In the sixth grade 3/7 of the students are boys and 5/8 of these boys are in Miss Jones class what fraction of the entire six grade class are the boys in Miss Jones class

Answers

Answer 1

Answer:

Think of the entire population of 6th graders here. 3/7 are boys and 4/7 are girls. 5/8 of these boys are in Ms. Jones' class; that fraction would be (5/8)(3/7), or 15/56. This 15/56 represents the fraction of the entire sixth grade class who are in Ms. Jones' class.


Related Questions

Solve 6x+8+7x-9=90 this is pretty hard tbh

Answers

Answer:

x=7

Step-by-step explanation:

6x+8+7x-9=90

13x+8-9=90

13x-1=90

add 1 to both sides

= 13x=91

divide both sides by 13

= x=7

if the jumping price is 18.50 per hour and the fee for socks is 3.25 what is the total cost in dollars for the 5 friends to jump for 1 hour the total cost is​

Answers

Answer: $108.75

Step-by-step explanation: 18.50+3.25=21.75 Per Person 21.75x5=108.75

The length of time of the school field day was decreased
from 100 minutes to 80 minutes. What is the percent
decrease in length of time of the school field day?

Answers

18% because take the first digits of each number and put them together lol

tried taking a photo and fail but any ways 16 - 2t = 5t + 9

Answers

ooo among us!! i was just looking at some fan art of it.. also love your pfp! who is it? if u don't mind me asking I would love to watch the show if it.. or at least know the person :D

anyway.. happy day/night ~

t = 1 (I hope this helps)
16-2t=5t+9
+2t +2t
16=7t+9
-9 -9

7=7t

(Divide both sides by 7)

t=1


Xander ordered a pizza with 8 equal slices as shown in the image below.
Assi
Hapo
Thes
Ito see all
ared
If Xander ate 6 slices of pizza, what percentage of the pizza did he eat?

Answers

If he ate 6 slices he wouldve eaten 75% of the pizza

help asap!!! it’s due in 20 minutes .

Answers

Answer:

ab

Step-by-step explanation:

PLEASE HURRY!!
Mildred classifies the following system of equations.

y = 4x + 3

y = 6x + 1

Select Correct or Not correct for each statement.

Statements:
The system is consistent because the slopes and the y-intercepts are different.
The system is independent because the slopes and the y-intercepts are different.

Answers

The first statement is correct and the second statement is not correct as it is derived from the first statement,

We are given two equations;

y = 4x + 3

y = 6x + 1

From the equation of line in slope intercept form, the formula is;

y = mx + c

where;

m is slope

c is y intercept.

Thus, in the 2 equations given, we can see that the slopes and y-intercepts are different

Now, when two equations have different slopes and different slopes, the system is said to have only one solution and can be said to be consistent.

Now, a system is only said to be independent if it is consistent and has exactly one solution.

This means independency of an equation depends on if it is consistent and has exactly one solution.

Thus, in conclusion, the first statement is correct and the second one is not correct as it is derived from the first statement,

Read more at;  https://brainly.com/question/19282045

Answer:

first correct second wrong

Step-by-step explanation:

what are the integers of 58

Answers

Answer:

{1,2,29,58}

Step-by-step explanation:

As the only factors of 58 are {1,2,29,58} , there are no two consecutive integers whose product is 58

Answer:

1,2,29.58

Step-by-step explanation:

:)

What is an equation of the line that passes through the point (-1, -3) and is perpendicular to the line x –2y = 14?​

Answers

Make equation: y = mx + b
x = 2y + 14
2y = x - 14
y = 1/2x - 7
Perpendicular: opposite sign and reciprocal slope
y = -2x + b
-3 = -2(-1) + b, b = -5
Equation: y = -2x - 5

The equation of the line passing through the point ( -1,-3) will be y = -2x - 5.

What is an equation of the line?

An equation of the line is defined as a linear equation having a degree of one. The equation of the line contains two variables x and y. And the third parameter is the slope of the line which represents the elevation of the line.

