Match each example given to the type of scientific concept.

theory
observation
hypothesis
law
The outer layer of the Earth is
divided into plates that move
due to convection currents
under the surface.
arrowBoth
If the amount of daylight
increases plant growth, then
plants will have higher rates
of growth during the summer.
arrowBoth
For every action or force
in nature, there is an equal
and opposite reaction.
arrowBoth

Answer:

The answer is the one that is not on this list

List of criteria for a living organism:

1.) Can Reproduce

2.) Goes through homeostasis

3.) Needs Energy

4.) Is organized/ has cells

5.) Grows and Develops

6.) Responds to stimuli.

Explanation:

Answer:

B.Phenotype

Explanation:

The term "phenotype" refers to the observable physical properties of an organism; these include the organism's appearance, development, and behavior. An organism's phenotype is determined by its genotype, which is the set of genes the organism carries, as well as by environmental influences upon these genes.

Answer:

A section of the spacecraft is slowly rotated in order to simulate the force of gravity.

Explanation:

The rotational force of the spacecraft makes an artificial sort of gravity, which can be altered by changing the speed of the spinning or by moving the rotating part further/closer to the center point of rotation.

Answer:

2 2/9

Explanation:

5 x 4/9

20/9

divide 20 by 9

= 2 2/9

Answer:

2[tex]\frac{2}{9}[/tex] is the answer

Explanation:

hope this helps

Answer:

46 chromosomes

Explanation:

46 chromosomes should be in each of these diploid cells after mitosis.

Answer:

A 25% (one in four) chance of having a son with hemophilia. A 25% chance of having a son with normal blood clotting. A 25% chance of having a daughter who is a carrier. A 25% chance of having a daughter who has hemophilia.

Explanation:

In the extremely rare event that both the mother and the father have the affected X chromosomes then there is a 50% chance that their sons will be born with hemophilia. There will be a 50% chance their daughters will be carriers and a 50% chance they will also have the condition.

Answer:

prophase I

Explanation:

This is important because it increases genetic variation.

hope this helps

pls mark brainliest

60%

Water makes up up to 60% of the adult human body. Water makes up 64 percent of the skin, 79 percent of the muscles and kidneys, and even 31 percent of the bones.

I hope this helps you

:)

Answer:They contain hemoglobin.

Explanation:

Explanation:

Adenosine triphosphate energy

Answer:

In photosynthesis, light energy is converted to chemical energy.

Answer:

ABO blood type B

Explanation:

The blood sample only contains B as a surface antigen (simplified as the sugars clinging to the blood embedded halfway inside) making any other blood type unviable. B would be the only option.

Answer:

Axons should be your answer.

Explanation:

The individual thin fibers in which neurons send signals to other cells are axons. When individual fibers are bundled together, it is called nerve fiber.

Answer:

I think it results in an imbalance of gene products from affected chromosomes, which alters normal development

Explanation:

Why: Why is aneuploidy in animals generally detrimental?

Explanation and Answer: Well it does result in an imbalance of gene products from affected chromosomes, which modify normal development. It results in DNA replication mistakes due to the aberrant number of chromosomes.

                           I expect this to help you!

                        Have a wonderful weekend!

Answer:

Photosynthesis is a process used by plants and other organisms to convert light energy into chemical energy that, through cellular respiration, can later be released to fuel the organism's activities. Some of this chemical energy is stored in carbohydrate molecules, such as sugars and starches, which are synthesized from carbon dioxide and water, In most cases, oxygen is also released as a waste product that stores three times more chemical energy than the carbohydrates. Most plants, algae, and cyanobacteria perform photosynthesis; such organisms are called photoautotrophs. Photosynthesis is largely responsible for producing and maintaining the oxygen content of the Earth's atmosphere, and supplies most of the energy necessary for life on Earth.

