in which direction do particles in a solution move during passive transport

Answers

Answer 1

During the passive transport, the particles move from a higher concentration to a lower concentration without the need for energy expenditure or spending. The passive transport is seen in the cell too.

What is the importance of the different types of transportation?

In the cell, different types of transport are seen, such as active transport and passive transport; in active transport, energy is used, while energy is not used in passive transport. The movement of molecules across the cell plasma membrane is important because it allows cells to get rid of unwanted molecules. Passive transport does not require energy, and many nonpolar small molecules and gases can cross the lipid plasma membrane barrier and go into and out of the cell while, in this passive transport process, they save the cell's energy.

Hence, during the passive transport, the particles move from a higher concentration to a lower concentration without the need for energy expenditure or spending.

Learn more about the different types of transportation here.

https://brainly.com/question/29764225

#SPJ6


Related Questions

1. Peer review allows others in the field to assess a scientist's investigations and results.
a. True
b. False

Answers

Answer:

False.

Explanation:

Peer review provide others scientist in the field to assess a scientist's investigations and results.

Peer Review:

It is the reviewing or evolution of the work by many professionals and experts in the field.

For example-  A scienfic manuscript is send to the many scientist for evolution before publication.

This peer review is unbiased because the reviewer does not know the name or other information about writter.

To know more about  Peer Review:

https://brainly.com/question/10853815

I'll give you a brainliest if is right or at least shows some effort
(thanks & i hope your having a good day)

In your own words, explain how background noise detected in space provides evidence for the Big Bang Theory.

Answers

Answer:

Celestial microwave radiation found a strange microwave signal causing background noise in the radio telescope. The signal came from every direction. The young universe would have been very hot. The microwave background radiation is the remaining heat from the Big bang.

I tried my hardest and this is what I put on MY test so good luck

What’s the corresponding mRNA strand for this DNA strand: TACGGGATAAGGCCACCTCTGGTAGACCACATT

Answers

Thymine(T) pairs with adenine(A)

Adenine(A) pairs with uracil(U)

Cytosine(C) pairs with guanine(G)

therefore the corresponding mRNA strand for TACGGGATAAGGCCACCTCTGGTAGACCACATT

is

AUGCCCUAUUCCGGUGGAGACCAUCUGGUGUAA

20 points and brainliest!
More and more often, farmers and food manufacturers are genetically modifying crops to improve flavor, reduce disease, and lower costs. Do you think genetically modifying food is a good idea? Use specific examples and reasons to support your opinion.

Answers

Explanation:

it is a good idea as it increase the life of certain food, also keeps bacteria away

centricles play specific roles during the division of​

Answers

Answer:Centrioles play a notable role in cell division. ... These spindle fibers act as guides for the alignment of the chromosomes as they separate later during the process of cell division. Though centrioles play a role in the mitosis of animal cells, plant cells are able to reproduce without them

Explanation:

How does soil erosion affect streams and rivers?

Answers

Explanation:

The effects of soil erosion go beyond the loss of fertile land. It has led to increased pollution and sedimentation in streams and rivers, clogging these waterways and causing declines in fish and other species. And degraded lands are also often less able to hold onto water, which can worsen flooding.

What is a likely reason for the change from mitosis to meiosis during reproduction under these conditions?

Answers

it’s b, meiosis is mixing both parent cells genetic information therefore their offspring have a better chance at sieving

Mitosis and meiosis are the two types of cell division, which result in the generation of daughter cells. Yeasts are capable of undergoing meiotic and mitotic division under favorable conditions.

The correct answer is:

Option B: Crossing over genes during meiosis increases diversity and the chance of survival of the next generation.

The significance of meiosis can be explained as:

Meiosis is a reduction division, in which the diploid parent cell gives rise to haploid daughter cells.

The crossing over of the genetic material of the haploid cells leads to genetic diversity and a higher rate of survival.

Meiosis leads to genetic diversity as the data in the parent cells are fused and recombined to give rise to new offspring.

Thus, meiosis is an important step in the genetic variation and survival of the organism.

Therefore, option B is correct.

To know more about meiosis, refer to the following link:

https://brainly.com/question/11622266

What are common changes
In an environment?

Answers

Answer:shelter, land, prey

Explanation:

Changes? Do you mean like temperature and humidity

What do RNAs do in the cell?

