In silkworms,yellow cocoon (B) is dominat over white cocoon(b). If the mom is BB and the dad is bb, what are the chances they have offspring with yellow cocoons?

Answers

Answer 1

Answer:

100 %

Explanation:

Dominance is a genetic phenomenon where a gene variant or allele masks the effects of another allele (of the same gene) in heterozygous individuals. This last gene variant is referred to as the recessive allele. In this case, the silkworm mother can produce only one type of gamete carrying the dominant gene (B) form, while the silkworm father can produce only one type of gamete carrying the recessive gene (b) form. In consequence, from this cross, all offspring (100 %) will be heterozygous (Bb) and therefore they will express the dominant trait (i.e., yellow cocoon).


Related Questions

Second part:
17. What are gremline cells

18. How is mitosis different from meiosis?

Answers

Answer:

just see explainnation

Explanation:

what is gremline cells tell me and the teach me what is mitisis ok and then teach me meiosis ok the I will tell u answer of thes question

FILL IN THE BLANK!!!

genotype is the____pair of alleles (TT)____of an organism. And phenotype is the____apperence__of an organism​

Answers

Answer:

THIS IS IT

Explanation:

The genetic makeup of an organism (ex: TT). Phenotype, The physical ... from each parent). This pair of alleles is called a genotype and determines the organism's appearance, or phenotype. ... A Punnett square can be used to predict genotype and phenotypes of offspring from genetic crosses

What is the relationship between a protein, the cell, and DNA?
A. DNA is produced by a protein which is produced in the cell
B. Protein is composed of DNA which is produced in the cell
C. A cell is composed of DNA and protein
D. DNA controls the production of protein in the cell

Answers

Answer:

B. Protein is composed of DNA which is produced in the cell

Explanation:

Answer:

B. Protein is composed of DNA which is produced in the cell

Explanation:

The option (B) is the relationship between a protein, the cell, and DNA.

How will water volume, incline gradient, and temperature affect the energy
of a stream?

Answers

Answer: Water Volume: The volume of water(discharge) in a stream affects the energy(velocity) of that stream. As the volume of the water in the stream increases, the velocity increases. ... Incline gradient: The incline gradient is also known as the slope of the stream.

Explanation:

A helpful shortcut our brain makes in scene recognition is to assume that lighting comes from:

Answers

Answer: A. Above

Explanation:

Scientists believe that in order for humans to see things, the brain has to make certain assumptions which are done based on previous scenes that it has interpreted before because the eyes do not provide it with complete data. .

One of those assumptions is that light comes from above which is why the shape of a picture can change depending on the lighting in it.

1. Describe the shape of a DNA molecule.​

Answers

Answer:

Explanation:

If you think of the double helix structure as a ladder, the phosphate and sugar molecules would be the sides, while the bases would be the rungs.

Answer:If you think of the double helix structure as a ladder, the phosphate and sugar molecules would be the sides, while the bases would be the rungs.

Which sediment would have the slowest rate of deposition?
a round sediment
O a very large sediment
an irregularly shaped sediment
O a high-density sediment

Answers

Answer:

C. An irregularly shaped sediment

Explanation:

Deposition is the settling of sediments within respective basins of deposition.

Irregularly shaped sediments are the slowest to settle within a basin this is due to the frictional resistance of their surface.

As these particles hits the water, the liquid drag on their edges is very great and prevents swift settling.

A. A high density sediment and a large sediment will have a fast settling time.

B. Rounded sediments will impose no friction on the water and they fall through the liquid very fast.

Answer:

the answer is C. an irregulary shaped sediment

Explanation:

hope this helps!

Give an example of how structure and function are related on the cellular level.

Answers

Answer:

Function and structure are related, because of a certain structure a living thing make contain makes the object function the way it does. ... The relationship of a structure and function is the structuring levels from molecules to organism ensure successful functioning in all living organism and living system

Explanation:

Use the following questions to write your conclusion to your lab report.

What did you learn from doing this lab? (Did the volcano have an effect on the ability of a predator to catch their prey? What might this mean for future generations? Include numbers from your data tables to show these changes.)



How could you make the lab better?

Answers

Answer:

WHat??

Explanation:

Methylmercury biomagnifies in an ecosystem, meaning its concentration __________ as it moves through each higher trophic level.
A. equalizes
B.does not change
C. decreases
D. increases

Answers

Answer:

D - Methyl Mercury Increases

Explanation:

The word Biomagnification has a simple explanation:

To magnify is to make bigger, meaning that the substance in question is becoming more abundant.