Explanation:

Answer:

25%

Explanation:

crossing two heterozygous plants would look like this Pp x Pp

making a chart

                      P     p

P              PP        Pp

p             Pp          pp

what this means is that the capital P isdminant so thats what will show is the dominant purple petal whereas lower case p is the ressecive white petal

this means 25% of offspring will be white :)

It is called central vascular catheterization

Catheterization is defined as the use of medical devices that can be inserted into the body and used for different medical purposes.

Vascular catheterization is a peripheral catheterization that is used to detect certain upper and lower peripheral extremity conditions.

There are different types of vascular catheterization which include:

Central vascular catheterization involves Introducing a vascular catheter directly into a vessel without further advancement past the punctured vessel.

Learn more about catheterization here:

https://brainly.com/question/3911876

When two protein chains combine to form an active protein, the structural level is quaternary.

The quaternary and tertiary structure of a protein is the tridimensional shape of the protein, which involves protein domains.

The quaternary protein structure refers to the different arrangements generated by different protein subunits.

The primary structure of a protein involves its amino acid sequence, whereas the second structure involves protein chains.

Learn more about quaternary structure here:

https://brainly.com/question/5286438

When two protein chains combine to form an active protein, the structural level is the quaternary arrangement.

Proteins may be defined as naturally emerging, extremely intricate substances that comprise amino acid residues joined by peptide bonds.

The Quaternary structure of a protein is very complex and 3-dimensional as compared to other protein structures which involve numerous motifs and domains.

Therefore, when two protein chains combine to form an active protein, the structural level is the quaternary arrangement.

To learn more about Protein structures, refer to the link:

https://brainly.com/question/14207491

#SPJ4

Answer:

How are animals similar? All animals are made of many cells. Most animals can move on their own. Like all living things, animals grow, change, reproduce, and respond to their environment.

Animals are made up of several cells. Most animals have independent movement. Animals develop, transform, reproduce, and react to their surroundings like all other living creatures do.

Any eukaryotic multicellular organism of the biological kingdom Animalia is referred to as an animal.

The majority of creatures in this kingdom lack a cell wall, are heterotrophic, motile, have specialised sensory organs, and originate from blastulae during embryonic development.

According to some, the fundamental distinctions between humans and other animal species are our capacity for complex reasoning, our use of complex language.

Also, the capacity for problem-solving, and the capacity for introspection (this means describing your own thoughts and feelings).

Multiple cells make up an animal. The majority of animals can move on their own. Like all other living things, animals grow, change, reproduce, and respond to their surroundings.

Thus, this way, many animals contrasts each other.

For more details regarding animals, visit:

https://brainly.com/question/12985710

#SPJ2

Answer:

photoreactivation repair

Explanation:

Photoreactivation utilizes the enzyme photolyase to break the bonds formed during pyrimidine dimerization. A thymine dimer produced by UV irradiation is bound by photolyase. Visible light energy is absorbed by photolyase and is redirected to break the bonds forming the dimer.

In addition to bacteria, this DNA repair mechanism is also found in single-celled eukaryotes, plants, and some animals such as Drosophila.

Answer:

I think is B because when you transfer a substance through energy the practicals increase

Answer:

A food chain represents the linear relationship between organisms for food. On the other hand, a food pyramid represents the optimal number of servings to be eaten each day from each of the basic food groups.

Food pyramid represents the total number of food to be eaten each day from each of the basic food groups .A food chain represents the linear relationship between organisms for food.

Food chain is a linear sequence of organisms through which nutrients and energy pass as one organism eats another.

Food pyramid is a depiction of the optimal number of servings to be eaten each day from each of the basic food groups.

To learn more about Food pyramid , here

https://brainly.com/question/17234521

#SPJ2

Answer:

Ocean acidification is already impacting many ocean species, especially organisms like oysters and corals that make hard shells and skeletons by combining calcium and carbonate from seawater.

Answer:

Homologous structures provide evidence for common ancestry, while analogous structures show that similar selective pressures can produce similar adaptations (beneficial features). Similarities and differences among biological molecules (e.g., in the DNA sequence of genes) can be used to determine species' relatedness.

