identify the median of 15-18​

Answers

Answer 1
The median of 15, 16, 17, 18 is 16.5
I hope this helps

Related Questions

Which equation choice could represent the graph shown below?

Answers

it has to be an equation that adds up to an exponent of 3

26 30 45 43 26 14 28 33 56 29 what is the medain of this data set

Answers

Answer:

26isthemedian

Step-by-step explanation:

2. The area of a rectangle is 721 quare yards, M the length of the rectarije v fards, Wuch enpresion represent
the width of the rectangle in yards?

Answers

Answer:

721/M

Step-by-step explanation:

Length times width equals area so area (721) divided by length/width (M) = the corresponding length/width. (width)

10 points
13 Jake has a wooden board that measures
8.25 feet long. He cuts the board into
pieces that each measure 0.75 feet so
he can make signs. If Jake earns $15.95
for each sign he sells, how much money
can he earn from the signs he makes
from this board?
a
Your answer

Answers

Answer:

$175.45

Step-by-step explanation:

8.25 / 0.75 = 11

15.95 x 11 = 175.45

Who has the shorter insect?

Answers

Connie does because

In a school day each student has to participate either in music or sport . Out of 350 students of the school 250 participated in sports and 145 in music then,
a. How many students have participated in both activities?
b. How many of them have participated in one activity only?
c. Represent the above information in a Venn Diagram.​

Answers

Answer:

a. 45

b. 305

(left side) just sports, (middle) amount that did both, (right side) kids that just did music

Step-by-step explanation:

a. 250 + 145 = 395 395-350 = 45

b. 350-45= 305

ope this helps :)

Fill in the table. What is the distance that David traveled going to his friend’s house and returning home?

Answers

Answer:12 and 12 hope this helps :)

Step-by-step explanation:

Answer:

mark her brialyist i cant spell lol

Step-by-step explanation:

If it is sunny, then we will go fishing.
Choose the equivalent statement.
A. If we go fishing, then it is not sunny.
B. If we do not go fishing, then it is not sunny.
C. If we do not go fishing, then it is sunny.

Answers

B. If we do not go fishing, then it is not sunny

Josh had $12.80 to spend for lunch. For lunch, he purchased two hamburgers that cost $2.75 each, cheese fries that cost $1.85, and a drink that cost $2.18. How much money did Josh have left after he purchased his lunch? *

Answers

Answer:

3.27

Step-by-step explanation:

the money he spent in total is 9.53 subtract it to 12.80

The amount of money left after he purchased his lunch is $3.27.

What is an expression?

The mathematical expression combines numerical variables and operations denoted by addition, subtraction, multiplication, and division signs.

Mathematical symbols can be used to represent numbers (constants), variables, operations, functions, brackets, punctuation, and grouping. They can also denote the logical syntax's operation order and other properties.

Given that Josh had $12.80 to spend for lunch. For lunch, he purchased two hamburgers that cost $2.75 each, cheese fries that cost $1.85, and a drink that cost $2.18.

The amount of money left will be calculated as,

Money left = 12.80 - [(2 x 2.75 ) + 1.85 + 2.18]

Money left = 12.80 - 9.53

Money left =  $3.27

Therefore, the amount of money left after he purchased his lunch is $3.27.

To know more about an expression follow

https://brainly.com/question/20460320

#SPJ5

I need a fast answer because I’m about to get on a plane

Answers

Answer:

C

Step-by-step explanation:

-6 is less than 7

Liz is a jewelry artist selling necklaces at the New Castle Farmers Market. It costs $135 to rent a table at the Farmers Market. The cost of the materials for each necklace is $4.50. Madison is selling the necklaces at $9 each.

The inequality 9n>135+4.50n represents the situation in which Liz makes a profit.

a. Will Liz make a profit if she sells 15 necklaces? Explain how you know.

b. Write an inequality to show the number of necklaces, n, Madison must sell to make a profit.

