In this activity, you will learn more about three individuals who played an important role in the Salem witch trials—Cotton Mather, Sarah Good, and Anne Putnam. You will read a brief biography about each person and some primary source information related to each person. You will also answer a few questions to evaluate the credibility of the information in each source.

Part A

Cotton Mather was a powerful Boston clergyman whose ideas about witchcraft influenced many of the judges at the trials. You can read this article to learn more about the life of Cotton Mather.

Primary resource: In 1689, Mather published Memorable Providences, Relating to Witchcrafts and Possessions, an account of a witchcraft case in Boston. Read an excerpt from the document to get an idea of what Mather thought about witchcraft.

Mather calls himself an eyewitness to the event. Do you think eyewitness accounts are always believable? Why or why not? Write your answer in 50 to 75 words.

Answers

Answer 1

When an eyewitness of an event tells us a story, we must consider it as credible. However, we must check it by consulting other sources.

What is a story?

A story is a type of narration whose main characteristic is the representation of events through language. The stories are testimonies that contribute to the preservation of memory about an event or even create memories. Another outstanding aspect of the stories is that it is influenced by the context and interpretation of the speaker.

According to the above, an eyewitness of an event may have a version of an event. However, to ensure the veracity of his account, it is necessary to consult sources related to the event such as

Other storiesResearchDocuments

Learn more about narration in: https://brainly.com/question/1223046


Related Questions

What are ya'll hoping to get for Christmas? Tell me in the comments below!

Answers

Answer:

platforms just those alt weird shoes you know what im talking bout

Answer:

I might get a new phone

Explanation:

have a nice day! :)

~Brainiest is appreciated ~

why did the British want to expand their control into the Ohio valley in the mid-1700s

Answers

In North America, Great Britain and France both claimed the Ohio River Valley. British settlers wanted to farm the rich soil there, and the French wanted to trap beavers and trade the furs. Great Britain and France could not agree about which country should control these lands.

the low anchovy catch in 1998 was most likely the result of

Answers

Based on geographical and historical perspective, the low anchovy catch in 1998 was most likely the result of "El-Nino."

What is Low Anchovy Catch?

Anchovy is a form of small oily fish that are found in places like the Atlantic, Indian, and Pacific Oceans, and as well as the Black Sea and the Mediterranean Sea.

In 1998 it was reported that there was a low catch of Anchovy fish, and this has been attributed to change in ocean climate, as there was no record of overfishing, restrictions, fishery closure.

El-Nino is a form of change in Ocean climate characterized by unprecedented warming of water surface, mainly in the Pacific Ocean.

Hence, in this case, it is concluded that the correct answer is El-Nino

Learn more about El-Nino here: https://brainly.com/question/11167118

If I ask a question will I just be given THE answer?

Answers

yepp what’s your question i might can help

Which is a goal of the AEC?
No links

Answers

Answer:

to be rich

Explanation:

70

James Oglethorpe’s business plan in _____ was upset by African American enslavement. Select the best answer from the choices provided. A. South Carolina B. Virginia C. Maryland D. Georgia

Answers

Answer(:GEORGIA )- would be your answer

Explanation:

[tex]\large\color{lime}{\boxed{{\colorbox{black}{Answer:}}}}[/tex]

[tex]\huge\colorbox{pink}{\color{black}{\boxed{D. Georgia}}}[/tex]

[tex]\huge\color{crimson}{\boxed{{\colorbox{black}{ChaEunWoo2009}}}} [/tex]

#CarryOnLearning

Versailles treaty
Please help (30points)

Answers

Answer:

again please tell chapter name does chapter name is Versailles treaty

C. The picture depicts the famous Chauhan ruler in the court of Muhammad Ghori, 1. Identify this Hindu ruler, 2. Mention the circumstances and the reasons that led to his defeat by Muhammad Ghori 3. Write a short note on this famous ruler. ​

Answers

Answer:

Please  send me image of the specific person so i can clarify who he is!

Explanation:

South Carolina and Georgia had the fastest growing economies in the colonies because their large tobacco plantations. True or false?​

Answers

Question:-

South Carolina and Georgia had the fastest growing economies in the colonies because their large tobacco plantations. True or false?

Answer:-

True

Explanation:-

To make money for trade, Britain needed to export more commodities than imports. (Tobacco)

Tobacco formed the basis of the colonial economy.

Due to bad weather, the colony was unable to produce the other crops needed for survival. With no crops, lack of income and food, the settlers took this opportunity to begin growing tobacco

What preparations did Napoleon take his early career to prepare himself for success as a French army officer?

Answers

he beat women until they were black and blue

which national capital was once known as the city of kings?

Answers

Answer:

Lima, Peru

Explanation:

what country was handball invented in over 100 years ago?

Answers

Answer:

Handball was first played in Germany at the end of the 19th century. That's over 100 years ago! Germany has won three Handball World Championships.