Group of answer choices

Answers

Answer:

A wide range of functions are performed by RNA, from translating genetic information into molecular machines and cell structures to controlling gene activity during development, cellular differentiation, and changing environments.

Explanation:

None

4
_ is a component of soil made entirely of decomposed organic remains. This component increases soil fertility and _
the ability of soil to retain water.
A. Humus; increases
B.
Parent material; decreases
C.
Subsoil; increases
D
Topsoil; decreases

Answers

Answer:

The answer is A

Explanation:

am 100% sure

someone pleaseee help me with this !!

Answers

lizards and snakes!

plants Which part of the carbon cycle occurs when plants, trees, or fossil fuels are burned?
A. Transpiration B. Oxidation C. Photosynthesis D. Combustion

Answers

I believe C- photosynthesis but I could be wrong.

describe and explain how the rate of photosynthesis is affected by light intensity​

Answers

Increasing the light intensity increases the rate of photosynthesis, until some other factor - a limiting factor - becomes in short supply. At very high light intensities, photosynthesis is slowed and then inhibited, but these light intensities do not occur in nature.

what is a cell membrane?

Answers

Answer:

The cell membrane is the semipermeable membrane of a cell that surrounds and encloses its contents of cytoplasm and nucleoplasm.

Explanation:

Answer:

Short. The semipermeable membrane surrounding the cytoplasm of a cell.

Long. The cell membrane is the semipermeable membrane of a cell that surrounds and encloses its contents of cytoplasm and nucleoplasm. The cell membrane separates the cell from the surrounding interstitial fluid, the main component of the extracellular fluid.

Explanation:

Can a
Brain cell
Fat cell
Muscle cell
Red blood cell
Liver cell
Convert one type of fuel molecule to another

Answers

answer: yes

exanation:

Write a summary statement for saturated fats including whether they are solids or liquids at room temperature and weather they have all single carbon-to-carbon or at least one carbon-to-carbon bond

Answers

Answer:

A saturated fat is a type of fat in which the fatty acid chains have all or predominantly single bonds. A fat is made of two kinds of smaller molecules: glycerol and fatty acids. Fats are made of long chains of carbon atoms. Some carbon atoms are linked by single bonds and others are linked by double bonds. Double bonds can react with hydrogen to form single bonds. They are called saturated because the second bond is broken and each half of the bond is attached to a hydrogen atom.

Explanation:

Answer:

saturated fats consists of single covalent bond and they are solid at room temperature and their melting point increases with increasing chain length

hope it helps

Explanation:

Which of the following is an example of how a species may change over time?
A.
Bacteria become resistant to antibiotics.
B.
Dog fur becomes thicker in the winter.
C.
Turtles become male or female based on incubation temperature.
D.
Humans become immune to a certain illness after vaccination.

Answers

Answer: possibly A

Explanation: B an C are not it because they are more like mutations. D humans don’t always become immune.

6. Name the nitrogenous wastes excreted by the following organisms:-
(1) Desert mole
(ii) Marine fish
(111) Tilapia​

Answers

Answer:

Desert mole excretes concentrated urine with urea.

Marine fish excretes urine with uric acid.

Tilapia excretes dilute urine with amino acids.

Explanation:

The nitrogenous wastes that are excreted by the following organisms are as follows:

Desert mole: Urea.Marine fish: Uric acid.Tilapia: Amino acids.

What is Nitrogenous waste?

Nitrogenous waste may be defined as the compounds which are excreted by the organisms that contain an excessive amount of nitrogen or its derivative products.

Among the above-given organisms, Desert mole and Marine fish are Ureotelic organisms that excrete either concentrated or diluted urine with a significant amount of urea and uric acid respectively.

While Tilapia is an Ammonotelic organism that excretes diluted urine with a significant amount of amino acids.

Therefore, it is well described above.

To learn more about Nitrogenous waste, refer to the link:

https://brainly.com/question/9517408

#SPJ2

Adhesion occurs when water is attracted to other polar substances. Which of the following is an example of adhesion in organisms?
a. Capillary action of liquid in plant stems b. Release of sweat to reduce body heat
C. Movement of ions to maintain homeostasis
d. Pumping of blood through the circulatory system​

Answers

Answer:

a. Capillary action of liquid in plant stems

C. Movement of ions to maintain homeostasis

d. Pumping of blood through the circulatory system​

Explanation:

Hope this helped!