Answers

Answer:

Step-by-step explanation:

a. no. 9 x 15 = 135, so if she sells more than 15 necklaces, she'll make a profit

b. 50n > 135 + 4.50n

Kennyhas$893inasavingsaccount.The interest rate is 8 1/5%, compounded annually.

To the nearest cent, how much interest will he earn in 5 years?

Answers

Principal (P) = $ 893Interest rate (r) = [tex]8 \frac{1}{5} \% = \frac{41}{5} \% = \frac{41}{5 \times 100} = \frac{41}{500} \\ [/tex]Number of times the amount is compounded per time period (n) = 1Time (t) = 5 years.Let the compound interest be I.Therefore,

[tex] \sf \: I = P(1 + \frac{r}{n} {)}^{nt} - P \\ \sf = 893(1 + \frac{41}{500} ) ^{1 \times 5} - 893 \\ \sf= 893 \times ( \frac{541}{500} ) ^{5} - 893 \\ \sf= 1324.30 - 893 \\ \sf = 431.30[/tex]

Answer:

$431.30(approximate value)

Hope you could get an idea from here.

Doubt clarification - use comment section.

What is the value of z?

Answers

X* = 180*- 125* = 55*
Hence X* = 55*, then Z* = 55*

Using a calculator or otherwise, calculate the exact value of 498.79×14.38. Round your answer to one (1) decimal place.

Answers

Answer:

7172.6

Step-by-step explanation:

A cyclist travels 4 miles in 20 minutes and then a further 6 miles in 30 minutes without stopping. Calculate the cyclist's average speed in mph.​

Answers

Answer:

11 miles per hr because 10 miles took 50 minutes so add 1 mile and it is 1hr. Which is 11 miles per hr

Plz answer bhhk f hi j

Answers

Answer:

its just rhombus and trapezoid i think.

Step-by-step explanation:

what is 5 over 4 in math

Answers

Answer:

An improper fraction

Step-by-step explanation:

In improper fraction is when the numerator (top number) is greater than or equal to the denominator (bottom number)

Check whether (19/9, 15/3) is
a solution of the equation 3a + b = 8 or
not where (a,b) is co-ordinate point.​

Answers

Answer:

No, it is not a solution to the equation.

Step-by-step explanation:

If [tex]( \frac{19}{9} , \frac{15}{3} )[/tex] is a solution of the equation, the left-hand side (LHS) of the equation would equal to the right-hand side (RHS) of the equation.

3a +b= 8

When a= [tex] \frac{19}{9} [/tex], b= [tex] \frac{15}{3} [/tex],

LHS

= [tex]3( \frac{19}{9} ) + \frac{15}{3} [/tex]

[tex] = \frac{19}{3} + \frac{15}{3} [/tex]

[tex] = \frac{34}{3} [/tex]

[tex] \frac{34}{3} ≠8[/tex]

Since the left-hand side is not equal to the right-hand side of the equation, [tex]( \frac{19}{9} , \frac{15}{3} )[/tex] is not a solution of the equation.

Given equation is 3a+b = 8

Given point = (19/9,15/3)

Put a = 19/9 and b = 15/3 in LHS of the given equation then

⇛ 3(19/9)+(15/3)

⇛(19/3)+(15/3)

⇛ (19+15)/3

⇛ 34/3 ≠ 0

LHS ≠ RHS

Given point not satisfies the given equation

Therefore, it is not the solution of the given point.

also read similar questions: The equation of a straight line is 2y = 3x + 4. a. Find the graduent of this line. b. Find the co-ordinates of the point where the line crosses the y-axis. Plea...

https://brainly.com/question/14809418?referrer

What is the value of a in the equation 3a + b = 54, when b = 9? 15 18 21 27..

https://brainly.com/question/164361?referrer

Congruence Criteria for a Parallelogram's two triangles is:

ASA
HL
AAS
SSS

Answers

Answer:

ASA

Step-by-step explanation:

two angles are the same and one side is the same

A knife is 3x the cost of a spoon9 spoons and 12 knives cost £82.80Work out the cost of 1 knife

Answers

The cost of my me knife is $5.52

10. John is mixing paint.He uses black, green and blue in the ratio 6:3: 1. How much of black green and blue paint is needed to make a mixture of paint of 500ml.

