measures, analyzes, and reports financial and nonfinancial information that helps managers make decisions to fulfill the goals of an organization. It focuses on internal reporting and is not restricted by generally accepted accounting principles (GAAP).
Other:
a) emphasizes the future (not the past)
b) influences the behavior of managers and other employees (rather than primarily reporting economic events).
*can include assets or liabilities (such as "brand names" developed internally) not recognized under GAAP
*can use asset or liability measurement rules (such as present values or resale prices) not permitted under GAAP.
*not restricted under GAAP principles.
*allows managers to charge interest on owners' capital to help judge a division's performance, even though such a charge is not allowed under GAAP

Answers

Answer 1

Management accounting collects, evaluates, and disseminates financial and nonfinancial data to assist managers in reaching organisational objectives. It is not constrained by generally accepted accounting rules and focuses on internal reporting (GAAP).

What is Management Accounting?

Managerial accounting, sometimes known as management accounting, is a type of accounting that generates statements, reports, and other documentation to aid management in making decisions about the performance of their company. Internal uses are where managerial accounting is most frequently employed.

The major goal of managerial accounting is to support a company's management in effectively carrying out its planning, organising, directing, and controlling duties. The following ways management accounting supports these activities:

Profit maximisation and loss minimization are the primary goals of managerial accounting. It is focused with the display of data to foresee financial discrepancies that assist managers in making crucial decisions. Its scope is very broad and encompasses many business activities. The items below go through what management accounting can do to improve.

To learn more on Management accounting from the link:

https://brainly.com/question/21597572

#SPJ4


Related Questions

assets in your net worth are listed at their fair market value. the fair market value is the price you:

Answers

If both the buyer and the seller were allowed a reasonable amount of time to complete the transaction, the product would sell for its fair market value (FMV) on the open market.

A completed transaction is an agreement between a buyer and a seller to trade goods, services, or financial assets in exchange for cash. These are some instances of transactions: to compensate a supplier for products or services received. acquiring ownership of a property that was once the seller's property by paying the seller with cash and a note. compensating a worker for their time. Money transfers into or out of your bank account are referred to as bank transactions. A few examples of bank transactions are cash withdrawals or deposits, cheques, internet payments, debit card charges, wire transfers, and loan payments.

Learn more about transaction here

https://brainly.com/question/1016861

#SPJ4

Which of these is not a man of the common task related sources a project conflict a priorities be schedule C personalities the technical approach

Answers

Personalities is not among the common task-related sources of project conflict.

What is project conflict?

Project conflicts can come in many different shapes and sizes. Project conflict can take many different forms, including disputes inside the team over a creative vision, discussions with senior management about deadlines and expectations, and even fights with outside vendors. Differences in values, attitudes, needs, expectations, perceptions, resources, and personalities can lead to conflict in team projects. Project conflict can take many different forms, including disputes inside the team over a creative vision, discussions with senior management about deadlines and expectations, and even fights with outside vendors.

To learn more about project conflict click,

https://brainly.com/question/28047749

#SPJ1

FILL IN THE BLANK The measure of how much profit the firm generates as well as how much profit certain aspects of the firm, including regions, channels, and customer segments contribute is referred to as _______.

Answers

The measure of how much profit the firm generates as well as how much profit-specific aspects of the firm, including regions, channels, and customer segments contribute is referred to as profitability analysis.

When a company is incepted, one of its sole objectives of it is to earn profits. Basically, earning better than you expend is what every business owner wishes for his company. Thus, to evaluate the growth of a business, a detailed analysis of profit is crucial. Analyzing the profits which are fundamentally the money remaining from the capital after deducting all of the overhead costs, will help you maintain a track of your business arrangement. Profitability analysis permits companies to maximize their earnings.

To learn more about profitability analysis visit here:

https://brainly.com/question/30091912

#SPJ4

Which of the following teaching strategies is most likely to increase students' sense of autonomy?

Answers

Ms. Brown asks her third graders to develop some class rules to ensure that all class members will have a chance to express their ideas openly. This teaching strategies is most likely to increase students' sense of autonomy.

What is sense of autonomy?

Autonomy, in its most basic form, refers to a person's capacity to pursue their own goals and interests. The word is derived from the ancient Greek and meaning "self-legislation" or "self-governance." The need of promoting and upholding individual autonomy is frequently emphasised in contemporary political theory and bioethics. However, it can be challenging to define precisely what autonomy implies and why it matters.