Explanation:

It should be Denmark

King Louis XIV was a monarch that had absolute power. How did he become so powerful?

Answers

Answer:

Explanation:

An absolute monarchy is one in which the king is God's representative on Earth, giving him absolute power that's free from all restraints. He created a centralized state that gave him complete power over the French government. King Louis XIV was an absolute monarch because he answered only to God.

based on the excerpt, the westward migration by the mormons in the 1830s and 1840s was most likely motivated by the

Answers

From the information given, it should be noted that the reason for the migration was the need to escape persecution.

Migration simply means the movement of people from one geographical area to another.

From the complete information, it should be noted that the the westward migration by the mormons in the 1830s and 1840s was most likely motivated by the need to escape persecution.

Learn more about excerpts on:

https://brainly.com/question/21400963

Two maerry blue eyes A very little nose A long snowy beard and cheeks like a rose A round chubby man A big bulging pack Hurrah for Old Santa We're glad he's come back!

Answers

Answer:

hi

tysm for pts

advanced merry Christmas and Happy new year

Explanation:

have a good day

which future u.s. president was captured by the british during the american revolutionary war?

Answers

Answer:

Thomas Jefferson and that is how the star springled banner

Explanation:

1. What is the purpose of the lab?

To observe thhe way wind changes the trajectory og gasses or objects and to observe the heat different objects obsorbes heat.

Answers

Answer:

The purpose of a lab report is to organize and communicate what you did in your experiment.

Explanation:

"We went on to Greece, and the Greeks led us to the edifices where they worship their God, and we knew not whether we were in heaven or on earth. For on earth there is no such splendor or such beauty, and we are at a loss how to describe it. We know only that God dwells there among men . . . we cannot forget that beauty." . . . Vladimir then inquired where they should all accept baptism, and they replied that the decision rested with him. Background Information: In this passage from the Primary Chronicles, Vladimir I of Kiev has instructed advisers to inspect the religions of the world and to report their findings back to him. What religion can you infer is being discussed in this passage? Islam Roman Catholicism Judaism Eastern Orthodox

Answers

Considering the passage's content, the religion one can infer is being discussed in this passage is "Roman Catholicism."

Baptism in Roman Catholicism

The practice of baptism is one of the essential aspects of Roman Catholicism.

Usually, a catholic is expected to be baptized once in his life, most while still a kid.

However, for those that did not get baptized as a child and those that wish to join the religion, they are expected to be Baptized.

Therefore, given that part of the passage mentioned that "Vladimir then inquired where they should all accept baptism..., " which is a practice of Roman Catholicism, we conclude that the correct answer is option B. "Roman Catholicism.

Learn more about Roman Catholicism here: https://brainly.com/question/4219318

what was the intended effect of the proclamation of 1763?

Answers

Answer:

Proclamation of 1763, proclamation declared by the British crown at the end of the French and Indian War in North America, mainly intended to conciliate the Native Americans by checking the encroachment of settlers on their lands.

Simple question

. State true or false


1) The drop cap button is present on the home tab______.
2) To exit logo , type bye on the command input box ________​

Answers

Answer:

Hello There!

1) The drop cap button is present on the home tab

It is

[tex]\Large\bold\red{False}[/tex]

Because you'll find it if you see the steps below...

Step 1: Go to ribbon

Step 2: Go to insert tab

Step 3: Go to Text group

You'll find drop cap button there

2) To exit logo , type bye on the command input box.

[tex]\Large\bold\red{True}[/tex]

Yeah, you need to type bye on the command then

you can exit logo.

I hope it is helpful to you...Cheers!__________

Based on the information given, the statement that the drop cap button is present on the home tab is false.

Home tab.

It should be noted that the home tab simply means the default tab that is in Microsoft Word.

It should be noted that the drop cap button is not present on the home tab. Also, to exit logo type bye on the command input box. This is true.

Learn more about the home. button on:

https://brainly.com/question/10787400

NEED HELP
Why did many Americans support the Sedition Act and the American Legion?
O A. They wanted to exclude former enemies, such as Germans.
B. They wanted to protect America from foreign influences.
O C. They wanted more immigrant workers.
O D. They wanted to defend freedom of speech.

Answers

Answer: B.) They wanted to protect America from foreign influences

Explanation:

15 points!:
Which of the following is NOT one of the American's achievements in the Treaty of Paris?
A. British recognition of American independence
B. The securing of American fisherman's right to access fishing waters of the coast of Canada
C. All European countries had to give up any of their land in North America
D. Great Britain gave the Americans all territory between the Alleghany Mountains and the Mississippi River​

Answers

Answer:

I think B

Explanation:

Users can pay a fee to have which kind of software written to meet their needs?
Select one:
a. Custom
b. Free
c. Shared
d. Public-domain

Answers

Answer: Public-domain is the answer

Explanation: Shareware, freeware, and public domain are software categories defined by how programs may be distributed, copied, used, and modified.

the ten commandments are to christianity as the eightfold path is to

Answers

Answer:

Buddhism

Explanation:

The Buddhism religion practices the Eight-Fold path.