The general form of the equation of the line:-

y = mx + c

Given that the line passes through the point (-1, -3) and is perpendicular to the line x –2y = 14. the equation of the line will be calculated as:-

Make equation: y = mx + b

x = 2y + 14

2y = x - 14

y = 1/2x - 7

For a line perpendicular, the sign will be opposite and the slope will be reciprocal.

y = -2x + b

-3 = -2(-1) + b, b = -5

The equation of the line will be written as below:-

y = -2x - 5

Therefore, the equation of the line passing through the point ( -1,-3) will be y = -2x - 5.

To know more about an equation of the line follow

https://brainly.com/question/2141803

#SPJ2

A graphic novel prints 12 issues per year, and a comic book prints 10 issues per year. The total number
of pages in all the issues of the graphic novel for one year is 32 more than the total number of pages in
all the issues of the comic book for one year. Each issue of the graphic novel has 18 fewer pages than
each issue of the comic book. Which system of equations can be used to find g, the number of pages in
each issue of the graphic novel, and c, the number of pages in each issue of the comic book?

Answers

Answer:

answer is che choi

Step-by-step explanation: wow ur in high school mathematics? i have this same question in middle school algrbra HHAHA

How much are these coins worth??

Answers

Answer:

quarters are worth 25 cents

dimes are worth 10 cents

nickels are worth 5 cents

pennies are worth 1 cent

that is a total of $1.48 there

Step-by-step explanation:

t-6= -12
8

I NEED HELP ASAP

Answers

Answer:

Step-by-step explanation:

t

=

122

Will mark brainliest

Answers

Answer: Desmos will answer this question for you :) just input the functions

Step-by-step explanation:

Ayana has $20.95 in quarters and dimes. If she has 103 coins in all, find the number of quarters and dimes. PLEASE HELP AND SHOW WORK! ​

Answers

There are 83 quarters and 2 dimes. This is correct because I know 4 quarters make a dollar I multiplied 4 by 20 giving me 80. After that I know that I can make 95 cents with 3 quarters and 2 dimes making my final answer being, 83 quarters and 2 dimes= $20.95

Given points A(9,3), B(-3,6), and C(-7,3). Which statement describe the vectors that include these points? Check all that apply

Answers

B C D F are the right answers

Step-by-step explanation:

Answer   c,e

Step-by-step explanation: i just did it

Which expression is equivalent to 100,000

Answers

Answer:

the answer is 10 with a little 4 on the top right corner

Step-by-step explanation:

count your zeros

if the difference of simple interest on a certain amount of money for 4%for five years and 5%for 4 years is. Rs. 28. find the sum​

Answers

Answer:

96000

Step-by-step explanation:

N=4years

R=4 %

We have S.I.=

100

PNR

=

100

P×4×4

=

100

16P

=0.16P

And on interest being compounded for 3 years and R=5 %, Amount=P(1+

100

R

)

N

=P(1+

100

5

)

3

=P×(1.05

3

)=1.157625P

So, C.I.=A−P=1.157625P−P=0.157625P

Given, S.I.−C.I=Rs228

=>0.16P−0.157625P=Rs228

=>0.002375P=Rs228

=>P=Rs96,000

A function f(x) is defined to be f(x) = X^2 -3x +21 .

What are the solutions to the equation f(x)=0?

Answers

Answer:

Step-by-step explanation:

(MARKING BRAINLIEST)Which of these is the most helpful first step for solving Frank's equation, 2x+28=40?
A. Multiply both sides by 2
B. Subtract 28 from both sides
C. Divide both sides by 2
D. add 28 to both sides

Answers

Answer: B. Subtract 28 from both sides
Explanation: You need to subtract first because the variable needs to be by itself.

What is the easiest way to solve negative fractions plus positive fractions?

