks for the human body.

What is the relation between organ and organelles?

Literally, the phrase refers to “tiny organs.” Organelles provide specialized functions to keep a cell alive, much like organs like the heart, liver, stomach, and kidneys serve specific functions to keep an individual alive.

Atoms, molecules, organelles, cells, tissues, organs, organ systems, and the human organism are the major levels of organization in the body, going from the simplest to the most complex.

Like an organ in the body, an organelle is a subcellular structure that performs one or more particular functions for the cell.

Therefore, organ and organelles differ in their functioning.

Learn more about organ and organelles here:

https://brainly.com/question/22911736

#SPJ2

!!pls help!!

taj incorrectly states that autographs are also known as consumers that need to feed on other organisms, including plants and animals, to gain energy. which of the following best describes consumers that feed on other organisms such as plants and animals for energy?

A. carnivores
B. trophic levels
C. heterotrophs
D. herbivores

Answers

the answer is D) herbivores

Herbivores best describes consumers that feed on other organisms such as plants and animals for energy.

What do you mean by herbivores?

A herbivore is an animal anatomically and physiologically adapted to eating plant material, for example foliage or marine algae, for the main component of its diet.

Many herbivores have large, dull, flat teeth. These teeth are excellent for chewing and breaking down tough plant material. Carnivores have sharp, narrow teeth that are better for biting and tearing flesh. However, some herbivores also have strong, sharp teeth.

Examples of large herbivores include cows, elk, and buffalo. These animals eat grass, tree bark, aquatic vegetation, and shrubby growth. Herbivores can also be medium-sized animals such as sheep and goats, which eat shrubby vegetation and grasses.

Learn more about herbivores:

https://brainly.com/question/16786804

#SPJ2

Is sand called sand because its in between the sea and the land?
I'm asking the questions that need to be asked people! :'D

Answers

No, not at all. ... The English word 'sand' comes from Old Dutch/proto-German 'zand', which has nothing to do with either sea OR land, but referred originally to unstable ground, as near rivers.

I hate the English language sometimes, like: "waterfall". But anyways, I hope this helps ^^

Hmmm... I've never thought of that before... nice catch lol

Have a great day :D

A student was asked the following question on her biology final exam
question : how do organisms grow in size
her answer : “organisms grow in size when the cells within the organism grow larger. As the cells grow larger the organism grows larger as well
Explain why her answer is not correct then explain how she should have answered the question

Answers

The cell can grow large but not the organisms. Once the cell is growing the organisms grow smaller. I think hope it correct

Select the correct bisector of the segment.
B
A
B
B
B
А
M
B
B
D

Answers

Answer:

C

Explanation:

it has the example figure number 7 and also it has the correct bisector

What determines which bases will be brought to the DNA strand during DNA replication?

Answers

Answer:
Replication relies on complementary base pairing, that is the principle explained by Chargaff's rules: adenine (A) always bonds with thymine (T) and cytosine (C) always bonds with guanine (G).

16. In which of the following situations are the phenotypes of F2 offspring expected to follow
the ratio of 9:3:3:1?
a. monohybrid cross for two unlinked traits
b. a monohybrid cross for two closely linked traits
c. a dihybrid cross for two unlinked traits
d. a dihybrid cross for two closely linked traits​

Answers

Answer:

C

Explanation:

The F2 offspring of a cross would follow the ratio of 9:3:3:1 only if the cross is a dihybrid for two unlinked traits.

There is nothing like a monohybrid cross for two traits. A cross involving two traits is a dihybrid cross. Hence, options a and b are out of the equation.

A dihybrid cross for two closely linked traits would produce F2 offspring in another ratio that is different from 9:3:3:1 depending on the linkage map.

Hence, the correct option is C.

The function of mitochondria and chloroplasts is related to energy. In what way does their function differ?
A.
Mitochondria produce energy in prokaryotic cells, while chloroplasts produce energy in eukaryotic cells.
B.
Mitochondria produce energy from food, while chloroplasts produce food from the Sun’s energy.
C.
In plants, mitochondria provide energy in non-green cells, while chloroplasts provide energy to cells in parts of the plant that are green.
D.
Mitochondria provide energy in the night, while chloroplasts provide energy in the day.
E.
Mitochondria provide energy from food synthesized by organelles other than chloroplasts, while chloroplasts provide energy through photosynthesis using the Sun’s energy.

