Natural killer (NK) cells are also called cytotoxic T cells (Option A).
What are NK cells?The NK (Natural killer) cells are cytotoxic lymphocytes that trigger responses from the innate immune system.
Natural killer cells are one of the most important types of lymphocytes (white blood cells) in human cells.
These cells have cytotoxic properties because they produce cytotoxic granules and different cytokines.
Learn more about NK cells here:
https://brainly.com/question/14308447
If the same object was taken to each of the planets, where would it weigh the most, and where would it weigh the least?
Answer:
answer in the link.
Explanation:
If you find a rock that has a belemnite fossil in it. how old is the rock? Explain your reasoning
Answer:
See below.
Explanation:
Belemnites is a genus of an extinct group of cephalopodsThese cephalopods existed in the Early Jurassic period from the Hettangian age (196.5–199.6 million years ago) to the Toarcian age (175.6–183.0 million years ago). Therefore, the discovered rock could be anywhere from 175.6 - 196.5 million years oldIntroducing a vascular catheter directly into a vessel without further advancement past the punctured vessel is called __________ vascular catheterization.
It is called central vascular catheterization
Importance of catheterizationCatheterization is defined as the use of medical devices that can be inserted into the body and used for different medical purposes.
Vascular catheterization is a peripheral catheterization that is used to detect certain upper and lower peripheral extremity conditions.
There are different types of vascular catheterization which include:
Arteriovenous (AV) fistula, Arteriovenous (AV) graft andCentral venous catheter (CVC)Central vascular catheterization involves Introducing a vascular catheter directly into a vessel without further advancement past the punctured vessel.
Learn more about catheterization here:
https://brainly.com/question/3911876
In photosynthesis what is the end product of carbon dioxide?
Answer:
Carbohydrates(glucose) and Oxygen.
Explanation:
During the process of photosynthesis, Carbon dioxide and Water combine in the presence of Sunlight and Chlorophyll to produce Carbohydrates (glucose) and Oxygen. Thus, the end products of photosynthesis are Carbohydrates(glucose) and Oxygen.
Monosaccharides disaccharides and polysaccharides are examples of:.
Answer:
Carbohydrates
Explanation:
Why does the DNA move through the gel when an electrical current is generated?
Answer:
DNA is negatively charged, therefore, when an electric current is applied to the gel, DNA will migrate towards the positively charged electrode. Shorter strands of DNA move more quickly through the gel than longer strands resulting in the fragments being arranged in order of size.
Explanation:
what is the approximate time of death if the body temperature was 10 degrees celcius
Answer:
I think it would be 2 to 3 days am so sorry if am wrong
Explanation:
F = c * {9/5} + 32 is the equation
F = 10 * {9/5}
F = 10 * 1.8
F = 18
where is the digestive and circulatory system connected?
a. alveoil
b. villi
c. artery
d. pancreas
Answer:
The products of the digestive system are actually tied directly to the circulatory system in that the organs of the digestive system are used to turn ingested food into products that can be absorbed by the blood and then carried to other organs for use as energy or other functions.
Explanation:
Answer:
b) Villi
Explanation:
The digestive and circulatory system is connected by villi.
It is the tiny finger-like projections that line inside of small intestine. Therefore, option (b) is the answer.
What system plays a vital role in the existence of the human species?
What's the ans?
Answer:
The reproductive system.
Explanation:
Without the reproductive system, humans are not able to reproduce meaning the human species would go extinct. With the reproductive system, humans are able to create more humans, in this way humans do not go extinct.
What three identifying features of a chromosome are used to pair homologous chromosomes in a karyotype?.
Answer:
To "read" a set of chromosomes, scientists use three key features to identify their similarities and differences:
Size. This is the easiest way to tell chromosomes apart.
Banding pattern. The size and location of Giemsa bands make each chromosome unique.
Centromere position. Centromeres appear as a constriction.
Explanation:
.......................................................
..........................................................
///////////////////////////
Answer:
2 2/9
Explanation:
5 x 4/9
20/9
divide 20 by 9
= 2 2/9
Answer:
2[tex]\frac{2}{9}[/tex] is the answer
Explanation:
hope this helps
The weight of an object also depends on
Answer:
the value of the acceleration of gravity.
Explanation:
how much water is in our bodies
60%
Explanation:Water makes up up to 60% of the adult human body. Water makes up 64 percent of the skin, 79 percent of the muscles and kidneys, and even 31 percent of the bones.
I hope this helps you
:)
Can a cell be an organism on its own
nah cant
Explanation:
cuz and organisms definition is:
an individual animal, plant, or single-celled life form.
SINGLE-celled life form meaning all the cells are the same
hope this helps :D
What happens to the lac operon when both glucose and lactose are present?
