If you have a viral infection, why should you cover your mouth when you sneeze? * To prevent other people from breathing in the viruses you expel To prevent viruses from infecting cells in your nose and mouth To keep as many viruses as possible in your own body To get all of the cold viruses out of your body and onto your skin.

Answers

Answer 1

Answer:

To prevent other people from breathing in the viruses you expel

Explanation:

CORRECT


Related Questions

compare the chemical equations for photosynthesis and cellular respiration explain how the two processes are interrelated

Answers

Answer: Photosynthesis makes the glucose that is used in cellular respiration to make ATP. The glucose is then turned back into carbon dioxide, which is used in photosynthesis. While water is broken down to form oxygen during photosynthesis, in cellular respiration oxygen is combined with hydrogen to form water

Explanation:

What is a society that is able to survive and function over a specified time?​

Answers

Answer:because time and society are different

Explanation:

Explain how diffusion and osmosis are related to the symptoms of cystic fibrosis

Answers

Answer:

Answer D

Explanation:

just took the test.

Someone smart PLS HELP!!!!!!!!!!!!! Uranium-235 is a popular choice of fuel for nuclear reactors. But U-235 doesn't always fission the same way. Below are three ways it can split. Complete the nuclear equations so they balance.
fill in the blank line(s) pls pls pls pls pls pls help!!!!!!!

Answers

I’m 90% this is right

Sorry if I’m wrong

Why do dead zones lack the oxygen fish and other aquatic animals need to survive?

Answers

Answer:

Because most organisms need oxygen to live, few organisms can survive in hypoxic conditions. That is why these areas are called dead zones. Dead zones occur because of a process called eutrophication, which happens when a body of water gets too many nutrients, such as phosphorus and nitrogen.

Explanation:

Use chromosomes 11 and 17 to answer the following questions. Chromosome Map Chromosome 17 is made of over million base pairs. Approximately how many genes are found on chromosome 17? List the genetic disorders found on chromosome 17. What do you know about any of those disorders?

Answers

Answer:

Hello!

Chromosome 17 is made of over 80 million base pairs.

Approximately how many genes are found on chromosome 17? 1600

Explanation:

Chromosome 17 is made up of more than 80 million base pairs. Approximately, 1600 genes are found on chromosome 17. The genetic disorders found on chromosome 17 are as follows:

Breast cancer.Neurofibromatosis.DNA damage response in individuals.Scoliosis.Congenital heart anomalies.

What are Chromosomes?

Chromosomes may be defined as thin, thread-like structures that may appear in the nucleus of the cell during the process of cell division. These structures may contain DNA, RNA, histones, and non-histone proteins. Chromosomes may be discovered by E. Strasburger in 1875.

Human chromosome 17 is implicated in a wide range of human genetic diseases. It is home to genes involved in many genetic disorders that may affect the physiology of an individual. They are very severe to organisms.

Mosaic trisomy 17 is a rare chromosomal anomaly syndrome, with a highly variable clinical presentation, mostly characterized by growth delay, intellectual disability, body asymmetry with leg length differentiation, scoliosis, and congenital heart anomalies.

To learn more about Genes and chromosomes, refer to the link:

https://brainly.com/question/29393001

#SPJ2

Plant cells are classified as

pluripotent
omnipotent
multipotent
totipotent

Answers

Answer:

pluripotent i think sorry if I'm wrong

BRAINLIEST:
in which month is a hurricane most likely to occur: October or December? explain

Answers

Answer:

October

Explanation:

October is one of the hurricane season months

Transcribe the following DNA strand into mRNA and translate that strand into a polypeptide
chain, identifying the codons, anticodons, and amino acid sequence.
DNA: CGATACAATGGACCCGGTATGCGATATCC

Answers

I don’t feel like answering all that but....
C=G G=C T=A A=U
C=G A=T dont know the rest have a gcodocododd dday

A 100 kg box is initially at rest on a level surface. One 10 N force acts on the box , directed toward the right. A second 10 N force acts simultaneously on the box , directed toward the left , as shown.

Answers

The box would stay at rest where it lies since the same amount of force is pulling it in opposite directions :)

Since 10 N forces are acting from both sides, these are balanced forces and the box will not move because balanced forces are acting on it. So the correct option is D.

What are balanced forces?

Forces that are equal in magnitude and opposing in direction are said to be balanced forces. Equilibrium is seen as a condition of balanced forces. There is no shift in direction when the forces are in balance.

