The fact that the rightmost bar labeled Total remains constant during the simple back-and-forth motion of a skater on a U-shaped track is a demonstration of the Law of Conservation of Energy.
What is the Law of Conservation of Energy?
According to the Law of Conservation of Energy law, energy can neither be created nor destroyed, but it can be transformed from one form to another.
In the case of the skater, the total energy of the system remains constant because the kinetic energy of the skater is converted to potential energy as he/she moves up the track, and the potential energy is then converted back to kinetic energy as he/she moves down the track.
Therefore, the total energy of the system (kinetic energy + potential energy) remains constant, and energy is conserved.
Learn more about the Law of Conservation of Energy at: https://brainly.com/question/166559
#SPJ1
In a P generation of true-breeding tall plants that are crossed with true-breeding short plants, 100% of the F1 generation are tall. What does this suggest about short and tall alleles
If in a P generation of true-breeding tall plants that are crossed with true-breeding short plants, 100% of the F1 generation are tall, then this suggest that short is recessive while tall is dominant.
What are recessive and dominant alleles for a given phenotypic trait?Recessive and dominant alleles for a given phenotypic trait are those that are masked or masked respectively the expression of the feature.
Therefore, with this data, we can see that dominant alleles are able to mask a particular feature in heterozygous individuals as obtained after a line pure cross.
Learn more about recessive and dominant alleles here:
https://brainly.com/question/3839594
#SPJ1
the so-called piltdown man was once considered an unusual and perplexing human ancestor, but it turned out to be the jaw of a young orangutan attached to a homo sapiens skull. what dating technique exposed the piltdown fraud?
The dating technique that exposed the Piltdown fraud was fluorine absorption dating. Flourine absorption dating is a relative dating technique used to determine the relative age of bones from ancient humans or animals.
The technique compares the levels of fluorine in bone from the same site, determining relative age based on these comparisons. This dating technique was used to expose the Piltdown fraud.According to a study published in Nature on November 21, 1953, the Piltdown man was discovered to be a forgery due to fluorine dating techniques. They used fluorine dating, a method of analyzing how much fluorine has penetrated fossil bones since burial. They found that the Piltdown remains contained less fluorine than any of the other materials they examined. This evidence showed that the skull and jaw could not have been buried together and indicated that the pieces of the skull had been artificially stained to match the colour of the jaw.The Piltdown man is one of the most prominent hoaxes in the history of science. The skull had been discovered in the early 20th century in Sussex, England, and had been presented as a crucial missing link between humans and apes. The scientific community was fooled for more than 40 years, until it was discovered that the skull was actually a forgery, made up of the jaw of a young orangutan and a human skull that was less than 1,000 years old.Learn more about skull: https://brainly.com/question/1491477
#SPJ11
the largest criticism of the biological perspective is that it tends to vastly oversimplify systems that are in reality extremely complex. the tendency to do this is called:
The tendency to oversimplify complex systems is called reductionism.
Reductionism is a major criticism of the biological perspective, as it can often neglect the complexities of living systems.
Reductionism is a theory that states that a complex system can be reduced to its individual elements to better understand it. This means that complex things can be broken down into smaller, more simple parts.
This reductionist strategy is used by scientists to simplify complex scientific systems and make them more easily understandable by breaking them down into simple and distinct elements.
Because biological systems are complicated and multifaceted, they are difficult to understand and study. Reductionism is the biological perspective's strategy for dealing with this complexity and gaining a better understanding of how biological systems function.
The largest criticism of the biological perspective is that it tends to vastly oversimplify systems that are in reality extremely complex. The tendency to do this is called reductionism.
Know more about reductionism here:
https://brainly.com/question/3859361
#SPJ11
Compare the patterns of results from your Punnett square for Problem 1 on Student Sheet 5. 1 with the results from the Ocean/ Lucy cross in ""Gene Combo. "" Why are they similar?
The Punnett square for Problem 1 on Student Sheet 5.1 and the results from the Ocean/Lucy cross in "Gene Combo" are similar because both involve the inheritance of a single gene with two possible alleles: dominant and recessive.
In Problem 1 on Student Sheet 5.1, the gene in question is for flower color in pea plants, with the dominant allele (P) causing purple flowers and the recessive allele (p) causing white flowers. The Punnett square shows that when two heterozygous plants (Pp) are crossed, the resulting offspring have a 3:1 ratio of purple to white flowers, consistent with the laws of Mendelian inheritance.