Answers

Answer:

The answer is option E- Mitochondria provide energy from food synthesized by organelles other than chloroplasts, while chloroplasts provide energy through photosynthesis using the Sun’s energy.

Explanation:

It’s E the answer is E mitochondria provide energy from food synthesized by organelles other than chloroplasts while chloroplasts provide energy through photosynthesis using the sun’s energy

.
Why are some sources of sugar better than others?

Answers

Explanation:

[tex]\huge{\underbrace{\overbrace{\mathfrak{\pink{Answer:❣}}}}}[/tex]

Whether an added sugar contains more or less fructose versus glucose has little impact on health. (An exception may be people with diabetes who need to control their blood glucose, in which case a higher-fructose, lower-glucose sugar may be preferable

Answer:

Some sugar that's made is usually take and unhealthy, but other sources can be purely made with no artificial s added to it making it fake.

How is the rock in the deep mantle similar to the rock in the parts of the mantle nearest the surface? How is it different?

Answers

Answer:

Rocks within the mantle contain more magnesium and iron than the ones in the crust. Difference: Rocks in the deep mantle are under intense heat and pressure.

At which type of technonic plate boundary is a volcano least likely to occur​

Answers

Answer:  A

coz its just sliding one another

Hope it is correct

^_^

biological macromolecules are organized into four main categories. What type of macromolecule contains phosphorus as part of a phosphate group?
1.) lipids
2.) proteins
3.) nucleic acid
4.) carbohydrates

Answers

Answer:

3.) nucleic acid

Explanation:

Biological macromolecules can be defined as a very large molecule (structure) that comprises of covalently bonded organic atoms and smaller molecular structures (monomers).

Biological macromolecules are organized into four main categories and these includes;

I. Lipids: these categories of biological molecules is mainly made up of fats and it is responsible for providing the body with long-term energy.

II. Carbohydrates: it is contained in energy-giving foods and it aids the functioning of the muscles, nervous system and other organs found in the body.

III. Proteins: it contains amino acids and it is responsible for maintaining the functioning of the body system.

IV. Nucleic acid: it comprises of deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) which are the genetic codes (blueprints) for living organisms.

Hence, the type of macromolecule that contains phosphorus as part of a phosphate group (sugar 2-deoxyribose) is nucleic acid.

From the biological macromolecules, Nucleic acids contains phosphorus as part of a phosphate group.

Nucleic acids are biopolymers, macromolecules, crucial for all known types of life. Nucleotides, which are the monomer components, make up their structure. a sugar with five carbons, a phosphate group, and a base with nitrogen. Deoxyribonucleic acid and ribonucleic acid are the two main types of nucleic acids.

Deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) are two types of nucleic acids that carry genetic information that is read by cells to create the RNA and proteins that allow living things to function.

Know more about nucleic acids:

https://brainly.com/question/11737667

#SPJ6

what happens to the neuron when u do drugs

Answers

Answer:

Explanation:

well different kinds of drugs can affect neuron activity an example is if you take pain pills it blocks the neurons that sense pain other drugs can give you high levels of dopamine, dopamine is the hormone that makes you feel good. that is why drug addictions are serious, and many cannot stop the addiction because it makes them feel good. and if you take the same dose over time your body gets a tolerance to the drug and you need a higher dose every time to get the same feeling and that can lead to an overdose or even death.

and no this is not copied :)

Explain which processes take place during meiosis that lead to variation in inherited traits.

Answers

Answer:

We are left with four haploid cells; each one genetically different from each other and the parent cell. 8. Describe the three ways meiosis produces genetic variability. We have seen that meiosis creates variation three ways: crossing over, mutations caused during crossing over, and independent assortment.

multiple choice
Daytime temperatures on Mercury are extremely hot because:

1. it is close to the sun
2. it has long days
3. one side is facing the sun
4. it gives off internal heat
5. there are volcanoes

Answers

Answer: it has long days

Explanation:

Identity Factors in an Experiment
WARM-UP
Consider what you already know about scientific design. To set up an experiment testing whether
students' grades are affected by their level of exercise, which factors do you think you would need to keep
in mind? Check all that apply.
student gender
vpe of exercise
amount of exercise
what grades are measured
how long the experiment will last
what time of day the students exercise
how much time the students spend studying
DONI

Answers

Answer:

Did you copy and paste this from somewhere because i want to help but i don't understand it at all.