Balanced combined forces have always been equal to zero. These are vectors for merging. Balance forces cannot alter an object's momentum or direction.

An item is kept traveling at a constant speed by a balanced force. In it, Newton's First Law of Motion is explained. A good illustration of a balanced force is a book on the table. The normal force (support force) of the table balances out the weight of the book. The two forces are exactly equal and opposed to one another.

While forces that are balanced can keep an item at rest or move at a steady speed, unequal forces can cause things to accelerate.

Therefore the correct option is D.

Read more about balanced forces, here

https://brainly.com/question/19127263

#SPJ5

In a chemical analysis of a sample of animal tissue, which element would most likely be found in the smallest quantity?

Answers

Answer:

Iodine

Explanation:

Iodine is needed by animals because the body's metabolic rate is controlled by the action of an iodine hormone, called thyroxine, which is secreted by the thyroid gland in the neck.

If the animal fails to supply enough iodine through food to be able to make a normal amount of this compound, then the thyroid gland enlarges or expands trying to create enough, resulting in a common type of goiter.

Please explain what osmosis is?

Answers

movement of a solvent (such as water) through a semipermeable membrane (as of a living cell) into a solution of higher solute concentration that tends to equalize the concentrations of solute on the two sides of the membrane.

(hope this helped)

Answer:

osmosis is a special type of diffusion that is the movement of WATER particles from an area of high concentration to and area of low concentration across a semi-permeable membrane

Explanation:

Bone is not a solid matter.
OA
True
O B. False

Answers

Answer:

FALSE

Explanation:

commen sense

Hello,

The answer is True.

Further explaining:

Bones are actually hollow tubes, if they were solid it would be a lot heavier. A adult usually has 206 bones which are hollow.
Hope this helps!
Brainliest?

Which of the following processes begins when a star enters the main sequence?
a


Nuclear fission
b


Nuclear fusion
c


Condensation of a nebula
d


Appearance of a supernova

Answers

Answer:

i believe it is B: Nuclear Fusion

Explanation:

Answer:

C. Nuclear Fusion

Explanation:

I am 1000000000% sure this is correctamundo, stay cool, and have a great day!

What is the electrical charge of the nucleus of an atom that has 11 protons , 12 neutrons , and 11 electrons ?

Answers

Answer:

The 11 positive protons cancel out the 11 negative electrons, and the overall charge of the atom is zero. So it neutral

Explanation:

I hope this helps!!

The nucleus of an atom has only protons and neutrons. Since the neutrons are neutral, the charge on the nucleus, in this case, would be +11.

What is the atomic charge?

The difference between the number of electrons and protons in an atom is defined as the charge on that particular atom. An atom has three sub-atomic components. These are electrons, protons and neutrons.

The electrons are negatively charged, the protons are positively charged and the neutrons are neutral.

Because the neutrons are neutral, the increase or decrease in the number of electrons or protons affects the charge on an atom. If the number of protons is higher, the atom will be positively charged. If the number of electrons is higher, the atom will be negatively charged.

The protons and neutrons are present in the nucleus of an atom and the electrons are present in atomic shells.

Therefore, in a nucleus with 11 protons, and 12 neutrons, the charge will be +11

Read more about atomic charge, here https://brainly.com/question/5308494

#SPJ6

The air in the thermosphere is composed of atoms of _____ that are very far apart from each other.

Answers

Answer:

Explanation:

In the upper thermosphere, atomic oxygen (O), atomic nitrogen (N), and helium (He) are the main components of air.

Energetic ultraviolet and X-ray photons from the Sun also break apart molecules in the thermosphere. In the upper thermosphere, atomic oxygen (O), atomic nitrogen (N), and helium (He) are the main components of air there ya go son

Describe some of the properties of water and explain how the structure of water is responsible for these properties.

Answers

Answer:

The main properties of water are its polarity, cohesion, adhesion, surface tension, high specific heat, and evaporative cooling. A water molecule is slightly charged on both ends. This is because oxygen is more electronegative than hydrogen. ... The stream of water bends due to the polarity of water molecules.

Explanation:

Chemicals and proteins in the cell read the DNA ___________ for building that make cells, tissue and organs.
(A.Instructions
(B.Genes
(C.Recipe
(D. Life manual

Answers

You answer will be B!! Good luckkk!