At all ages, feeling independent is a major motivator of reward or danger. According to Steve Maier of the University of Colorado at Boulder, whether or not a stressor affects an organism's ability to operate depends on the level of control that organisms have over it. According to his research, only unmanageable stress has negative impacts. Uncontrolled tension can have negative effects.

To study more about sense of autonomy

https://brainly.com/question/18090413

#SPJ4

Which of the following marketing orientations calls for aggressive promotional efforts and focuses on creating transactions rather than long-term customer relationships?
A) the marketing concept
B) the production concept
C) the product concept
D) the selling concept
E) the societal marketing concept

Answers

The selling concept necessitates aggressive promotional efforts and prioritizes transactional rather than long-term customer relationships.

The selling concept is based on the premise that customers will not buy your brand's goods/services unless you engage in large-scale sales and promotional activities. As a result, businesses and companies should engage in promotional and marketing activities to help their product gain traction in the market. Customers have inner needs, and it is your job to convert those needs into purchases of your product through motivation and persuasion. The selling concept is extremely useful for selling unwanted goods, such as insurance. Where you first identify your target market segment and then persuade them by explaining the benefits of the product. The ultimate goal is to sell a large number of products in order to increase net profit.

To learn more about selling concept:

https://brainly.com/question/17366707

#SPJ4

With _____, the firm first divides the marketplace into subgroups, determines which of those subgroups it should pursue, and finally decides how it should best position its product or service.
A. SWOT
B. The marketing mix
C. STP
D. The Four P's

Answers

Option C. STP. Segmentation, targeting, and positioning is a method that marketing managers use to find and assess various prospects. These offer businesses the chance to discover more about their clients.

The company first divides the market into subgroups or segments, chooses which of those segments it should pursue or target, and then chooses how to position its goods and services to best suit the demands of those selected targets.

separating the market into categories combating the harmful effects of the environment outside positioning its goods and services to be in line with the demands of the targeted market Choosing the subgroups that should be pursued 1. Segmenting the market into smaller segments 2. Selecting the appropriate subgroups to explore.

Following this procedure, it's likely that all links without redundant links will be in the forwarding state. Links that were redundant but less effective than the links that were chosen will be blocked. Spanning Tree never makes more than one link to the same place. With Spanning Tree, there is no load-sharing feature.

To learn more about marketing managers please click on below link

https://brainly.com/question/30265019

#SPJ4

Consider the following supply and demand curves for a certain product.
QS = 25,000P
QD = 50,000 - 10,000P
a. Plot the demand and supply curves.
b. What are the equilibrium price and equilibrium quantity for the industry? Determine
the answer both algebraically and graphically. (Round to the nearest cent.)

Answers

The demand and supply curves can be plotted as follows:

Demand Curve:

PQD = 50,000 - 10,000P

Supply Curve:

QS = 25,000P

Algebraically, the equilibrium price and quantity can be determined by setting the demand and supply equations equal to one another and solving for P and Q. We get:

50,000 - 10,000P = 25,000P

25,000P = 50,000

P* = $2.00

Q* = 25,000/2.00 = 12,500

Graphically, the equilibrium price and quantity can be determined by finding the intersection of the demand and supply curves. At the point of intersection, the price is $2.00 and the quantity is 12,500. The equilibrium price and quantity can be determined by making the demand and supply equations equal to each other and solving for P and Q, or by finding the intersection of the demand and supply curves.

In this case, the equilibrium price is $2.00 and the equilibrium quantity is 12,500. This means that the market is in equilibrium when the price of the product is $2.00 and the quantity of the product is 12,500. This equilibrium price and quantity represent the most efficient and socially optimal combination of price and quantity in the market.

To know more about equilibrium click here

https://brainly.com/question/28527601

#SPJ4

Selling inventory for cash results in which of the following? Assume inventory is sold for more than it cost to produce.

Answers

Cost of goods sold is the term used to describe the direct expenses incurred by a company in manufacturing the commodities it sells (COGS). This total also includes the price of the materials and labour that were used directly to create the good.

The selling price or cost is used to value inventory.

Inventory costs, not selling prices, are recorded. The price paid to a supplier for the goods plus any additional expenses incurred in getting the goods to the retailer make up the inventory cost of a store.

The cost concept Mcq is which of the following?

According to the cost principle, all assets must have their acquisition values recorded in the books of .This relates to the expense incurred.