Answer:
If both glucose and lactose are both present, lactose binds to the repressor and prevents it from binding to the operator region. The block of lac gene transcription is thus lifted, and a small amount of mRNA is produced.
Explanation:
Which change in surface water will cause a decrease in groundwater?
a.rising temperature melt glaciers
b.drought decreases the flow of streams
c.treated wastewater is released over a field
d. water conservation methods are adopted by a town
Answer: D
Explanation:
Based on the diagram, what would happen if Earth had no atmosphere?
Diagram of greenhouse effect showing the sun, atmosphere, and human activities that release greenhouse gases. The diagram shows that sunlight is reflected back to space by the atmosphere, absorbed at the surface, and reflected by the surface. Greenhouse gases trap heat from the sun. Examples of human activities include CFCs and haloalkane from refrigerators and aerosols, nitrous oxide from gasoline and agriculture, methane from cattle and fertilizer, and carbon dioxide from oil and coal.
Human activities would not release greenhouse gases.
Greenhouse gases would not trap heat from the sun.
Sunlight would not be absorbed at the surface.
Surface temperatures would be maintained.
Based on the diagram, we can confirm that if Earth had no atmosphere, Greenhouse gases would not trap heat from the sun.
Why would these gases not trap heat from the sun without the atmosphere?Greenhouse gases are located in the atmosphere, therefore, without it, they would not be able to trap the heat from the sun. Although high concentrations of these gases are a modern problem in global warming, these gases are a natural part of the earth and are necessary to maintain livable temperatures at the surface of the earth.
Therefore, we can confirm that if Earth had no atmosphere, Greenhouse gases would not trap heat from the sun.
To learn more about greenhouse gases visit:
https://brainly.com/question/11595872?referrer=searchResults
Answer:
Greenhouse gases would not trap heat from the sun.
Got it right. Have a great day!
1. Is sneezing and coughing on clothes better than using tissue paper?
2. Do disinfect wipes work effectively?
Answer:
1. no because the bacteria will stik on your clothes
2. yeah
Which of the following best explains why deforestation increases the risk of floods in an area? a. Tree leaves catch and retain rain water. B. Trees block the free flow of water. C. Deforestation increases precipitation. D. Tree roots improve soil water retention. Please select the best answer from the choices provided A B C D.
Deforestation increases the risk of floods in an area tree roots improve soil water retention.
Why does deforestation result in higher flood risk?When deforestation takes place, the top layer of soil can be dislodged – this is also known as soil erosion.
When the top layer of soil is unstable, it is unable to retain any of the water that falls on it, resulting in increased surface run-off, which, in turn, increases the risk of flooding.
Thus, option "D" is correct.
To learn more about deforestation click here:
https://brainly.com/question/17178423
There was a change in the environment between generations 10 and 30. the change likely .
These adjustments are in all likelihood genetic mutations evolution is the technique of alternating all existing paperwork from one era to the next and evolutionary biology research how this evolution takes place.
Every era of organisms inherits trends owned via way of means of their mother and father via genes. Changes (known as mutations) in this gene will new trends withinside the offspring of an organism. In an organism's populace, a few trends become greater common, even as others will disappear.This technique is known as herbal selection. The profits of greater offspring than the variety of mother and father at the side of the inheritance.What are heredity mutations?Hereditary mutations encompass cystic fibrosis, hemophilia, and sickle mobileular disease. Other mutations can occur on their very own at some stage in a person's existence. These are known as sporadic, spontaneous, or new mutations.
Thus it is well explained.
To learn more about evolution refer to the link :
https://brainly.com/question/1144962
Answer:
✔ favored trait AExplanation:
An organism has two different possible traits, A and B. A graph of the population is shown right. Which of the following statements is true about Trait B? Check all that apply.
It decreased in frequency over time.
It became extinct.
It is carried on a recessive allele.
There was a change in the environment between generations 10 and 30. The change likely
✔ favored trait A.18 The size of a mouse population in a natural
ecosystem tends to remain relatively constant due to
A. the cycling of energy.
B. the lack of natural predators.
C. the increased numbers of decomposers.
D. the carrying capacity of the environment.
Answer:
D- the carrying capacity of the environment.
Explanation:
The limiting factors also called as the carrying capacity of the environment keeps the size of a mouse population in a natural ecosystem constant. Therefore, option (D) is correct.
What is a limiting factor in a ecosystem?Limiting factors are physical, biological, and ecological conditions that:
(1) Limit the ecosystem's ability to sustain native plant and animal populations and to accommodate natural disturbances like floods;
(2) Limit the quality or availability of habitat that supports all life stages of native species; and
(3) Limit the ecosystem's ability to sustain the local tribal culture.
The only natural factor limiting the number of mice in the home is a scarcity of resources such as food. Therefore, The limiting factors also called as the carrying capacity of the environment keeps the size of a mouse population in a natural ecosystem constant.