In the Ocean/Lucy cross in "Gene Combo," the gene in question is for fur color in mice, with the dominant allele (B) causing black fur and the recessive allele (b) causing brown fur. The cross between two heterozygous mice (Bb) results in offspring with a 3:1 ratio of black to brown fur, again consistent with Mendelian inheritance.
Both the Punnett square and the Ocean/Lucy cross follow the same basic principles of Mendelian inheritance, with the dominant allele masking the recessive allele in heterozygous individuals. As a result, the observed ratios of dominant to recessive phenotypes in the offspring are predictable and follow a specific pattern.
To know more about the Punnett square, here
https://brainly.com/question/14438101
#SPJ4
Identify the correct formula for phosphorus and oxygen
The correct formula of a compound that has ten oxygen atoms and four phosphorus atoms is P4O10.
When both the reactants and products of a chemical reaction have an equal amount of atoms and charge of each chemical element, the equation for the reaction is said to be balanced.
Phosphorus pentoxide is created when phosphorus and oxygen combine (P2O5).
The reaction involved is : P4 (s)+5O2 (g)⟶2P2O5 (s)
Subscripts that appear after each element's symbol indicate how many atoms of that element are present in the compound.
(The letters P and O stand for phosphorus and oxygen, respectively.)
There are 4 phosphorus atoms and 10 oxygen atoms in all. Tetraphosphorus Decoxide is the name of the substance.
To know about formula
https://brainly.com/question/30168705
#SPJ4
The complete question is
What is the correct formula of a compound that has ten oxygen atoms and four phosphorus atoms?
What is a difference between systemic and pulmonary circulation?
A.
Systemic circulation carries deoxygenated blood to the body and pulmonary circulation carries oxygenated blood to the lungs.
B.
Systemic circulation carries oxygenated blood to the body and pulmonary circulation carries deoxygenated blood to the lungs.
C.
Systemic circulation carries oxygenated blood to the lungs and pulmonary circulation carries deoxygenated blood to the body.
D.
Systemic circulation carries deoxygenated blood to the lungs and pulmonary circulation carries oxygenated blood to the body.
Answer:
It's B!
Explanation:
Systemic circulation carries oxygenated blood to the body and pulmonary circulation carries deoxygenated blood to the lungs. This is the main difference between the two types of circulation. Systemic circulation is responsible for delivering oxygen-rich blood from the heart to the rest of the body, while pulmonary circulation is responsible for carrying oxygen-poor blood from the heart to the lungs, where it can be oxygenated and then returned to the heart.
It is not option C because systemic circulation carries oxygenated blood to the body, not the lungs. It is not option A because systemic circulation carries oxygenated blood to the body, not deoxygenated blood. It is not option D because pulmonary circulation carries deoxygenated blood to the lungs, not oxygenated blood.
Hope this helps! If not, I'm sorry! If you need more help you can ask me! :]
Shortly explain the science behind gene therapy.
Explanation:
Gene therapy is a medical field that aims to treat genetic disorders by introducing or modifying genetic material within an individual's cells. The goal is to replace a missing or defective gene or to introduce a new gene to improve the function of a specific cell or tissue.
There are two main approaches to gene therapy: ex vivo and in vivo. Ex vivo gene therapy involves the removal of cells from a patient, modifying the cells outside of the body, and then re-implanting them back into the patient. In contrast, in vivo gene therapy directly delivers the genetic material to the targeted cells within the body.
Gene therapy can be achieved using various methods, such as viral vectors, which are modified viruses that can deliver the genetic material to cells. Other methods include using nanoparticles or directly injecting the genetic material into cells.
Although gene therapy has the potential to cure genetic disorders, there are still some challenges and risks associated with it, including the risk of immune reactions, unintended mutations, and the difficulty of delivering the genetic material to the appropriate cells. However, with ongoing research and development, gene therapy is becoming increasingly promising as a viable treatment option for a variety of genetic disorders.
Why do we not see red, orange, and yellow colors in leaves during most of the year? a. During the rest of the year, the tree isn't conserving water. b. Accessory pigments are masked by chlorophyll most of the year. c. Cold weather is needed to stimulate accessory pigments to show off their c colors. d. The photoperiod needs to shorten in order to trigger the accessory pigments.