To know more about costs visit:-

https://brainly.com/question/30045916

#SPJ4

the amount by which an additional unit of a good or service changes a consumer's total satisfaction, all other things unchanged, is utility. the amount by which an additional unit of a good or service changes a consumer's total satisfaction, all other things unchanged, is utility. expected maximum average marginal

Answers

The amount by which an additional unit of a good or service changes a consumer's total satisfaction, all other things unchanged, is utility. expected maximum average marginal utility.

The pleasure a consumer has from owning one additional unit of an item or service is known as marginal utility. The idea of marginal utility is used by economists to forecast how much of a good consumers would purchase.

When the consumption of an additional item raises total utility, this is known as positive marginal utility. On the other side, negative marginal utility happens when one extra unit is consumed and the overall utility falls.

The concept of marginal utility is used by economists to examine how customer satisfaction levels impact purchasing decisions. The theory of diminishing marginal utility is another one that economists are aware of. It demonstrates how the first unit of consumption of a good or service is more useful than subsequent ones.

Learn more about marginal utility:

https://brainly.com/question/13194829

#SPJ4

this refers to the irregularly occurring pattern of economic activity, which is generally depicted as an undulating wave of expansions and contractions.

Answers

The term "business cycle," sometimes known as "the economic cycle," refers to the unpredictably occurring  undulating wave of expansions, peaks, contractions, and troughs.

What exactly is an economic cycle?

The economic cycle is the shifting status of an economy as a result of expansionary and deflationary phases. It is often calculated using a country's or region's Gross Domestic Product (GDP).

What sets the business cycle and economic growth apart?

Random variations, seasonal changes, shifts in the business cycle, and enduring structural factors can all contribute to economic growth. The latter two may be impacted by policy. The term "business cycle" refers to the predictable cyclical pattern of economic booms and contractions (recessions)

To know more about Business Cycle visit:

https://brainly.com/question/20335740

#SPJ4

based on your understanding of the factors that affect the cost of money, identify which of the following statements is true:interest is the price paid to borrow funds.higher inflation leads to lower interest rate

Answers

based on your understanding of the factors that affect the cost of money, Both the statements are true.

1. Interest is the price paid to borrow funds. When an individual or organization borrows money, they are required to pay back the principal amount plus an additional amount, known as interest. This interest is the cost of borrowing money and is typically expressed as a percentage of the principal amount.

2. Higher inflation leads to lower interest rates. In general, when inflation is high, the value of money decreases, and it becomes less expensive for borrowers to repay loans. As a result, lenders will often lower interest rates to attract borrowers and maintain a steady level of demand for loans.

The cost of money alludes to the cost paid for utilizing the cash, whether acquired or possessed. Each amount of cash utilized by organizations bears cost. The premium paid on obligation capital and the profits paid on possession capital are instances of the expense of cash.

Know more about Cost of Money - https://brainly.com/question/9583229

#SPJ4

when a country has a comparative advantage in the production of a good, it means that it can produce this good at a lower opportunity cost than its trading partner. then the country will specialize in the production of this good and trade it for other goods. the following graphs show the production possibilities frontiers (ppfs) for yosemite and denali. both countries produce almonds and pistachios, each initially (i.e., before specialization and trade) producing 24 million pounds of almonds and 12 million pounds of pistachios, as indicated by the grey stars marked with the letter a.

Answers

Yosemite has a comparative advantage in the production of almonds, while Denali has a comparative advantage in the production of pistachios.

What is comparative advantage? Comparative advantage is an economic concept which states that a country, or a business, is more efficient and better at producing a certain type of good or service than another. It is based on the idea that each country or business has different resources and capabilities, which give them an edge in certain areas of production. For example, a country may have more access to natural resources than another, making it more efficient in producing certain goods. Similarly, a business may have more experience and knowledge in a certain industry, making it better at producing products or services than its competitors. Comparative advantage is an important concept for businesses and countries when it comes to international trade, as it helps them to identify the areas where they are most productive and can benefit from trading with other countries.

To learn more about comparative advantage refer to:

https://brainly.com/question/12291750

#SPJ4

there are four stages of branding. when a manufacturer can calculate the value of a consumer's loyalty over their lifetime is called: group of answer choices brand preference brand equity brand awarenessbrand lyalty

Answers

You can see that my stages are: customer perception/image, market performance, financial value, and marketing engagement.