Answers

Answer:

Step-by-step explanation:

and I'll explain why so when when we're

looking into combining fractions

positive negative fractions the main

important thing we need to make sure we

have is like denominators

all right common dinar common

denominator the easiest the easiest way

to find a common denominator is to

multiply the denominators right that's

the easiest way to go ahead and find one

just multiply three times eight which is

24 that's gonna give you your comments

and on there does that make sense so

make sense multiply the denominator but

that's not always going to be the least

common denominator so an easy way to

always check to find the least common

denominator is choose the largest

denominator which would be 8 and then

kind of list out the multiples so is and

sitting determine it does 3 divide into

any of those multiples before we get to

24 so just 3 to buy an 8 no so 8 is not

the least common denominator then we go

to 16 just 3 divided into 16 No

24 yes it does so actually end up 3

times 8 is gonna equal 24 and it's okay

lays knowing if you always want to

multiply your denominators you can

always do that but that just because

you're multiplying you're not always

gonna get the least common denominator

and the problem with that is you're

gonna have to simplify your fraction a

little bit more at the end all right but

it is also a way to always get a common

denominator so my lcd is 24 and what I

like you guys to do is always like write

that down so you can always kind of

remember it and basically when we have

an LCD of 24 what we want to be able to

do is say alright what do I need to

multiply now both of my denominators by

to get to 24 well to get 3 forget about

the negative sign per second for do get

3 we need to multiply by 8 right but

there's a problem if you have a fraction

and you only multiply the denominator by

it you've now changed the fraction think

about 1/2 if you have 1/2 and you

multiply the denominator by 3 you now

have 1/6 right is 1/6 equal to 1/2

no so we need to multiply the numerator

and the denominator by 8 think about

again 1/2 times 3 over 3 equals 3 over 6

is 3 over 6 equivalent to 1/2 yes so

when you're multiplying your fraction we

want to make sure we

keep equivalent fractions for 3/8 we

need to multiply by five over five and

then when I multiply fractions I just

simply multiply across numerator times

numerator denominator times denominator

therefore I get negative 8 over 24 plus

I don't know 3 right thank you I don't

know I was like off in my own world I

guess there you go

sorry so therefore now I have negative 8

24 plus 9 over 24 and now when we need

to add combined fractions we need to

combine fractions as long as they have

common denominators we just add or

subtract our numerators so just think

about negative you owe eight dollars you

have nine dollars in your pocket

therefore you're gonna have one dollar

left right and you keep the denominator

the same question okay letting it

internalize

why does math have to be so hard

Answers

I felt this, I’m currently failing even tho I’m trying but that could also be because my teacher doesn’t like me

Answer:

Math seems difficult because it takes time and energy. Many people don't experience sufficient time to "get" math lessons, and they fall behind as the teacher moves on. Many move on to study more complex concepts with a shaky foundation. We often end up with a weak structure that is doomed to collapse at some point.

Math is hard because it is a non-intuitive, non-natural activity. Math don't happen by chance only, it only happens with deliberate, focused work. For this you expend a lot of energy and cause a lot of mental strain, you put yourself on an uncomfortable condition for hours, days, sometimes weeks to solve a problem.

But some people love math, like me, because they study math more than others. If you study more and learn more about math, then you’ll start to feel more comfortable because you’ll be ahead of the class when your teacher teaches you something.

The most important thing is to keep trying and never give up.

Hope this helps! :)

What is the measure of ZRST?


Answers

Answer: 131

Step-by-step explanation: that one is good

What is the value of 3/8 x - 4.5 when x =0.4

Answers

-3.5625 is you use pemdas

???????????????????????????????

Answers

??????????????? ??????
the answer is A. 3z-1
because the terms are in order from least to greatest.

A bottling machine fills 100 bottles in 150 seconds. How many minutes does it take the same machine to fill 1000 bottles?

Answers

Answer:

you have to have to put pp in girls wee wee and go in out and out ahhewgvfhbjnhvvvaef jcfvgfg

Step-by-step explanation:

Tom will rent a car for the weekend. He can choose one of two plans. The first plan has an initial fee of and costs an additional per mile driven. The second plan has an initial fee of and costs an additional per mile driven. How many miles would Tom need to drive for the two plans to cost the same?

Answers

Complete question :

Tom will rent a car for the weekend. He can choose one of two plans. The first plan has an initial fee of $57.98 and costs an additional $0.14 per mile driven. The second plan has an initial fee of $53.98 and costs an additional $0.16 per mile driven. How many miles would Tom need to drive for the two plans to cost the same?

Answer:

200 miles

Step-by-step explanation:

Let miles driven = x

First option :

57.98 + 0.14x

Second option :

53.98 + 0.16x

First option = second option

57.98 + 0.14 = 53.98 + 0.16x

57.98 - 53.98 = 0.16x - 0.14x

4 = 0.02x

x = 200

200 miles

Jennifer drove to her aunt's house, which is 325 miles away. If it took her 5 hours and she drove at a constant rate, what was Jennifer's speed in miles per hour?