Answers

The given ratio becomes 6x : 3x : x.

6x = black paint

3x = green paint

x = blue paint

6x + 3x + x = 500

10x = 500

x = 500/10

x = 50

6x = 6(50) = 300

3x = 3(50) = 150

x = 50

Answer:

300 ml of the black paint.

150 ml of the green paint.

50 ml of the blue paint.

The quadratic function g(x)=ax^2+bx+c has the complex roots (-7+4i) and (-7-4i)
What is the value of a?
What is the value of b?
What is the value of c?

Answers

Answers:

a = 1

b = 14

c = 65

===========================================================

Explanation:

Let's focus on the root x = -7+4i

Add 7 to both sides, then square both sides. Then get everything to one side so 0 is on the other side.

x = -7+4i

x+7 = 4i

(x+7)^2 = (4i)^2

(x+7)^2 = 16i^2

(x+7)^2 = 16(-1)

(x+7)^2 = -16

(x+7)^2+16 = 0

If you were to follow those steps for the other root -7-4i, then you should get the same result. Solving (x+7)^2+16 = 0 leads to the two complex roots -7+4i and -7-4i.

Expand out that expression to get it into standard form

(x+7)^2+16

(x+7)(x+7)+16

x^2+7x+7x+49+16

x^2+14x+65

The equation is now in y = ax^2+bx+c form

a = 1

b = 14

c = 65

If you were to plug those a,b,c values into the quadratic formula, you'll find that it leads to the two given roots -7+4i and -7-4i.

The prices of some houses in a neighborhood are shown below: House Price A $120,000 B $130,000 C $140,000 D $150,000 E $1,110,000 Based on the data, should the mean or the median be used to make an inference about the price of the houses in the neighborhood?

Answers

Answer:

The mean

Step-by-step explanation:

The mean would allow you to make an average aka the inference about the price of houses whilst if you take the median, you're just taking the middle number from a  list of numbers and not the average.

Answer: Median

Step-by-step explanation:

Median, because there is an outlier that affects the mean.

Step-by-step explanation:

The outlier is 1,110,000

As you have learned in the lesson, outliers affect means, meaning that you should not use them.

Hope this helped! ❤

On a scale drawing, a statue is 8.3 inches tall. The scale factor is 212. Find the actual height of the statue.

Answers

Answer:

1759.6

Step-by-step explanation:

8.3 multiplied by 212 i think

The land area of Connecticut is about 12,549,000,000 square meters. The land area

of Rhode Island is about 2,707,000,000 square meters. How many times greater is the land area of Connecticut than the land area of Rhode Island?

Answers

Answer:

  4.636

Step-by-step explanation:

The ratio is the same when it is written in terms of billions of square meters:

  CT/RI = 12.549/2.707 ≈ 4.636

The area of CT is about 4.636 times as large as the area of RI.

Please help with this question!!!!

Answers

Answer:

what is your question ?

Step-by-step explanation:

36 ÷ ____ = 9 15 points

Answers

Answer:

36 ÷ __4__ = 9

Step-by-step explanation:

36/9 = 4, so

36 ÷ __4__ = 9

If f(x) = 5^x + 2x and g(x)= 3x-6, find (f + g) (x)

Answers

Step-by-step explanation:

f(x) = 5^x + 2x and g(x)= 3x-6

(f + g) (x)

5^x + 2x + 3x-6

5^x + 5x -6

Evaluate the following expression 6⋅2+6^4 khan academy

Answers

Answer:

6.2+6^4

6.2+1.296

7.496

Brainiest if good answer!
No links!!! I won’t view them

Given the system of linear equations:
{x+6y=6
y=1/3 x−2

Part A: Graph the system of linear equations.
Part B: Use the graph created in Part A to determine the solution to the system.
Part C: Algebraically verify the solution from a Part B

Answers

Answer:

QUESTION 1

The image attached shows the graph of the given system of equations. There you would notice that the solution is (-1,-5), which is the interception point.