What is meant by financial value?Value in the context of business markets refers to the monetary value of the technological, economic, service, and social advantages that a customer company obtains in exchange for the cost of a market offering. Market value is the price or sum that a buyer is prepared to pay on the market, and it is determined by supply and demand. The advantage that a good or service provides to a person or business is measured in terms of its economic value.Profit per share, or profit divided by the total number of outstanding equity shares, can be used to determine a company's value. Valuation refers to the process of determining and putting a price on a business or asset.

To learn more about financial value, refer to:

https://brainly.com/question/29657673

#SPJ4

Identify the bank reconciliation items that would require adjustments to the book balance.
a. Collection of note by bank
b. Interest earned
c. Outstanding checks
d. Bank charges
e. NSF check
f. Deposits in transit

Answers

The bank reconciliation items that would require adjustments to the book balance are:

a. Collection of note by bank

b. Interest earned

d. Bank charges

e. NSF check

In economic and business, A bank reconciliation statement generally can be defined as a summary of banking and business activity that reconciles an entity's bank account with its financial records. The bank reconciliation statement outlines the activities that affecting a bank account for a specific period such as deposits, withdrawals, and others. There are several steps of bank reconciliation statement process, there are Compare the deposits, Adjust the bank statements, Adjust the cash account, and also Compare the balances.

Here you can learn more about bank reconciliation https://brainly.com/question/29097188

#SPJ4

The balances of the accounts reported on the balance sheet are carried forward from year to year. Example:

Answers

The balances of the balance sheet accounts are carried forward from year to year. Permanent accounts include cash, accounts receivable, equipment, accumulated depreciation, accounts payable, common stock, and retained earnings.

Why are balance sheet account balances carried over to the following accounting period?

Balance sheet account balances are carried forward into the next fiscal year. This guarantees that the balance sheet accounts' closing balances in the fiscal year being carried over are the same as the opening balances in the following fiscal year.

The account balance display shows the sum to be carried forward. To carry forward balances, you can use one application for general ledger accounts and another for client and vendor accounts.

Learn more about accumulated depreciation

https://brainly.com/question/15610334

#SPJ4

A portfolio contains two securities and has a beta of 1.08. The first security comprises 54 percent of the portfolio and has a beta of 1.27. What is the beta of the second security?
A) .79
B) .86
C) .62
D) .82
E) .93

Answers

A portfolio contains two securities and has a beta of 1.08. The first security comprises 54 percent of the portfolio and has a beta of 1.27.  the beta of the second security is  82.

To calculate the beta of the second security, we first need to calculate the combined beta of the two securities. The beta of a portfolio is the weighted average of the beta of its components. In this case, the first security comprises 54 percent of the portfolio, so we can calculate the combined beta as follows: Beta of the portfolio = 1.27 * 0.54 + Beta of the second security * 0.46 = 1.08.

The beta of the second security can then be calculated by subtracting the first security's beta from the portfolio beta: Beta of the second security = 1.08 - (1.27 * 0.54) = 0.82Therefore, the beta of the second security is 0.82.

To know more about the portfolio refer  to the  link  brainly.com/question/17165367

#SPJ4

lei lei is running an orientation session for the new hires at the hospital where she works in human resources (hr). she spends time walking them through the private network

Answers

At the hospital wherein she works in human resources, lei lei is leading an orientation session for new hires (hr). She takes her time guiding them through the "staff orientation" portion of the private network.

Explain the term of human resources management?

The term "human resource management" refers to a deliberate approach to fostering employee growth and development as well as a productive workplace.

There are three main responsibilities that an HR manager might play:

Administrator

Processing payroll, writing job descriptions, establishing workplace policies, and purchasing benefits are all frequent activities in HR administration.

Manager of change

To promote compliance, HR professionals must keep an eye on laws and notify staff of any changes to policies or procedures.

Manager of personnel

Conflict resolution, overseeing learning and development, and encouraging employee involvement are all part of managing people.

When at the hospital wherein she works in human resources, lei lei is leading an orientation session for new hires (hr).

Thus, she takes her time guiding them through the "staff orientation" portion of the private network.

To know more about the human resources management, here

https://brainly.com/question/17070987

#SPJ4

there are 10 employees in a particular division of a company. their salaries have a mean of $70,000, a median of $55,000, and a standard de?viation of $60,000. the largest number on the list is $ 100,000. by accident, this number is changed to $ 1,000,000.

Answers

The mean salary would increase to $860,000, the median salary would increase to $555,000, and the standard deviation would increase to $600,000.