Because of its abundance, chlorophyll covers other pigments like xanthophyll and carotenoids that are yellow and orange in colour. Other pigments can be observed in leaves as the amount of chlorophyll decreases.
Why are red, orange, and yellow colours absent from leaves for the majority of the year?You could believe that the orange and yellow hues, or pigments, are only present in leaves during the fall, but in reality, they are present all year long; we can just not see them because of the intense green pigment that is also present in leaves hides them.
Why are the yellow and orange colours not visible during the summer?As I've mentioned in a number of my earlier pieces, leaves yellow and orange hues come to light when chlorophyll, the pigment that gives leaves their green appearance, is lost from the leaf. These pigments were hidden by chlorophyll in the summer.
to know more about pigments here:
brainly.com/question/24193152
#SPJ1
Fill in the table with two pros and two cons of the corn farmer switching to the genetically modified insect-resistant corn
The two pros and two cons of the corn farmer switching to the genetically modified insect-resistant corn are shown below:
PROS
1.) Genetically modified (GM) crops have been shown to be safe via study and usage, and they may potentially improve the safety of popular meals.
2.) GMO crops reduce food prices while increasing nutritional value, hence reducing global hunger.
CONS
1) Human clinical trials have not established that genetically modified (GM) crops are safe for human consumption.
2) Plant genetic modification may result in changes to the food supply that introduce toxins or provoke allergic responses.
The Genetic Literacy Project reports that "the most recent data from the International Service for the Acquisition of Agri-biotech Applications (ISAAA) show that more than 18 million farmers in 29 countries, including 19 developing nations, planted over 190 million hectares (469.5 million acres) of GMO crops in 2019." According to the group, the crops are prohibited in a "majority" of European nations, as well as Russia. Nonetheless, most nations that prohibit the cultivation of Transgenic crops accept their import. Europe, for example, buys 30 million tonnes of GMO maize and soy animal feeds each year.
Learn more about genetically modified corn:
https://brainly.com/question/29978368
#SPJ4
Automatically
d) State the null hypothesis for the experiment in Figure 1. Provide reasoning to justify the
claim that the change in the amino acid sequence in the modified RNA polymerase affected the
shape of the active site on the enzyme.
The null hypothesis for experiment 1 is that the replacement of an amino acid will not affect the experimental strain's maximal elongation rate.
What is a null hypothesis in simple terms?Conjectures used in statistical tests, which are formal techniques for drawing conclusions or making decisions based on data, include the null hypothesis and the alternative hypothesis. The hypotheses, which are based on a sample of the population, are suppositions about a statistical model of the population.
The tests are essential components of statistical inference and are frequently used to distinguish between statistical noise and scientific claims when interpreting experimental data in science. "The null hypothesis is the assertion that is being tested in a test of statistical significance.
Learn more about null hypothesis
https://brainly.com/question/28920252
#SPJ1
Please help me!!!!! Hurry!
Missense mutations result in the incorporation of a different amino acid into the protein, while nonsense mutations result in the formation of a premature stop codon, leading to a truncated and often non-functional protein.
What is the difference between missense and nonsense as types of substitution mutation?In a missense mutation, a single nucleotide change results in a different amino acid being incorporated into the protein. This can have a range of effects, from no effect at all to a complete loss of function.
In a nonsense mutation, a single nucleotide change results in the formation of a premature stop codon, which truncates the protein before it is complete. This results in a truncated and usually non-functional protein.
Learn more about mutation:https://brainly.com/question/17130462
#SPJ1
7 points for each answer and a brainliest yay!
All the scientific theories used to explain the formation of the solar system are
A. Outdated
B. Imaginative
C. Non-testable
D. Unacceptable
through artificial selection, humans bred dogs from wolf ancestors. describe what type of selective pattern this represents to first get domesticated animals than different dog breeds. why this pattern? do not write artificial selection!
The selective pattern that humans bred dogs from wolf ancestors represents is "selective breeding.
Selective breeding is a type of selection pattern that was done intentionally by humans to create domesticated animals and different dog breeds. Selective breeding involves mating animals with specific traits in the hope of creating offspring with the desired traits. Humans have selectively bred plants and animals for thousands of years to produce desirable traits.
They used selective breeding to create a variety of domesticated plants and animals that are common today. The primary purpose of selective breeding is to create animals with desirable traits that are more suited to human needs or that can serve specific functions. It is the process of selecting specific traits by humans rather than natural selection.