In organisms, an important example of adhesion is the: a. Capillary action of liquid in plant stems.

What is Adhesion?

Adhesion can be described as the attraction that occurs between molecules as a result of molecular mechanism, which is also known as capillary action.

In plants, capillary action occurs when the molecules of water cling to the xylem cell walls. This is known as adhesion.

Therefore, an example of adhesion in organisms is: a. Capillary action of liquid in plant stems.

Learn more about adhesion on:

https://brainly.com/question/14457491

#SPJ2

When discussing Newton’s laws of motion, which terms do people most likely use when talking about Newton’s third law of motion?

A. “action” and “reaction”


B. “mass” and “inertia”


C. “inertia” and “force”


D. “force” and “acceleration”

Answers

Answer:

A. action and reaction

Explanation:

the third law is:-

Every Action has it's opposite and equal Reaction

Answer:

The correct answer is "action" and "reaction".

Explanation:

Newton's Third Law is: "for every action, there is an equal and opposite reaction". This means that every time something is pushed on, the other object pushes back. For example, when a swimmer pushes off the wall of a pool, the wall will push back on the swimmer, giving them the push they need to swim to the other side.

"CRISPR" stands for Clustered Regularly Interspaced Short Palindromic Repeats, which are the hallmark of a bacterial defense system that forms the basis for CRISPR-Cas9 genome editing technology. In the field of genome engineering, the term "CRISPR" or "CRISPR-Cas9" is often used loosely to refer to the various CRISPR-Cas9 and -CPF1, (and other) systems that can be programmed to target specific stretches of genetic code and to edit DNA at precise locations, as well as for other purposes, such as for new diagnostic tools. How can this tool be used to alter genes in various organisms?

Answers

Answer:

by designing short guide RNAs (sgRNAs) customized to target genes of interest in the cells of these species

Explanation:

The CRISPR-Cas9 editing system is a versatile and powerful genome engineering tool for editing genomes, which can be directed to alter almost any DNA sequence in order to modify gene function. This system consists of an endonuclease protein (Cas 9) that cuts DNA at specific sites guided by a short guide RNA (sgRNA), which binds by base complementarity to the target sequence. This sgRNA must be designed with efficiency and specificity to target genes of interest. In consequence, the CRISPR-Cas9 genome editing system produces DNA double-strand breaks which may be repaired by 1- error-prone nonhomologous end joining (NHEJ) or 2-homology-directed repair (HDR) DNA repair pathways. According to the DNA repair pathway that has been activated, it is possible to trigger genetic modifications in the cells of different species (i.e., plant cells, animal cells, human cells, etc).

What number go in each circle ?
What number go in both circle?

Answers

Answer:

1 goes in the middle of all of the circles. 2 goes in animal cell. 3 goes in plant cell. 4 goes in between animal and plant cell. 5 goes in The middle of all of the circles. 6 goes in the middle of all of the circles. 7 goes in the bacteria circle. 8 goes in bacteria. 9 goes in bacteria.

Also:

8 and 9 I'm not completely sure of. Let me know if I'm wrong. Good Luck! :D

Tay-Sachs disease is a rare inherited disorder that progressively destroys nerve cells
in the brain and spinal cord. The allele for having Tay-Sachs is recessive written as t
and the functional allele is written as T. If two heterozygous parents have four
children, how many of the offspring will most likely inherit and develop Tay-Sachs
disease?

Answers

Answer:

B and C

Explanation:

I just took the test and it was right

5 tips to improve your critical thinking - Samantha Agoos

Watch the Video and make a summary

Ps: They don't let me paste the link lookup what it says above

Answers

Answer:

that one is hard because we did not see the vidoe

Explanation:

can u answer that question

Answers

Answer:

The synthesis of new proteins

HELP ME PLSSS someone

Answers

Answer: B

Explanation: The amount of salt in the inner circle is equal to the amount of salt in the outer circle.

what occurs in a chemical reaction

Answers

Answer:

options on. D is write answer

which of the following is not true about an allele?