What is standard deviation? Standard deviation is a measure of the spread or variability of a set of data from the mean or average value. It is calculated by taking the square root of the variance, which is the average of the squared differences from the mean. Standard deviation is a useful statistic for measuring the degree of variation or dispersion of data around the mean. It is also commonly used to measure the risk associated with an investment or a portfolio of investments, as it can help to measure the volatility of the returns over a given period of time. Standard deviation can also be used to compare the variability of two different sets of data. It is important to note that standard deviation is not the same as variance, as standard deviation is the square root of the variance.

Without the $100,000 salary, the mean salary was $60,000 ($70,000 - $10,000). With the $1,000,000 salary, the new mean salary is $860,000 ($60,000 + $800,000).

The median salary was $55,000 before the change, and with the $1,000,000 salary, the new median salary is $555,000.

The standard deviation was $60,000 before the change, and with the $1,000,000 salary, the new standard deviation is $600,000.

To learn more about standard deviation refer to:

https://brainly.com/question/24582542

#SPJ4

this graph shows merchandise export data for the years 2010 through 2012. a graph titled total merchandise exports from 2010 to 2012 has year on the x-axis and exports in trillions of u s dollars on the y-axis, from 0 to 2.5 in increments of 0.5. a line representing united notes exports is slightly lower than a line representing china exports. which statement most accurately describes the information presented on the graph?

Answers

Between 2010 and 2012, China outexported the US in terms of exports.

What is mean by Exports?

Items and services that are produced in one nation and bought by citizens of another nation are known as exports.Exports are goods or services that are created or assembled in one nation and distributed outside.A country's economy is aided by exports. They are significant in foreign and diplomatic policies as a trading element.The export of commodities and services by nations is based on their comparative or competitive advantage.Governments support exports because they boost tax revenues, employment opportunities, foreign exchange reserves, and liquidity.An element of global trade is exports. They are the products and services that locals in a country purchase yet are manufactured outside.

To learn more about Exports refer to:

https://brainly.com/question/26428996

#SPJ4

An investment adviser representative lives in State W and works for a federal covered adviser that is headquartered in State W. The investment adviser also has customers in States X, Y and Z. The investment adviser representative has customers in States W, X and Y, but not in State Z. The investment adviser representative is required to register in:
A. None of the States because the adviser is federal covered
B. State W only
C. States W, X, and Y only
D. States W, X, Y and Z

Answers

The investment adviser representative is required to register in States W, X, and Y only, i.e. Option C is correct

Investment adviser are authorized experts who are burdened with the obligation of giving monetary direction or master guidance around speculations, charge arranging and so on for clients in a monetary foundation.

A delegate of a Government Covered consultant is simply expected to enlist with the state in which the person is working.

Be that as it may, for the venture guide, they're normal or legally necessary to enlist with the Securities and Exchange Commission (SEC) since they're having no office in the state.

Thus, No, enlistment doesn't imply that the Speculation Consultant is able to give venture exhortation to clients as indicated by the Uniform Protections Act.

The Uniform Securities Act ( USA ) is a model resolution or legitimate structure intended to direct each condition of the US of America in drafting and adjusting both state and government administrative protections regulation. It is utilized in the US of America to arraign all extortion connecting with trading of protections.

Know more about Investment Advisers - https://brainly.com/question/20631044

#SPJ4

public-key encryption is based on a . question 6 options: message authentication code (mac) certificate hash value key

Answers

Public-key encryption which is also known as public key cryptography is based on a key.

A set of keys known as a public key and a private key (a public key pair) are connected with an entity that needs to technologically authenticate its identity or sign or encode data. Only the appropriate private key may decode data encrypted with the public key. Public key RSA pairs can be of any length.The usual sizes today are 1024 and 2048 bits. Anyone with a public key may encrypt a message, resulting in a ciphertext, but only those who have the corresponding private key can decipher the ciphertext to recover the original statement.  Public Crucial algorithms are  elementary security savages in ultramodern cryptosystems, including  operations and protocols which offer assurance of the confidentiality, authenticity and non-repudiability of electronic dispatches and data  storehouse.

Learn more about encryption here:

https://brainly.com/question/17017885

#SPJ4

______requiring companies to actually demonstrate the ability to refinance on a long-term basis in addition to merely intending to do so avoids intentional or unintentional of current liabilities.

Answers

It prevents intentional or unintentional current liabilities by requiring enterprises to really show their ability to refinance on a long-term basis in addition to just wanting to do so.