Humans used such a pattern in breeding dogs from wolf ancestors. By selecting the desired traits in different wolves, humans over time created domesticated dogs. This selective breeding led to different dog breeds that possess unique characteristics like specific behaviors, shapes, sizes, and colors.
Learn more about ancestors: https://brainly.com/question/1234951
#SPJ11
Trinucleotide repeat disorders are hereditary diseases caused by mutant genes containing an increased number of repeats of a DNA trinucleotide sequence. Which sequence(s) contain a trinucleotide repeat? Select all that apply.
a)...CACGGAAGAAGAAGAAGAAATAGAC...
b)...AGCGACAGCAGCAGCAGCAGCAAGT...
c)...TTCACTGTCACTGTCACTGTCACTGTCC...
d)...CACGGCGGCGGCGGCGGCATCGC...
e)...GGCAGGCAGGCAGGCAGGCAGGCTG...
Trinucleotide repeat disorders are hereditary diseases caused by mutant genes containing an increased number of repeats of a DNA trinucleotide sequence. Therefore, the correct option is a, c, and e.
Which sequence(s) contain a trinucleotide repeat?Trinucleotide repeat is a DNA sequence that is repeated several times in a row. A repeated sequence of three nucleotides that leads to a specific and consistent phenotype when it is repeated is known as trinucleotide repeats.Sequences containing a trinucleotide repeat are:
a) CACGGAAGAAGAAGAAGAAATAGAC, c) TTCACTGTCACTGTCACTGTCACTGTCC, and e) GGCAGGCAGGCAGGCAGGCAGGCTG.Learn more about trinucleotide: https://brainly.com/question/2898576
#SPJ11
Computer crime first appeared in the 1970s. Soon after, special protocols of digital investigation and evidence were needed because _____.
cybercriminals were really smart
digital data could be altered in different ways from nondigital data
computers were becoming more powerful
the Internet was invented
Computer crime first appeared in the 1970s. Soon after, special protocols of digital investigation/forensics and evidence were needed because b. Digital data can be altered differently than nondigital data.
How computer crime first appeared?
Unlike traditional physical evidence, digital data can be easily altered or destroyed without leaving any visible traces, which makes it challenging to preserve and present it as evidence in a court of law. Therefore, special protocols of digital investigation and evidence were developed to address these challenges and ensure the integrity of digital evidence.
This need arose because of the unique characteristics of digital data, not necessarily because cybercriminals were smart or because computers were becoming more powerful. The invention of the internet also played a role in the growth of computer crime, but it was not the sole reason for the need for special protocols of digital investigation and evidence.
To learn more about digital investigation/forensics , visit: https://brainly.com/question/14893776
#SPJ1
Answer:
digital data could be altered in different ways from nondigital data
1. Which of these characteristics would classify an introduced species as being invasive?
A. They can be grown easily
B. They have many natural predators
C. They take away resources from native organisms
D. They tend to not survive well with changes to a new environment
Answer:
A
Explanation:
A species is said to be invasive when the rate at which it is spreading and multiplying is higher than expected causing a negative effect on the natives of the habitat
What might the shape of the skull and the supraorbital height tell us about each species?
It describes the species' gender and its capabilities. It could also reveal the age of the species.
Australopithecus africanus is the species that the unidentified skull most closely resembles based on the activity. According on the data the measure of the undefined skull is almost little as the pan troglodyttes, while it's teeth resembled that of a humans. If the foramen magnum indicates the position of the spine in relation to the head, and thus whether the creature moved about on two legs or in another manner, then the position of the opening may indicate when our ancestors first adopted the upright, bipedal posture that is so frequently considered to be the hallmark of humanity.
Learn more about ancestors here-
https://brainly.com/question/15074135
#SPJ1
if cell a has 48 chromosomes, how many chromosomes would be present in cell k?
If cell A has 48 chromosomes, the chromosomes would be present in cell K we cannot say how many chromosomes would be present in cell K because there is no definitive relationship between them.
Chromosomes are tiny structures within a cell's nucleus that contain genetic material in the form of DNA molecules. Each species has a specific number of chromosomes. The majority of human cells, for example, have 46 chromosomes. The chromosomes of a cell duplicate before the cell divides, ensuring that each daughter cell receives an identical set of chromosomes.