Explanation:

1. What is the pH range for an acid?

A. 0 - 7- 14



2. What is the pH range for a base

A. 0 - 7- 14



3. What are the products of an acid base reaction?

A. water and salt

B. acid and base

C. water and sugar

D. water



4. What substance has a neutral pH?

A. ammonia

B. water

C. sodium bicarbonate

D. vinegar



5. The negative ion found in bases is the ______________

A. hydrogen ion (H+)

B. hydroxide ion (OH-)

Answers

Answer:

0-7-14

0-7-12

c is correct water and suger

d is correct vinegar

b is correct (OH-)

What happens to excess carbohydrates in animals?
They are stored as fat.
They are stored as protein.
They are stored in nucleic acids.
They are stored as sugar.

Answers

Answer:

A-They are stored as fat.

Explanation:

In animals, the excess of carbohydrates or glucose is first converted into glycogen (polysaccharide) through the process called glycogenesis. ... When glycogen reservoirs are saturated, excess carbohydrates, as well as proteins, are converted into fats which are then majorly stored in adipose tissues.

the answer would be they are stored as fat :)))
Other Questions
coriolisWhich of the following cause the winds to move in the bands on the diagram?uneven heating of the Earth and the Coriolis Effectthe Earth's rotation and the Earth's revolutionlocation of the oceans and locations of the mountainsplate movements and high pressure systems Find the value of x.3430x = A 52 gram sample of an unknown metal requires 714 Joules of energy to heat it from30.5C to 82C. What is the specific heat ofthis metal?Answer in units of J/g C. 1. PART A: How does paragraph 6 help to develop the plot of this short story?A. The little girl grows so cold that her hands become numb, and she is unable to sellher matches.B. The little girl begins to imagineself inside of the warm home, which leads her tolater try and enter the homesC. The little girl strikes her first match, beginning a set of visions that bring herwarmth and comfort despite her cold.D. The little girl strikes a match, using up a match she could sell, which causes her toget in trouble later. explainHow important is warm up? A submarine 50.2 m below the surface of the oceangoes up 15.6 m. Then it goes down 35.7 m. What is thesubmarine's new position relative to the surface of theocean? Show your work.Please help it due today please help One of the benefits of yoga for the elderly population is:fall preventionbetter appetiteimproved mental capacityweight loss how many feet are in 2 miles 300 feet? 1pt Copper chloride and aluminum react to producealuminum chloride and copper. Which of thefollowing is the correctly balanced chemicalequation for this reaction?O A. CuCl, + Al -> AICI, + uO B. 3CuCl, + Al -> AlCl, + 2CuOC. 3CUCI, + 2Al -> 2AICI, + 3CuOD. CuCl, + 3Al -> AICI, + 2Cu . Distinguish between the short run and the long run as they relate to macroeconomics. Why is the distinction important PLEASE HELP! DUE TOMORROW 1-8-21 !! Look at these equations. Write each equation in slope-intercept form. Are these equations the same or different? Explain. I dont know how to do the middle equation so please show work for that. Rectangle ABCD has a width of 8 yards and a length of 20 yards. Rectangle QRST, which is similar to rectangle ABCD, has a length of 40 yards.Find the scale factor of ABCD to QRST and the perimeter of each rectangle. is the inauguration process still the same today as it was when the first president took office please help!! 3. A coil of 100 turns encloses an area of 100 cm2. It is placed at an angle of 700 with amagnetic field of 0.1 Wbm-2. What is the magnetic flux through the coil? If the magneticfield is reduced to zero in 10-3s, what emf is induced in the coil? Can speaking a different language be a communication barrier?Group of answer choicesYesNo Round 1.453 to the nearest tenth. T/F There may be occasional reasons to go into debt, like real emergencies. ah hurry!In a bag, you have a strip of paper with the numbers 1-10 written on the strips. If one strip of paper is pulled from the bag and then replaced, what is the probability of the following events: pick the number 3 and then picking the number 6.A: 1/100B: 1/10C: 3/10D: 6/10 repartirllamarsetraerabrirrecorrerescribirsacarChoose a verb from the box above to completethe sentences in the present tense.1. Mi familia siemprecelebrarel Da de los Reyes Magos el 6 de enero.2. En diciembre mis hermanos y yoa los Reyes Magos.nuestras cartas3. Los Reyes!Melchor, Gaspar y Baltasar..4. Los Reyescalles en sus camellos.en la Cabalgata ylas5. Los Reyescaramelos a todos los nios. Artificial selection applies only to dog breeding? True OR False.