The "bio" part of this word is referring to the fact that it is a biological substance you are dealing with.

Question: "Methylmercury biomagnifies in an ecosystem, meaning its concentration __________ as it moves through each higher trophic level."

Answer: "The concentration of the methylmercury increases as it moves through each higher trophic level. Hence, the methylmercury biomagnifies in the ecosystem. So, based on the options given prior to the question above, Option D) increases would be your best bet."

Can anyone give me two mineral feed ingredients for poultry birds ?! 20 points for it

Answers

Answer: aragonite oyster shell crab meal

Explanation: aragonite is for calcium and oyster shell also has calcium. Crab meal provides small amounts of protein and minerals

Please Help!
The middle of an mRNA molecule contains the nucleotide sequence shown here. Much more of the mRNA is translated. Assume that the sequence is translated from left to right.

AUUUAACUGUUCUGUCUAGAG


1.

Construct an Explanation Based only on the information provided, why could the mRNA section be translated into three different sets of amino acids, instead of just one set?

2.

Use Models Use the genetic code to translate the sequence into each of the three possible sets of amino acids.

3.

Draw Conclusions Which of the three sets of amino acids is the most likely to be included in the polypeptide? Explain your reasoning.

Answers

Answer:

TAA ATT GAC AAG ACA GAT CTC

1. The more bases there are per codon the more information you can code for. There are only 22 different amino acids, in consequence we need minimum 3 bases per codon.

2. codon

three nucleotides—called a triplet or codon—codes for one particular amino acid in the protein. The nucleotide sequence in the DNA is first transcribed into a molecule of messenger RNA (ribonucleic acid).

3. Known as alpha helices and beta sheets, these stable folding patterns make up the secondary structure of a protein. Most proteins contain multiple helices and sheets, in addition to other less common patterns (Figure 2). The ensemble of formations and folds in a single linear chain of amino acids — sometimes called a polypeptide — constitutes the tertiary structure of a protein. Finally, the quaternary structure of a protein refers to those macromolecules with multiple polypeptide chains or subunits.

OKAY I THINK EVERYTHING IS RIGHT BUT SORRY IF WRONG ;)

The mRNA sequence could be translated into three different sets of amino acids because of the degeneracy of the genetic code.
Using the genetic code to translate the mRNA sequence, we get the following three possible sets of amino acids:Set 1: isoleucine-phenylalanine-leucine-serine-valine-arginineSet 2: isoleucine-asparagine-valine-leucine-serine-arginineSet 3: isoleucine-asparagine-leucine-serine-valine-arginine

3. It is not possible to determine which of the three sets of amino acids is the most likely to be included in the polypeptide based solely on the information provided.

What is a nucleotide sequence?

A nucleotide sequence is the order of nucleotides (the building blocks of nucleic acids) in a DNA or RNA molecule.

Nucleotides are composed of a sugar, a phosphate group, and a nitrogenous base, which can be adenine (A), cytosine (C), guanine (G), thymine (T) (in DNA) or uracil (U) (in RNA). The specific order of these nucleotides in a DNA or RNA molecule determines the genetic information that the molecule carries.

Learn more about nucleotide sequence, here:

https://brainly.com/question/30299889

#SPJ6

can someone pleasee answer thiiisss pleasee

Answers

Answer:

Hi how are you doing today Jasmine

Make a list of the energy carriers involved in the Krebs cycle. Include their names before and after they accept the electrons.
Thank you!

Answers

Answer:

12

Explanation:

True Or False urgebt

Answers

Answer:

The answer is true

Explanation:

true

Scientists are studying the bacteria living in termites because they want to
genetically engineer......

Bacteria that can resist pests on crops.

Bacteria that can create ethanol from left over plant material.

Bacteria that create a vaccine.

Bacteria that create antibiotics.

Answers

Answer:

B. this is why Those bacteria may contain genes that will help convert plant material to ethanol. so B. and if it's wrong then sorry but if it's right u welcome ;)

Bacteria that can resist pests on crops.

The following information should be considered:

In the case when the scientist should studying the bacteria that lived the termites so it should resisted the pest on the crops. These kind of bacterias should comprise of genes that would helps transform plant material to ethanol.

Learn more: https://brainly.com/question/5303391?referrer=searchResults

I NEED HELP ITS DUE RIGHT NOW PLEASE ( biology question !!! )

Answers

Answer:

A is the correct answer.