What is refinance?Refinancing is the process of replacing an existing debt obligation with a new one that has a different duration and interest rate. When you refinance your home loan, you essentially exchange your old mortgage for a new one with a new principal and a new interest rate. The older mortgage is then paid off by your lender using the proceeds from the newer one, leaving you with just one loan and a single monthly payment.When the conditions of an existing loan, such as the interest rate, the payment schedule, or other conditions, are changed, this is known as a refinance. When borrowing rates decrease, borrowers frequently refinance. Refinancing entails reassessing a person's or company's credit and repayment status.

To learn more about refinance refer to:

https://brainly.com/question/18329422

#SPJ4

Which of the following demographic descriptors is used at the microsegmentation the process of segmentation of industrial markets?
A)Age of the firm
B)Size of the firm
C)Industry affiliation
D)Sex of the decider

Answers

The age of the business is a demographic description used in the process of segmenting industrial markets known as micro-segmentation.

How Should Industrial Markets be Segmented?

Industrial marketers are not alone in believing that segmentation is a challenging task for them. Not only has there been little published on the issue as it pertains to industrial markets, but such analysis is also more sophisticated than that of consumer markets. The challenge is determining the optimal factors for segmenting industrial markets.

While segmenting consumer markets is challenging, it is considerably simpler and easier than segmenting industrial markets. Several distinct industrial items can be employed in the same application; similarly, the same industrial product can have several uses.

To learn more about  industrial markets, click

https://brainly.com/question/17052464

#SPJ4

Which of the following demographic trends has significant implications to global marketers?

Answers

c) The large and growing markets in India and China is a demographic trend that has significant implications to global marketers.

The large and growing markets in India and China are a demographic trend that has significant implications for global marketers because of the sheer size of these markets and the potential for growth in consumer spending.

The population in India and China is increasing, and the average age of the population is also decreasing, meaning that there is a larger population of young consumers who are more likely to be interested in purchasing goods and services.

Additionally, the economic growth in these countries means that there is more disposable income available for consumers to spend on non-essential goods and services. This presents a huge opportunity for global marketers to tap into these markets and reach a large and growing consumer base.

For more questions like Demographic trend click the link below:

https://brainly.com/question/28900407

#SPJ4

Complete question:

Which of these is a demographic trends that has significant implications to global marketers?

Multiple Choice

A.the lack of savings of elderly populations in developed countries

B.the tripling of the population of consumers under 40 years old

C.the large and growing markets in India and China

D.the declining populations in Latin American countries

E.the decreasing interest in entrepreneurship in developing countries

The assets of a corporation that has liabilities of $250,000, common stock of $125,000, and retained earnings of $85,000.

Answers

The Current assets of the corporation would be $460,000

What is the difference between current assets and non-current assets?

Current assets are assets that are expected to be converted into cash or used up within one year or less, such as cash, accounts receivable, and inventory.

Non-current assets, on the other hand, are assets that are expected to be used for more than one year, such as property, plant, and equipment.

The main difference between these two types of assets is their liquidity, with current assets being more liquid and non-current assets being less liquid.

We know that Assets = Liabilities + common stocks + retained earning

Assets = $250,000 (liabilities) + $125,000 (common stock) + $85,000 (retained earnings) = $460,000

To learn more about the Current assets from the given link

https://brainly.com/question/11556132

#SPJ4

Alkaline Batteries- How much does EMD (Electrolyic Maganese Dioxide) cost? And what is a decision a manager might make to save cost of materials.

Answers

The cost of EMD (Electrolyic Maganese Dioxide) cost is said to range around $1,000 to $1,500 per metric ton.

The decisions the manager can make to save cost of materials include:

Negotiating prices Exploring alternatives Reducing waste in manufacturing

How to save on cost ?

The cost of  EMD (Electrolyic Maganese Dioxide) can be affected by factors such as the price of raw materials, production costs, and demand for the product. It's hard to give an exact cost, but an estimate of the cost of EMD is around $1,000 to $1,500 per metric ton.

A manager can save on cost of materials by negotiating better prices with suppliers by increasing the volume of purchases or entering into long-term contracts. Exploring alternative sources of EMD, such as importing from other countries or using recycled materials. Reducing waste in the manufacturing process to save on raw materials.

Find out more on saving cost at https://brainly.com/question/14182846

#SPJ1

on july 1, davis corporation receives $10,000 for rent in advance from a tenant. which of the following are correct for davis to record? (select all that apply.) multiple select question. debit cash $10,000 debit prepaid rent $10,000 credit cash $10,000 credit deferred rent revenue $10,000

Answers

The correct response is Davis debits prepaid rent $10,000, Davis credits cash $10,000.