Answers

325 ÷5=65
So the answer is 65 miles per hour
To double check you multiply 65 and 5, which equals 325, so the answer is correct.

helpppppp for brainliest

Answers

Answer:

508 sheets /4 shelters = 127 sheets per shelter.

I'LL MARK BRAINLEST JUST PLS HELP ME

Answers

Answer:

B

Step-by-step explanation:

Answer:

30.96 mm²

Step-by-step explanation:

area of square: side×side

12×12= 144 mm²

area of circle: πr²

π×6²= 113.01 mm²

area of shaded region: 144-113.01 = 30.96 mm²

hope it helps!!!

what is 2/5 - 250.00

Answers

The answer is -249.6

Answer:

-249.6

Step-by-step explanation:

Convert 2/5 to 0.4. Then subtract 0.4 and 250 to get -249.6

Hope this helped! :)

Other Questions
Anyone know the answer to this? There are 32 Drama DVD's. The ratio of Drama DVD's to Mystery DVD's is8:5. How many Mystery DVD's are there? 1. A business records its net profits for the week by subtracting the operating costs from the revenue. The function P(x) = (140x) (30x + 1200) represents the profits for one week, where x is the number of products sold. Which statement is true?a) The slope of the function is 110, and it represents the change in net profit per product sold.b) The slope of the function is 140, and it represents the initial operating costs of the businessc) The slope of the function is 110, and it represents the initial operating costs of the business.d) The slope of the function is 140, and it represents the change in net profit per product sold. what would happen to new orleans lose if slavery was abolished Read this excerpt from a works cited page for an informative essay.Works CitedFerry, Christopher. Racial Change in Civil War America. New York: Sunspot Press, 2011. Print. Underground Railroad. World Book Online. 2012. Web. 20 December 2012. .Which best describes the two citations? Which statement about the food chain is correct?A.The Harpy Eagle obtains chemical energy from the Sun.B.The Red-eyed Tree Frog obtains chemical energy from the Squirrel Monkey.c. The Coconut Trees obtain light from the Sun and convert it into chemical energy.D. The Squirrel Monkey obtains chemical energy from the Grasshopper. 5. Briefly explain the first steps towards economic imperialism in China. how do i solve this? find the equation of the line that passes through the point (1,8) and is parallel to the line y=3x+6. write the equation using the slope-intercept form. -Democracy was introduced in Athens-The Romans created a representative democracy-the British implemented representative democracy-the United States has the longest running democratic republic in theworld.The list above describes the geographic concept of -a) cultural divergence b) spatial diffusionc) spatial assimilationd) human-environment interaction Transcribe the following DNA strand into mRNA and translate that strand into a polypeptidechain, identifying the codons, anticodons, and amino acid sequence.DNA: CGATACAATGGACCCGGTATGCGATATCC How can collaboration influence anartistic renaissance?I 5x-7=3 whats the answer The greater of two integers is 10 more than twice the smaller integer. The sum of the two integers is -8. Find the integers. An idea,theme,or image that begins and ends a text can be referred to as a New- Muhammad taught the belief that there is only one god and believed that the other Two Semitic religions (Judaism and Christianity) were ________.not relevant to current society.valid revelations from God but were distorted by man.not truly monotheistic religions.believed in the wrong God. What is one conclusion that can be synthesized from this selection?A) Students are usually hesitant to express their opinions to teachers. B) School administrators are out of touch with the needs of their students. C) Guidance counselors can offer helpful advice about a variety of life issues. D) Teachers are reluctant to listen to students' opinions about the books they teach. 2- some of your mates like Chinese cousin, don't they?Why we use some of at the first of the sentence!! Shane reads 16 pages in 8 minutes. a. How many pages does Shane read per minute, b. How many minutes does Shane spend reading each page Galaxy B moves away from galaxy A at 0.577 times the speed of light. Galaxy C moves away from galaxy B in the same direction at 0.731 times the speed of light. How fast does galaxy C recede from galaxy A?