What is the meaning of life? (I’m Giving out 35 points)

Answers

Answer: do what makes you happy

Explanation:

Answer:

to live life to the fullest and appreciate the little things that make you happy and follow your dreams and just accept all the bad days because life isn't perfect and neither is everyone

List and explain the 3 paths natural selection can take.

Answers

Answer:

1. Stabilizing Selection  

2. Directional Selection  

3. Disruptive Selection  

Explanation:

Stabilizing Selection  

This type of natural selection occurs when there are selective pressures working against two extremes of a trait and therefore the intermediate or “middle” trait is selected for. If we look at a distribution of traits in the population, it is noticeable that a standard distribution is followed:

Example:  For a plant, the plants that are very tall are exposed to more wind and are at risk of being blown over. The plants that are very short fail to get enough sunlight to prosper. Therefore, the plants that are a middle height between the two get both enough sunlight and protection from the wind.

Directional Selection  

This type of natural selection occurs when selective pressures are working in favour of one extreme of a trait. Therefore when looking at a distribution of traits in a population, a graph tends to lean more to one side:

Example: Giraffes with the longest necks are able to reach more leaves to each. Selective pressures will work in the advantage of the longer neck giraffes and therefore the distribution of the trait within the population will shift towards the longer neck trait.

Disruptive Selection  

This type of natural selection occurs when selective pressures are working in favour of the two extremes and against the intermediate trait. This type of selection is not as common. When looking at a trait distribution, there are two higher peaks on both ends with a minimum in the middle as such:

Example: An area that has black, white and grey bunnies contains both black and white rocks. Both the traits for white and black will be favored by natural selection since they both prove useful for camouflage. The intermediate trait of grey does not prove as useful and therefore selective pressures act against the trait.

Which of the following substances is not a fossil fuel?
a.
coal
c.
gas
b.
oil
d.
wood

Answers

Answer:

D, wood.

Explanation:

Wood is not a fossil fuel.

Hope this helps!

Which of the following is true about moss sporophytes?
a. Sporophytes perform photosynthesis. C. Sporophyttes contain a single spore.
b. Sporophytes depend on the gametophyte for d. Sporophytes are very large.
nutrients.

Answers

Answer: sporophytes photosynthesise, particularly when immature, but depend on gametophytes for at least 50% of nutrient requirements

Explanation: In mosses, the gametophyte generation is the dominant generation unlike in higher plants. The diploid sporophyte generation produces several spores per capsule.

Answer:

c

Explanation:

whitch of the following nutrients is primarily used for building and repairing of demaged cells and tissues

Answers

Answer: protein ..i hope this helped!

Explanation: protein is a nutrient used to make and repair our body cells like blood and muscle cells.

Answer:

Explanation:

he is correct

I was wondering if my answer was right ?

Answers

Explanation:

yes the 4th one is right so yes the one you have is right

Secondary consumers are organisms that eat primary consumers for energy. Primary consumers are always herbivores, or organisms that only eat autotrophic plants. However, secondary consumers can either be carnivores or omnivores.

with that said, yes! your answer is correct. there are other secondary consumers in the other options, but the answer you selected it the only one with everything species listed is a secondary consumer

If an organism's diploid number is 14. its haploid number is...​

Answers

Answer:

If an organism's diploid number is 14. its haploid number is...

Explanation:

Answer:

7

Explanation:

14 ÷ 2

a haploid is half the diploid

so the answer is 7

if the atmosphere is 21% oxygen and the cornea contains 15% oxygen, which direction will more of the oxygen molecules travel: into the cornea or out of the cornea

Answers

According to simple diffusion. Molecules travel from high concentration to low. So it would be traveling into the cornea

Identify part A, B and C. What is the function of part B?

Answers

A-fallopian tubes
B-uterus
C-ovaries

The uterus is the place where the fetus develops

Where will you find permafrost? tall grass prairie savanna chaparral tundra

Answers

Answer:

Where Is Permafrost Found? About a quarter of the entire northern hemisphere is permafrost, where the ground is frozen year-round. It's widespread in the Arctic regions of Siberia, Canada, Greenland, and Alaska—where nearly 85 percent of the state sits atop a layer of permafrost.

Explanation:

hope this helps

Describe a DNA molecule and its shape

Answers

Answer:

DNA is a long molecule, made up of two strands twisted together to make a spiral known as a double helix.