A. alleles are found at the same place on a chromosome

B. alleles have a dominant and recessive form

C. an allele is never independently assorted and passed down randomly

D. and allele is one of two or more forms of a gene

Answers

Answer:

C

Explanation:

I guess it's C but not conform

C. An allele is never independently assorted and passed down randomly.

What is an allele?

Alleles are found at the same place on a chromosome, known as a locus. They can have a dominant and recessive form, meaning that one form of the allele may be expressed over the other in the phenotype of an organism. An allele is one of two or more forms of a gene, which are variations of a particular gene that can produce different traits in an organism.

However, alleles are not always passed down randomly. In meiosis, the process of cell division that produces gametes (sex cells), the alleles of a gene are independently assorted and passed down to the offspring. This means that each gamete receives one copy of each allele at random, which can result in a mix of alleles in the offspring. However, the exact combination of alleles that an offspring receives depends on the combination of alleles that its parents had, which can influence the probability of certain alleles being passed down.

Learn more about allele, here:

https://brainly.com/question/14206531

#SPJ2

Which is an example of the use of plants in human societs?

Answers

Answer:

|

v

Explanation:

photosynthesis creates oxygen, water and glocose(starch) and we take in those and use it in our mitochondrias to create atp so it can hapen all over again.

Human uses of plants include both practical uses, such as for food, clothing, and medicine, and symbolic uses, such as in art, mythology and literature.

The movement of water in or out of the cell membrane without the use of ATP.

Diffusion

Facilitated diffusion

Osmosis

Excoytosis

Answers

The answer is Osmosis because its the only one that has anything to do with water
Other Questions
How do you compare the mass of proton, neutron, andelectron? What does the information in Ancient Egypt suggest about the author's point of view? Select all that apply. Answer choices for the above question The author thinks that sometimes it is better to simply appreciate the pyramids rather than try to understand how they were created. The author believes the pyramids will start to have a strong influence on future architectural projects throughout the world. The author does not believe humans could have built such giant structures given the tools available at the time. The author cannot understand how it is possible that the pyramids are still standing after so many centuries. The author thinks that the architectural design elements of the pyramids are some of the best in the world. The author is fascinated by the size and construction quality of the pyramids. Hello everyone. I hope someone know the answer to this. because I really hate biology is there anyone out there who is really good at biology?? thank you. I'll also give a brainliest Select the best topic sentence for an informative paragraph written to support a controlling idea that compares and contrasts the monarch butterfly and the ruby-throated hummingbird. In conclusion, monarch butterflies and ruby-throated hummingbirds have similar migration patterns. Later on, monarch butterflies and ruby-throated hummingbirds have similar migration patterns. To begin with, monarch butterflies and ruby-throated hummingbirds have similar migration patterns. Otherwise, monarch butterflies and ruby-throated hummingbirds have similar migration patterns. What are the parts and primary function of the male reproductive organ? help child.......help me Reread paragraph 3. Which persuasive technique is used in this paragraph ??????????????????????????????? What is the measure of ZRST? Xander ordered a pizza with 8 equal slices as shown in the image below.AssiHapoThesIto see allaredIf Xander ate 6 slices of pizza, what percentage of the pizza did he eat? A bottling machine fills 100 bottles in 150 seconds. How many minutes does it take the same machine to fill 1000 bottles? Select the correct answer.Which of the following is not a martial art?A. Kung FuB. AikidoC. BilliardsD. Muay Thai A 100kg couch is being pushed with 196N of force. As it slides along the ground it experiences a coefficient of friction of 0.1. What is the net force in this situation?A 300NB 202NC 398ND 98N 6th grade reading and writing i will give brainliest if the difference of simple interest on a certain amount of money for 4%for five years and 5%for 4 years is. Rs. 28. find the sum As a bicycle is ridden west in a straight line with decreasing speed,the acceleration of the bicycle must be why does math have to be so hard A client whose labor is being augmented with an oxytocin(Pitocin) infusion requests an epidural for pain control. Findings of the last vaginal exam, performed 1 hour ago, were 3 cm cervical dilation, 60% effacement, and a 2-station. What action should the nurse implement first? Jennifer drove to her aunt's house, which is 325 miles away. If it took her 5 hours and she drove at a constant rate, what was Jennifer's speed in miles per hour? which statement best identifies the central idea of this oral history