Genes of DNA can be read by chemicals and proteins for building that can make cells, tissue, and organs. Therefore, option "B" is correct.

What are genes?

Genes are composed of  DNA which is the genetic material. Gene is the functional unit of heredity. Chromosomes are comprised of multiple genes. Genes code for a particular trait. More than one gene can code for a particular trait.

The function of DNA and RNA is controlled by genes. There are more than 3000 genes present. Mutation can occur in genes. Deletion and insertion are some types of mutation genes. Transposomes are called jumping genes. Sickle cell anemia and cystic fibrosis are some examples of gene mutations.

Genes code for the traits such as the color of eyes, height quality of hair, and more.

Learn more about genes, here:

https://brainly.com/question/31121266

#SPJ2

Peoples choices can sometimes have negative effects on their own health as well as the health of your well-being of others describe to these choices explain how they can impact the individual and others

Answers

Answer

a good environment could mean better people better love and kindness bad environment could mean problems in your future and/or daily life this can affect everybody and anybody

Explanation:

when benedicts solution is added to a sucrose solution and put into a boiling water-bath , no change in color is observed

state why no color change is observed

Answers

Answer:

b

Explanation:

Is the troposphere high or low and what is the temperature there only answer if you know it

Answers

Answer: High

Explanation:

The average temperature of the troposphere is 62°F (17°C), Pls give thanks because I got hack

What do the enzymes in excision repair systems do?

A destroy cancer cells
B cut off telomere sections
C replace dna damaged by chemicals
D replace rna primers with dna

Answers

B would be the answer I think

Which of the following does not contribute to erosion?
O Lava
Olce
O Wind
O Water

Answers

Lava..

got it right on edge 2020

People are more likely to seek treatment if they
A. are in a minority
B. live in a rural community
C. have medical insurance
D. have a diagnosis

Answers

Answer:

C. have medical insurance

Explanation:

People are more likely to seek treatment if they D. have a diagnosis as it helps in the treatment of disease.

The clinical diagnosis lets in a clinical expert chart a listing of clinical signs after which evaluate them to different data. A high-quality fitness final result is primarily based totally one scale of being alive and not using a long-time period results to death.

What is the diagnosis?

The act of spotting a disorder from its symptoms and symptoms and signs the realization this is reached following and trying out .The prognosis turned into pneumonia.

Thus it is well explained.

To learn more about the medical insurance refer to link :

https://brainly.com/question/1941778

Compare asexual and sexual reproduction. Place each statement into the correct box.

Answers

Answer:

Explanation:

asexual doesn't require a mate or another thing to reproduce. sexual requires another thing to reproduce like a male and female

Answer:

During asexual reproduction, the organism that is reproducing spits in two.

A sea anemone reproduces asexually.

During sexual reproduction, there are two organisms(male and female) that are part of the reproductive process.

Humans reproduce sexually.

Explanation:

what are the inputs and outputs of the reaction

Answers

Answer:

The inputs are carbon dioxide from the air and the ATP and NADPH produced by the light reactions. The cycle's output is an energy-rich sugar molecule. The Calvin cycle uses carbon from the carbon dioxide, energy from the ATP, and high-energy electrons and hydrogen ions from the NADPH.

Explanation:

The light reactions, which occur during photosynthesis, have specific inputs and outputs. The inputs of the light reactions include light energy and water. The outputs of the light reactions are ATP (adenosine triphosphate), NADPH (nicotinamide adenine dinucleotide phosphate), and molecular oxygen.

Light energy is absorbed by the chlorophyll pigments in the thylakoid membranes, while water molecules serve as a source of electrons for the photosynthetic electron transport chain.

ATP is a high-energy molecule that serves as the primary energy source for cellular processes. NADPH is a coenzyme that carries energized electrons and plays a role in the synthesis of carbohydrates during the subsequent dark reactions of photosynthesis. Molecular oxygen is a byproduct of light reactions and is released into the atmosphere as a waste product. Together, these outputs provide the energy and reduce the power needed for the synthesis of organic molecules during photosynthesis.

Therefore, the inputs of the light reactions include light energy and water. The outputs of the light reactions are ATP (adenosine triphosphate), NADPH (nicotinamide adenine dinucleotide phosphate), and molecular oxygen.

For more details regarding light reactions, visit:

https://brainly.com/question/13349357

#SPJ6

has anyone done this worksheet? i need help with it. thanks:)

Answers

I have done it I think
try scanning it with the google app with text and usually answer keys pop up good luck!