Therefore, the number of chromosomes in a cell is a distinct feature of the species or an individual, and it cannot be linked to another cell of the same or different species. Chromosomes can be used to identify different kinds of life and are an essential tool for biologists in their research.
Learn more about chromosomes at:
https://brainly.com/question/30993611
#SPJ11
Describe the effect ht epassage of the natinal forest manegment act in 1976 had on the trend in logging between 1980s and early 2000s
The effect passage of National Forest Management, Plans for renewable resource management are required. Limits on logging were imposed, and loggers were required to keep out of national forests.
The National Forest Management Act (NFMA) of 1976 (P.L. 94-588) is a United States federal law that was enacted in 1976 as an amendment to the Forest and Rangeland Renewable Resources Planning Act of 1974, which called for the management of renewable resources on national forest holdings. The statute was enacted in response to challenges concerning different national forest operations, notably wood harvesting. Members of the Point Baker Association on Prince of Wales Island filed the case Zieske v Butz over the US Forest Service's first environmental impact assessment.
The complaint halted harvesting on 400,000 acres of the island's northwest tip, prompting the forestry sector to ask for Congressional action to overturn the lawsuit. Congressman Foley stated on the floor that six additional actions with rulings identical to Zieske v Butz were impeding logging.
Learn more about National Forest Management act :
https://brainly.com/question/15776732
#SPJ4
Complete question:
Describe the effect the passage of the National Forest Management act in 1976 had on the trend in logging between the 1980s and early 2000s.
The effect of genetic drift on a population that splits into two populations because of geographic isolation may be
A
emigration.
B
immigration.
C
divergent evolution.
D
convergent evolution.
The effect of genetic drift on a population that splits into two populations because of geographic isolation may be divergent evolution.
What impact does genetic drift have on a population?Alleles or genotypes fix in populations as a result of genetic drift. Drift removes alleles, which increases homozygosity and the inbreeding coefficient. In species that experience repeated cycles of extinction and recolonization, drift is presumably prevalent.
How does the divergence of two populations change as a result of genetic drift?Rare alleles may completely disappear, and the gene pool may also shrink. A population may eventually become genetically distinct from the original population as a result of such drift. Divergence, reproductive isolation, and ultimately speciation could result from this.
To know more about genetic drift visit:-
https://brainly.com/question/29764189
#SPJ1
Ancient organisms that lived during closer time periods were more alike than organisms that lived in widely separated time periods. What evidence in the fossil record most directly supports this scientific claim?
A
Most fossils are dated indirectly, by inference from surrounding rock that has been directly dated.
B
The rocks that fossils are found in can be examined in order to infer what environments certain organisms existed.
C
Fossils found in adjacent rock layers are generally more like each other than fossils found in widely spaced layers.
D
If the rock layers in a certain location have not been disturbed by tectonic or other movement, the lowest layer was formed before the layers above it.
Fossils found in adjacent rock layers are generally more like each other than fossils found in widely spaced layers evidence in the fossil record .
Option C is correct.
Which fossils can provide evidence of evolution?The remains or traces of ancient animals, plants, and other organisms that have been preserved are known as fossils. Fossils are crucial to the theory of evolution because they demonstrate that life on Earth used to be very different from what we see today.
What is the relationship between modern and ancient organisms?Evolution is the process by which modern organisms have evolved from ancient ones. Population change over time is evolution. There have been a lot of different explanations for how species change over time, but the ideas that Charles Darwin first put out are the foundation of modern evolutionary theory.
Learn more about ancient organism:
brainly.com/question/1375688
#SPJ1
(URGENT HELP PLEASE) Which of the following does NOT support the theory of natural selection? *
There are species that live in North America that are not found in Australia
Humans have small bones at the end of our spine that resemble tail bones in other animals
Prehistoric mastodons are similar to today's elephants
Species that are similar to each other tend to live near each other
Answer:
arti nya apa wkwk
Explanation:
saya ngk bisa bahasa inggris
What happens to biodiversity
when species are lost?
O biodiversity
O biodiversity
gets higher
stays the same
biodiversity gets lower
O nothing
Answer:
C, biodiversity gets lower
Explanation:
When species are lost, biodiversity gets lower. This is because each species plays a unique role in the ecosystem, and the loss of one species can have cascading effects on the rest of the ecosystem. As more species are lost, the complexity and resilience of the ecosystem decline, resulting in a decrease in overall biodiversity.