The DNA molecule is shaped like a ladder that is twisted into a coiled configuration called a double helix. The nitrogen bases form the rungs of the ladder and are arranged in pairs, which are connected to each other by chemical bonds.

a person suffering from cold doesn't get proper test why​

Answers

Because of the blood being frozen and your body reacts differently

What causes the "plastic" nature of
the asthenosphere?
A. it is mostly water
B. it only found under the ocean
C. constant earthquake activity
D. heat from below

Answers

The heat from below causes the "plastic" nature of the asthenosphere. The correct option is D.

What is asthenosphere?

The asthenosphere is the upper mantle's mechanically sluggish and ductile region.

It is located beneath the lithosphere, somewhere around 80 and 200 kilometers underneath the surface, and can extend up to 700 kilometers. However, the asthenosphere's lower boundary is not well defined.

Semi-plastic rock makes up the Asthenosphere. Because of Lithosphere has a lower density, it resides on top of the Asthenosphere, much like an iceberg or a block of wood does on water.

The lower mantle beneath the Asthenosphere is stiffer and less plastic. The outer core is located beneath the Mantle.

The "plastic" essence of the asthenosphere is caused by heat from below.

Thus, the correct option is D.

For more details regarding asthenosphere, visit:

https://brainly.com/question/7152935

#SPJ2

Other Questions
Understanding the Federal Justice SystemPlease choose the correct answer.Which aspect of the federal judiciaryis specifically established in theConstitution?O The three-tiered structure of thefederal court systemO The Supreme Court's role as thehighest court in the landO The number of justices servingon the Supreme CourtThe number of judges in theentire federal court system Which phrase best describes an event, "historical context".A.The total number of people it affected B. The unfair interpretations people have made about it C. The different views people have told about it D. The social or Political setting in which it occurred How does Ryan giving Gregory the name "Teacher Tamer"contribute to the conclusion of the story? Whoever answer this question with explanation gets marked the brainiest 23-World Hist/Culture/ Geog-3 (Daily Question) In your opinion, what is the biggest challenge in problem solving and conflict resolution and why? 6th grade science!!!!!!!!!! What are 5 ways that Canadaslandforms affect population? HEY CAN ANYONE WRITE A SENTENCE USING GROOVE IN UR OWN WORDS!!! Language is a definingfeature ofA. economics.B. governments.C. culture. 6 + 2x + 4 = 14ill give brainliest HELLLLPPPPPPPP!!!! The photo below is being enlarged to form a 24- by 30-inch print. What is the scale factor being used to enlarge it? 5 ia Andrew walked 24 laps during a walkathon to raise money for his school's art department. Each lap was 1 4 of a mile, and Andrew's dad donated $5.25 for every mile that Andrew walked. How much money did Andrew's dad donate? $ PLEASE HELP ON READ THEORY ASSIGNMENT!!!!!!!!!! Una fbrica de bolgrafos fabrica sus propios productos en tres colores distintos. 25 de su fabricacin son bolgrafos azules, 13 son bolgrafos negros y el resto son bolgrafos rojos. a.- Qu fraccin de bolgrafos son bolgrafos rojos? b.- Si en total en un da se han fabricado 2250 bolgrafos Cuntos se han fabricado de cada color? Which feature is one of the defining features of a hurricane?O funnel cloudO high pressureO low pressureO rapid snowfall PLEASE HELP ASAP I need major help, please. Helps me will get 44 points please I am willing to give this many away because I really need this help please don't just put something random for points.You are a high school senior with a part-time job at a retail store. Your employer pays you $9.75 per hour. Last week, you worked a total of 30 hours.The following payroll deductions were taken from your gross pay:Federal income tax (withholding) at 10%Social Security tax at 6.2%Medicare tax at 1.45%Use the check stub below to help you think through the problem.check stubThe amount for GROSS EARNINGS for this pay period was $ please help me asap!!! Equivalent units for the molding department totaled 18,600 during January for conversion costs. Fifteen thousand units were transferred out to the finishing department. If the items remaining in ending inventory are 40% complete as to conversion costs and 80% complete as to materials, how many physical units are in ending inventory? All of these statements from the passage give evidence that the speaker-repeated a grade in high school EXCEPTA)Counselors were shown that I didn't have to graduatewith my class, like they so earnestly wished for meto.I showed the teachers who said, "Conrad, yourB) sophomore year will be two of the best years of yourlife, son."Then, maybe I would have gone to those PhysicalScience study halls. Maybe I would have actuallydone my homework in Mr. Pugnacious' class.Just because he only took the requisite twelve yearsto make it through school and graduate from hisalma mater, and I took slightly longer, that doesn'tmake me a loser.D)