To verify the solution algebraically, we need to multiply the first equation with -1 and then sum them up

Then, we use this value to find the other one

Therefore, the solution is (-1,-5), which is the same showed graphically.

QUESTION 2.

Using the same process as we did in the QUESTION 1. The image attached shows both lines and the interception point which is the solution. So, the solution is (6,0).

To verify the solution algebraically, we must multiply the second equation by -6

Then, we use this value to find the other one

Therefore, the solution is (6,0), the same showed graphically.

Step-by-step explanation:

If you don't get it

question 1

solution is (-1,-5)

question 2

solution is (6,0),

The solution to the system of linear equations x+6y=6 and y=1/3 x−2 is x = 6 and y = 0.

What is a linear equation?

It is defined as the relation between two variables, if we plot the graph of the linear equation we will get a straight line.

If in the linear equation, one variable is present, then the equation is known as the linear equation in one variable.

We have:

The system of linear equations:

x+6y=6

y=1/3 x−2

Part A: Graph is shown in the picture.

Part B: The intersection point is (6, 0)

x = 6

y =0

Part C: By substitution method.

[tex]\rm x+6\left(\dfrac{x}{3}-2\right)=6[/tex]

x  = 6

y = 0

Thus, the solution to the system of linear equations x+6y=6 and y=1/3 x−2 is x = 6 and y = 0.

Learn more about the linear equation here:

brainly.com/question/11897796

#SPJ2

Other Questions
See the picture first, thank you.QUESTIONS::1. Does each graph represent a linear function? Why?2. What is the domain of the first graph? second graph?3. What is the range of the first graph? second graph? help pleas im super slow i hate science Which of the following occurrences is LEAST likely lead to the development of the human resource of a country? Kindly help out with this question! AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA y=6x-17 -12x+2y = -34 ?? While emptying the autoclave, the medical assistant notices that the wrapped instruments are damp. The medical assistant should Which phrase best describes what a soil horizon is? A the bottom layer of a soil profile B each layer of a soil profile C the place where two soil profiles meetD the place where a soil profile meets bedrock A wave has wavelength of 10 m and a speed of 340 m/s. What is the frequency of the wave?I need the Formula,Known,Substitute & Solve Answer with Units Welcome to Gboard clipboard, any text you copy will be saved here. help pls im having trouble understanding this question As world population grows and the ocean is called on to provide more and more resources, what can people do to be sure the resources are used sustainably? Developing a shared understanding through communication is complex because __________________.a.everyone interprets the world differentlyc.learning to communicate well is too difficultb.no one understands enough words to communicate effectivelyd.all of the abovePlease select the best answer from the choices providedABCD (Place in chronological order) PLEASE HELPLondon Company establishes JamestownMayflower CompactUS ConstitutionDeclaration of IndependenceWar of 18121st Continental CongressColumbus's first voyage to the IndiesLouisiana PurchaseRevolutionary War beginsWashington becomes 1st US President I NEED MORE HELP PLZZ a uniform thin rod of length l and mass m is allowed to rotate on a frictionless pin passing through one end. The rod is released from rest in the horizontal position. a.) What is the speed of the center of gravity when the rod reaches its lowest position? b.) What is the tangential speed of the lowest point of the rod when the rod reaches its lowest position? Which examples of propaganda are found in this passage? Select two options.Snowball is used as a scapegoat.Napoleon talks to the animals through Squealer.Squealer targets his message to emphasize plain folks.Squealer uses glittering generalities to describe Napoleons tactics.Napoleon uses name-calling to differentiate the pigs from the other animals. who were dev and ashamvav At a hospital, 56 percent of the babies born are not girls. Of the baby girls born, 12 percent are premature. What is the probability of a premature baby girl being born at this hospital? round to the nearest percent. Why did Marshall describe the economy in Europe over the past 10 years as "highlyabnormal"?