Explanation:

The correct statement is C. They demonstrate how different species differ and which creature created the structure first. Anatomical characteristics observed in several species that have a common ancestor include what are known as homologous structures.

Although these structures may have diverse purposes in many creatures, their similarities suggest that they had an ancestor.

The anatomical characteristics of several creatures may be compared to find homologous structures and deduce evolutionary links.

Because diverse kinds of creatures have homologous features, it is likely that these qualities were passed down from a common ancestor.

Similarity levels and common anatomical patterns might shed light on a species' evolutionary path.

To know more about Anatomical characteristics:

https://brainly.com/question/32344097

#SPJ2

Answer:

The structural and functional units of the kidney are called nephron.

Fun Facts about Nephron:

Nephron is the structural and functional unit of the kidney.

Its primary purpose is to maintain the concentration of water and soluble chemicals such as sodium salts in the blood by filtering it, reabsorbing what is needed, and excreting the excess as urine.

The glomerulus and renal (kidney) tubule are the two primary structures in each nephron. Each human kidney contains around 1,000,000 nephrons.

The structural and functional units of the kidney are called the nephrons. Each human kidney contains 8-10 lakhs nephrons.

A Kidney may be defined as a pair of bean-shaped organs that eliminate waste and extra water from the blood and help keep chemicals balanced in the body.

Each nephron contains two structures i.e. Glomerulus and Tubules. The Glomerulus is a tough capillary through which a large amount of fluid is filtered from the blood.

Tubules are the other structure of the nephron in which the filtered fluid is converted into the urine.

Therefore, the structural and functional units of the kidney are called nephrons.

To learn more about Nephron, refer to the link:

https://brainly.com/question/832244

#SPJ4

These adjustments are in all likelihood genetic mutations evolution is the technique of alternating all existing paperwork from one era to the next and evolutionary biology research how this evolution takes place.

Hereditary mutations encompass cystic fibrosis, hemophilia, and sickle mobileular disease. Other mutations can occur on their very own at some stage in a person's existence. These are known as sporadic, spontaneous, or new mutations.

Thus it is well explained.

To learn more about evolution refer to the link :

https://brainly.com/question/1144962

Answer:

Explanation:

An organism has two different possible traits, A and B. A graph of the population is shown right. Which of the following statements is true about Trait B? Check all that apply.

It decreased in frequency over time.

It became extinct.

It is carried on a recessive allele.

There was a change in the environment between generations 10 and 30. The change likely

The most likely cause potential flooding in the area will be saturation of the ground with water.

This is defined as a situation in which an overflow of water submerges land that is usually dry.

When the ground is already saturated with water, a forested area receiving a lot of rain in a short amount of time will lead to flooding.

Read more about Flooding here https://brainly.com/question/12686086

Answer:

First, you must know what the stop codons are: UAA, UAG, and UGA

Whenever this sequence is read, it signals for an end in transcription and amino acids will stop being formed

Thus, 5′−GGCCCUUUUAGGGCCUUUUU−3′ contains a cue for transcription termination as it will stop after the codon "UAG"

Explanation:

Those mRNA sequences that consist of the stop codons like UAA, UGA, and UAG would form a structure that is a cue for transcription termination of some genes.

Transcription may be defined as the process by which the information in a strand of DNA is copied into a new molecule of messenger RNA (mRNA).

Stop codons are responsible for the termination of transcription of almost all the genes. They are necessary for inhibiting the excessive expression of some genes.

Therefore, those mRNA sequences that consist of the stop codons like UAA, UGA, and UAG would form a structure that is a cue for transcription termination of some genes.

To learn more about Transcription, refer to the link:

https://brainly.com/question/1048150

#SPJ4

Answer:

Explanation:

light reaction - chlorophyll absorbs light energy

dark reaction -  

factors - chlorophyll, carbon dioxide concentration, light intensity , temperature ,water