What Bacteria is put in yougurt ?

Answers

two species of bacteria called Lactobacillus bulgaricus and Streptococcus thermophilus.

Answer:

food bateria

Explanation:

Phenotypes are the
observable characteristics of an individual (ex:
curly hair)

or

genetic representation of a an individual (ex: Hh)

Answers

Answer:

phenotype are the observable characteristics of an individual (ex:curly hair)

Which of the following statements regarding prokaryotic and eukaryotic cells is true

Answers

Answer:

I would need the statements to answer that. however prokaryotic cells are plant cells and eukaryotic cells are animal cells

Answer:

They are typically smaller than eukaryotic cells. The DNA of a prokaryotic cell is contained in the nucleoid. There are several ways in which prokaryotic cells are different from eukaryotic cells. Firstly, they are generally smaller in size, their organelles are not membrane bound, and they have no nucleus. They, however, share commonalities with eukaryotic cells including the presence of a bilipid plasma membrane, presence of ribosomes and DNA.

Hope this helps, have a great day/night, and stay safe!

Other Questions
ughvjkbkmnlk,bh imn hbkvkjm, h jknmbjb Read the following excerpt from a news article:The air was muggy in the baseball stadium at Texas Tech University. Storm clouds were gathering in thewest.Which of the following questions is most likely answered in this excerpt?How did it happen?Who did it?When did it happen?Where did it happen? Cynthia says that the expression2(3x + 4) is equivalent to the expression6x + 8. Is Cynthia correct? Can anyone please help me with the last question Im struggling! 35,423 15 with a remainder Which statement BEST states what happens during mitotic anaphase? The chromosomes are duplicated. O Spindle fibers stretch across the cell. O Sister chromatids move to opposite sides of the cell. O Chromosomes and centrioles attach to the plasma membrane. PLZZZ HELP DUE IN 5mins answer correctly for BL Transcribe the strand of DNA CTA AGG TAG please help 30 points!!!!!!!!!!How did investigators identify the bomber?this has to do with the Murrah bombing in oklahoma city in 1995 A VIN led to a sketch, which was identified by a motel manager A Highway Patrol Officer followed him. A witness saw the bomber flee the scene, Video footage from a security camera caught the suspect's face! In which document would these points most likely be included the please show work 8) 3n+1 +8n2 8n 79. given the function: f(x) =3x-7, find f(-2) a.What is the primary mission of the Orbital Debris Observatory?It is used as part of our national security to listen in on communication.b. It is used to make three-dimensional models of the galaxies.It locates spy satellites and decodes secret military languages.d. It locates old satellites, lost equipment, and space-related garbage.C. Aubrey says that the product of 104 and 102 is 108. Is she correct? If not, explain why.A. Yes, she is correct.B. No, the exponent should be positive 8.C. No, she multiplied the exponents instead of adding them.D. No, she multiplied the exponents instead of subtracting them. Kim planted sunflower seeds in a flower patch. The tallest sunflower grew 2.65 meters tall. The height of the shortest sunflower was 0.34 meters less than the tallest sunflower. What was the height, in meters, of the shortest sunflower? Think about how particles are arranged inside atoms. Please name and describe those three particles, and describe how the particles are arranged inside atoms. Some topics to include are: the charge of the particles, the mass of the particles, and where the particles are located. Alexa bought 2 1/3 pounds of turkey for 26.25. What is the cost per pound? discount mark ups and mark downs! PLZ PKZ HELP DUE IN 10 MINS!!!!!7. $40 game; 30% off; 5% tax PLS HELP ASAPSection 4: Answer the following analysis questions about your proposed solutions. 1. Describe the ways your proposed solutions decrease the negative effects of habitat destruction and human activity on your selected ecosystem. 2 Describe the costs, safety, and reliability of your proposed solutions, as well as any social, cultural, and environmental impacts your solutions address. 3. Evaluate your proposed solutions for their impact on overall environmental stability and changes. Which solution has more impact? Explain your reasoning for picking one solution over another. 4. How could you refine one of your proposed solutions to further reduce environmental impact and loss of biodiversity while also addressing human needs? What is the first step in evaluating the expression shown below?(12.9 3.1) 6.2 2 + 43A. Multiply 3.1 and 6.2B.Add 2 and 43.C.Subtract 3.1 from 12.9D.Subtract 2 from 6.2.HELPPPP