The invasion of which country brought Britain (Canada) into far?
A)Serbia
B)Bosnia
C)France
D)Belgium

Answers

The invasion of Serbia by Austria Hungary

Why has emirati cultural change over time?
Help pls

Answers

The UAE's cultural landscape has been affected by the entrance of other cultures and economic globalization. "Concerns over Emirati identity have developed in recent years as the impact of other cultures and languages has expanded with the growth of the expatriate community.

what challenges have confronted countries in africa south of the sahara since the end of the cold war

Answers

Answer:

 At the end of the Cold War, the main conflicts these countries were facing were political instability, religious conflicts, civil conflicts, HIV & AIDS, and women in leadership positions were becoming more common.

Explanation:

Political instability, Religious conflicts, Civil conflicts are the challenges faced by the countries in Africa south.

The Cold War was a serious conflicts that happened between U.S. and its allies and Soviet Union and its allies before the end of World War II.

However, the U.S. and Soviet Union never fought each other directly.

The challenges faced by the countries in Africa south since the end of the Cold War includes

political instabilityreligious conflictscivil conflictswomen in leadership positions etc.

Read more about Cold War

brainly.com/question/10134112

What are steps in race for the presidency? How long does this process take?​

Answers

Primaries and caucuses people with similar ideas usually belong in the same political party. National conventions like democratic,republicans,hold national conventions

rior areas of
the climate
rt trees kr
ldcats, wil
ound in th
topping
Mediterrar
literranear
bts, and gr
nifers, ar
o
sem:
pl
8. Air pollution is also a serious problem where?
A. West africa Bonomo bem made: 3 915
B. Eastern Mediterranean
C. Egypt
D. Russia

Answers

Answer:

Mediterrar literranear bts, and gr nifers, ar o sem: pl 8. Air pollution is also a serious problem where? A. West africa Bonomo bem made: 3 ...

Explanation:

..

Which of the following contributed the most to the rise to power of totalitarian
leaders in Italy and Germany in the 1930s?
A.) certainty about the future
B.) stability in the aftermath of war
C.) serious economic problems
D.) abundant natural resources

Answers

Answer:

B

Explanation:

Other Questions
Kindly help out with this question! AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA y=6x-17 -12x+2y = -34 ?? While emptying the autoclave, the medical assistant notices that the wrapped instruments are damp. The medical assistant should Which phrase best describes what a soil horizon is? A the bottom layer of a soil profile B each layer of a soil profile C the place where two soil profiles meetD the place where a soil profile meets bedrock A wave has wavelength of 10 m and a speed of 340 m/s. What is the frequency of the wave?I need the Formula,Known,Substitute & Solve Answer with Units Welcome to Gboard clipboard, any text you copy will be saved here. help pls im having trouble understanding this question As world population grows and the ocean is called on to provide more and more resources, what can people do to be sure the resources are used sustainably? Developing a shared understanding through communication is complex because __________________.a.everyone interprets the world differentlyc.learning to communicate well is too difficultb.no one understands enough words to communicate effectivelyd.all of the abovePlease select the best answer from the choices providedABCD (Place in chronological order) PLEASE HELPLondon Company establishes JamestownMayflower CompactUS ConstitutionDeclaration of IndependenceWar of 18121st Continental CongressColumbus's first voyage to the IndiesLouisiana PurchaseRevolutionary War beginsWashington becomes 1st US President I NEED MORE HELP PLZZ a uniform thin rod of length l and mass m is allowed to rotate on a frictionless pin passing through one end. The rod is released from rest in the horizontal position. a.) What is the speed of the center of gravity when the rod reaches its lowest position? b.) What is the tangential speed of the lowest point of the rod when the rod reaches its lowest position? Which examples of propaganda are found in this passage? Select two options.Snowball is used as a scapegoat.Napoleon talks to the animals through Squealer.Squealer targets his message to emphasize plain folks.Squealer uses glittering generalities to describe Napoleons tactics.Napoleon uses name-calling to differentiate the pigs from the other animals. who were dev and ashamvav At a hospital, 56 percent of the babies born are not girls. Of the baby girls born, 12 percent are premature. What is the probability of a premature baby girl being born at this hospital? round to the nearest percent. Why did Marshall describe the economy in Europe over the past 10 years as "highlyabnormal"? which organelle modifies sorts and packages proteins I need some essay ideas for: "Describe the biggest challenge youve faced and overcome as a student OR Describe a time when you failed and persevered through the situation?"What can I write about? DNA contains all the traits that we inherit from our parents.True or false