Invasive species have what affect on native populations when they exist in the same niche?
Answer: their population was affected
Explanation:
Link the regulation of breathing in humans to the three components of any homeostatic process (ASAP PLS)
Answer:
Homeostasis is the process by which the body maintains a stable internal environment despite external changes. It involves three main components: receptor, control center, and effector. The regulation of breathing in humans is linked to all three components of homeostasis.
Receptor: The receptor in this case is the chemoreceptors located in the carotid arteries and aortic arch. They detect changes in the levels of oxygen, carbon dioxide, and pH in the blood.
Control center: The control center is the respiratory center located in the medulla oblongata of the brainstem. It receives input from the chemoreceptors and sends signals to the effectors to maintain homeostasis.
Effector: The effectors in this case are the muscles involved in breathing, including the diaphragm and intercostal muscles. They are controlled by the respiratory center and adjust the rate and depth of breathing to maintain the appropriate levels of oxygen, carbon dioxide, and pH in the blood.
Overall, the regulation of breathing in humans is an important example of how the three components of homeostasis work together to maintain a stable internal environment in the face of changing external conditions.
Explanation:
which feature does not apply to protists: group of answer choices they form a non-monophyletic group they form a monophyletic group they comprise many of the groups in the domain eukarya they are all eukaryotes they are mostly unicellular
They form a monophyletic group is not a feature of protists.
FeaturesThe first three kingdoms are well defined monophyletic groups, but the "Kingdom Protista" is not monophyletic; it comprises species that are more closely connected to members of other kingdoms than they are to other protists.An ancestral taxon and all of its offspring make up a monophyletic group, often known as a clade. A monophyletic group can be cut from the root with just one cut, but a non-monophyletic group requires two or more cuts.Humans, apes, and new world monkeys are an example of a monophyletic group since they all share the old-world monkeys as their most recent common ancestor.For more information on protists kindly visit to
https://brainly.com/question/1626285
#SPJ1
describe the main differences between bacterial and eukaryotic transcripts. drag the appropriate items to their respective bins.
Bacterial transcripts are single-stranded and produced by the polymerase enzyme. They are relatively simple, consisting of just the coding strand of DNA.
Eukaryotic transcripts are double-stranded and produced by the polymerase enzyme. They contain both the coding and non-coding strands of DNA and are much more complex than bacterial transcripts.
Bacterial transcripts - single-stranded, produced by polymerase enzyme, consists of just coding strand of DNA
Eukaryotic transcripts - double-stranded, produced by polymerase enzyme, contains coding and non-coding strands of DNA
For more questions related to Transcripts, refer here:
https://brainly.com/question/14136689#
#SPJ11
=
7. Which is not a similarity between how
plants and animals use energy?
O Both plants and animals change food into
energy in the mitochondria.
O Both plants and animals require energy to
survive.
O Both plants and animals eat food and turn
it into energy.
O Both plants and animals break down food
into energy.
Answer:
Both plants and animals eat food and turn it into energy.
Explanation:
Plants cannot eat food because they use photosynthesis to make it, and they use the sun as one of the ways to get energy and not eating food.
Which demonstrates an insertion mutation of the sequence GGGCCCAAA?
a. GGGGCCAAA
b. GGGCCAAA
c. GGGAAACCC
d. GGGCCCAAAAAA
FILL IN THE BLANK. Axon terminals __________.
are clusters of enlarged endings of an axon that may contain neurotransmitters
are continuous with the endomysium
are the same as the sarcoplasmic reticulum
are the key structures involved in eccentric contraction of a skeletal muscle
conduct impulses into the deepest region of muscle fibers
Answer: Axon terminals are clusters of enlarged endings of an axon that may contain neurotransmitters.
Axon terminals are clusters of enlarged endings of an axon that may contain neurotransmitters.
At the termination of axons, there are little swellings called axon terminals. Neurotransmitters are often kept there to facilitate communication with other neurons via their synapses, which are typically found at these locations.
These terminals are important for transmitting signals between neurons or from neurons to other cells. They release neurotransmitters, which are chemical messengers that transmit signals across a synapse, or the space between two cells.
The neurotransmitters bind to receptors on the target cell, causing a response. Thus, axon terminals play a crucial role in communication within the nervous system.
To know more about axon terminals here:
https://brainly.com/question/28234182#
#SPJ11