In double-entry accounting, debits and credits are entries made in account ledgers to indicate changes in value brought on by business transactions. Account debit transactions show money entering them, and credit entries show money leaving them. With each transaction, money is moved from credited to debited accounts. A tenant writing a check for rent to a landlord would, for instance, record a credit for the bank account on which the check is written and a debit for the rent cost account. The landlord would similarly put a credit in the tenant's rent income account and a debit in the bank account where the check is placed.

Learn more about debits here

https://brainly.com/question/14264057

#SPJ4

On july 1, Davis corporation receives $10,000 for rent in advance from a tenant.

during the 21st century, the complexity of the challenges posed by disruptive, digital technologies and accelerating rates of change has encouraged companies to:

Answers

In the twenty-first century, businesses have become more dependent on strategic partnerships and other types of collaboration due to the complexity of the issues posed by disruptive, digital technologies and accelerated rates of change.

A strategic alliance is a contract signed between two companies to collaborate on a task that will be advantageous to both while preserving each company's autonomy. The agreement is simpler and more enforceable than a joint venture, which entails two businesses combining their resources to create a new corporate organization. A company could create a strategic alliance to boost its market share, expand its line of products, or outperform competitors. The contract made between two allows two ventures to work together on a project that will benefit both of them. There may be a long-term or short-term link.

For more such questions technologies refer to:

https://brainly.com/question/29446274

#SPJ4

Due to the complexity of the issues posed by disruptive, digital technologies and the accelerated rates of change, businesses have become more dependent on strategic partnerships and other forms of collaboration.

A strategic alliance is an agreement between two companies to collaborate on a task that will be advantageous to both while preserving each company's autonomy. The agreement is simpler and more enforceable than a joint venture, which entails two businesses combining their resources to create a new business organization. A company might create a strategic alliance to boost its market share, expand its line of products, or outperform competitors. The agreement allows two companies to work together on a project that will benefit both of them. There may be a long-term or short-term connection.

For more such Technology refers to:

brainly.com/question/29446274

#SPJ4

suppose a us medical board is using marginal analysis to determine the optimal screening frequency for a specific disease. below is the approximate number of early cases detected as you expand testing to a broarder population. suppose further that each early detection case is considered to have a benefit of $50,000 and the cost of screening one person is $20,000. number of people screened in a given a year total number of early detection cases 1,000 500 2,000 1000 3,000 1400 4,000 1700 5,000 1900 the marginal benefit to screening 2 thousand people is , and 3 thousand people is . suppose a us medical board is using marginal analysis to determine the optimal screening frequency for a specific disease. below is the approximate number of early cases detected as you expand testing to a broarder population. suppose further that each early detection case is considered to have a benefit of $50,000 and the cost of screening one person is $20,000. number of people screened in a given a year total number of early detection cases 1,000 500 2,000 1000 3,000 1400 4,000 1700 5,000 1900 the marginal benefit to screening 2 thousand people is , and 3 thousand people is . 400 cases ($20,000,000); 500 early detection cases ($25,000,000) 500 early detection cases ($25,000,000); 400 cases ($20,000,000) 1000 early detection cases ($50,000,000); 1400 ($70,000,000) early cases 1400 ($70,000,000) early cases; 1000 early detection cases ($50,000,000)

Answers

The average total cost formula is created by dividing the total cost of production by the total amount paid in money.

What is the total cost formula?The average total cost formula is created by dividing the total cost of production by the total amount paid in money. The total-cost formula is a simple and user-friendly process that works by dividing the total production cost by the quantity of goods produced.Cost reports: As part of cost accounting, managers at various levels can access periodic cost reports such as weekly and monthly reports. These reports serve as the foundation for managerial decision-making, performance evaluation, and planning and control.The complete direct costs of manufacturing, including labour and raw materials, are referred to as prime costs. Utility costs, management pay, and delivery expenses are examples of indirect costs that are excluded from prime costs.

To learn more about total cost  refer to:

https://brainly.com/question/25109150

#SPJ4

Given the following information, what is Net Income on a FIFO basis?The LIFO provision is $100, The LIFO Gross Profit is $2,000, The LIFO EBIT is $1,500, The LIFO Earnings Before Tax is $1000, The LIFO Tax Expense is $250 and LIFO Net Income is $750.a. $1,600b. $850c. $750d. $825

Answers

c) The LIFO, method to calculate the cost of goods, Net Income is $750.