Learn more about carrying capacity, here:
https://brainly.com/question/2375972
#SPJ2
Three examples of mitotic reproduction are __________________________, __________________________, and _______________________________
Answer:
Yeast budding. Binary fission. Replacement of worn out tissues.
Explanation:
If an herbicide were to selectively inhibit development of antheridia in a moss colony, what would be the consequence?
The most likely consequence of a herbicide that selectively inhibits the development of antheridia would be the reproduction of female plants only.
Whta are antheridia?The antheridia are haploid reproductive structures that produce male gametes in some types of plants.
The antheridia can generate a special type of biflagellate sperm (male gametes) required during se_xual reproduction.
Conversely, archegonia is a structure that produces a single egg, i.e., the ovum or female gamete.
Learn more about antheridia here:
https://brainly.com/question/1286197
Which mrna sequences would form a structure that is a cue for transcription termination of some genes?
Answer:
First, you must know what the stop codons are: UAA, UAG, and UGA
Whenever this sequence is read, it signals for an end in transcription and amino acids will stop being formed
Thus, 5′−GGCCCUUUUAGGGCCUUUUU−3′ contains a cue for transcription termination as it will stop after the codon "UAG"
Explanation:
Those mRNA sequences that consist of the stop codons like UAA, UGA, and UAG would form a structure that is a cue for transcription termination of some genes.
What do you mean by Transcription?Transcription may be defined as the process by which the information in a strand of DNA is copied into a new molecule of messenger RNA (mRNA).
Stop codons are responsible for the termination of transcription of almost all the genes. They are necessary for inhibiting the excessive expression of some genes.
Therefore, those mRNA sequences that consist of the stop codons like UAA, UGA, and UAG would form a structure that is a cue for transcription termination of some genes.
To learn more about Transcription, refer to the link:
https://brainly.com/question/1048150
#SPJ4
Hello people ~
The interspecific interaction in which one partner is benefitted and the other is unaffected (neutral), is called
(a) amensalism
(b) mutualism
(c) competition
(d) commensalism
Answer:
it is called commensalism
Explanation:
because it benefits one and other derives neither benefit nor harm
Answer:
CommensalismExplanation:
It is a symbiotic relationship in which one benefitted and the other one is neither benefitted nor harmed..
Topic : Photosynthesis and Energy transfer in food chains
App : Teams Homework
Note : it’s ok if u can’t write an essay but can anyone please share their ideas so I can put it together
How is gravity simulated on the hermes spacecraft?.
Answer:
A section of the spacecraft is slowly rotated in order to simulate the force of gravity.
Explanation:
The rotational force of the spacecraft makes an artificial sort of gravity, which can be altered by changing the speed of the spinning or by moving the rotating part further/closer to the center point of rotation.
What makes erythrocytes unique from other cellular components of the blood?.
Answer:They contain hemoglobin.
Explanation:
When two protein chains combine to form an active protein, the structural level is ________
When two protein chains combine to form an active protein, the structural level is quaternary.
What is a quaternary structure?The quaternary and tertiary structure of a protein is the tridimensional shape of the protein, which involves protein domains.
The quaternary protein structure refers to the different arrangements generated by different protein subunits.
The primary structure of a protein involves its amino acid sequence, whereas the second structure involves protein chains.
Learn more about quaternary structure here:
https://brainly.com/question/5286438
When two protein chains combine to form an active protein, the structural level is the quaternary arrangement.
What do you mean by Proteins?Proteins may be defined as naturally emerging, extremely intricate substances that comprise amino acid residues joined by peptide bonds.
The Quaternary structure of a protein is very complex and 3-dimensional as compared to other protein structures which involve numerous motifs and domains.
Therefore, when two protein chains combine to form an active protein, the structural level is the quaternary arrangement.
To learn more about Protein structures, refer to the link:
https://brainly.com/question/14207491
#SPJ4
In a population of pea plants such as the one below, bees and other pollinators prefer to land on purple colored flowers. Over generations, more and more purple flowers successfully reproduce due to this pollinator preference. Which of the following statements accurately describes what is happening to the pea plants over time?
Question 2 options:
Natural selection causes evolution in the population of pea plants and leads to increased overall variation.
Natural selection causes evolution of individual pea plants and leads to increased overall variation.
Natural selection causes evolution in the population of pea plants and leads to an increase in favorable adaptations.
Natural selection causes evolution of individual pea plants and leads to an increase in favorable adaptations.
Answer:
Natural selection causes evolution in the population of pea plants and leads to an increase in favorable adaptations.
Explanation:
The flowers will evolve to keep that purple trait in order to continue their population growth, hence why it is not individual evolution but as a population. Also since the purple color is a favorable trait it will lead to an increase in favorable adaptations and will decrease variation.