The LIFO (Last In First Out) method is used to calculate the cost of goods sold and inventory value by assuming that the most recent goods purchased are sold first.

In this case, given the information provided, the LIFO Net Income is $750. This is the final amount of income after all expenses and taxes have been taken into account.

The LIFO Gross Profit is $2,000, which represents the total revenue minus the cost of goods sold. The LIFO EBIT is $1,500, which is the Earnings Before Interest and Taxes.

The LIFO Earnings Before Tax is $1000, which is the total revenue minus the expenses. The LIFO Tax Expense is $250, which is the amount of taxes that have to be paid on the earnings before tax.

For more questions like LIFO click the link below:

https://brainly.com/question/16749750

#SPJ4

Other Questions
(c16p12) suppose that the attraction between the moon and the earth were due to coulomb forces rather than gravitational force. what would be the magnitude of the charge required if equal but opposite charges resided on both earth and moon? mass of earth Quadrilateral EFGH is a rectangle. If mFEG=57 , find mGEH . Early in its history, psychology was divided into two branches, each with a distinct focus. What were those two branches?1. ethical and unethical2. clinical and historical3. clinical and scientific4. behavioral and scientific what are some fictional diseases like the hanahaki disease? A member of one species (the predator) feeds directly on all or part of a living organism (the prey) as part of the food web. Randomly selecting 20 cards out of 52 card deck, the probability of each outcome will be basically the same whether it is done with or without replacement 1TRUE OR FALSE? 1. 50cm of 0.5 mol/dm NaOH solution and 50cm of 0.5mol/dm HNO3 were mixed at 20c and stirred in a calorimeter with negligible heat capacity. The temperature of the mixture rose to 23.2c.the density of each solution is 1.0g/cm and the specific heat capacity of each solution is 4.18J/K/g.calculatei.the enthalpy for the neutralizationii.calculate the change in enthalpy per mole of water formed last year small manufacturing company netted $540,000 the net profit increased this year by 135% what is the net profit of the company this year Becky had net sales (all on account) in 2017 of $820000. At December 31, 2017, before adjusting entries, the balances in selected accounts were: accounts receivable $1000000 debit, and allowance for doubtful accounts $2120 debit. Becky estimates that 2% of its accounts receivable will prove to be uncollectible. What is the net realizable value of the receivables reported on the financial statements at December 31, 2017 there are 10 employees in a particular division of a company. their salaries have a mean of $70,000, a median of $55,000, and a standard de?viation of $60,000. the largest number on the list is $ 100,000. by accident, this number is changed to $ 1,000,000. which nims structure develops recommends and executes public information Using y = 6 - 2x, plot the ordered pairs from the table. Then graph the function represented by the ordered pairs and tell whether the function is linear or nonlinear. Part 1 out of 3 Complete the table. Input, x Output, y Check -1 3 Next a client who is taking an oral hypoglycemic daily for type 2 diabetes develops an infection with anorexia. which advice will the nurse provide to the client? a solution is prepared at that is initially in dimethylamine , a weak base with , and in dimethylammonium bromide . calculate the ph of the solution. round your answer to decimal places. find the area of region s . find the volume of the solid generated when region s is revolved about the horizontal line y How were the civillzation of huang river valley and the nile river valley similar using defined inputs to ensure that an algorithm or program is producing the expected outcomes, in the development process. Someone Help me Please. Your friendfinds the sum. Is your friend correct?Explain your reasoning.-3.7 + (-0.25) = | 3.7 | + | 0.25 | = 3.7 + 0.25 = 3.95 ntsam ProctorQuestion 2Animals have albinism if they are unable to produce the molecule melanin. The protein responsiblefor making melanin is tyrosinase.If this is the normal sequence for a section of the mRNA transcript for tyrosinase:GCUGAUAGUCCUAnd a rat has this version of the sequence:GUGAUAGUCCUIs this rat likely to have albinism? How do you know?Second letterFirst letterUAUUC.UUG}LeuCUUCUCCUACUGUCUPheUCCLeuAUUAUC lleAUAUCAUCGCCUCCCCCACCGACUACCACAAUG Met ACGGUUGCUProUACJSerThrAUAU Tyr UGC CysUAA Stop UGA StopUAG Stop UGG TrpGCAUTCACJCGUHisCGCCAGGIn CGGAAUAsnArgAGC SerAAGLYS AGG ArgGAUR GGUUCAGDUA DUA D10 ptsThird letter