Mathematics Middle School

I will mark best answer brainliest

I Will Mark Best Answer Brainliest

Answers

Answer 1

Answer: -1

Step-by-step explanation:

-8 (-8x - 6) = -6x - 22

distribute

64x + 48 = -6x -22

get rid of the smallest x by adding 6x to both side

70x + 48 = -22

minus 48 to both sides

70x = -70

divide both side by 70

x = -1

Answer 2
X = -1

Lol im not getting brainliest but I’ll Write this anyway

Related Questions

try to say m without using Ur lips ( its impossible) if u can do that u will get a brainliest
and i cant hear u im blind

Answers

Answer: U

Step-by-step explanation:

Martha wants to give each guest the same thing in each gift bag. She has 12 chocolate bars, 24 packs of gum and 48 bags of chips.

Answers

Answer:

You could put together 12 bags and each would have 1 piece of chocolate, 2 packs of gum and 4 bags of chips

Step-by-step explanation:

Martha is able to make 12 equal bags. Each bag can contain 1 chocolate bar, 2 packs of gum and 4 bags of chips.

:D hiiii im back with another most likely easy questionnnnnnnnnnnnnnnnnnnnnn

Answers

Answer: The answer is 75

20/4=5

5*15=75

It’s 75 because 20/4 is 5 and 15x5 is 75

A 12,000-gallon pool is being filled at a rate of 40 gallons per minute. At this rate, how many minutes will it take to fill the pool 3/4 full?

Answers

Answer:

It would take 225 minutes to fill up 3/4 of the pool

Step-by-step explanation:

Whoever answers all three correctly is who I’ll give brainlist to.

Answers

Answer:

a c d i think those are answers

1.A
2.C
3.C or D I believe

Please
Marked as brainlist

Solve the equations:
1. 9x - 5 = 5x + 7
2. 8x - 2 = x - 16
3. 8x + 5 = 2x + 23
4. 2x + 8 = 5x + 20
5. 5(2x + 6) = 3x - 5

Answers

Answer:

5(x – 4) + 3x – 9x = 6 – (2x + 5) + 8x

step1:-   5x - 20 + 3x - 9x = 6 - 2x - 5 + 8x

step2:- 5x + 3x - 9x - 20 = 8x - 2x + 6 - 5

-x - 20 = 6x + 1

stp 3

-20 = 7x + 1

step 4

-21 = 7x

divide both sides by 7:-

-3 = x

thats the solution   x  = -3

Answer:

1. X=3, 2. X= -2, 3. X=3, 4. X= -4

By how much did the price of the stock change from the beginning of Week 1 to the end of Week 4?

Answers

Answer:

It changed by 1.2

Step-by-step explanation:

1.5 divided by 1.25 equals 1.2

1.25 times 1.2 equals 1.5

Hope I helped!! :)

Sorry if it's wrong! :(

Pls mark brainlist!!!

Answer:

um you add then you i dont   know to  how to explain this

Step-by-step explanation:

Can you answer THIS one in the picture form

Answers

sorry i needed points so ask my own questions

what is the slope of the line passing through the point(2,-1) and the origin.
This is the whole question, no picture came with it.

Answers

Answer:

- 1/2

Step-by-step explanation:

(0,0) (2,-1)

m = difference of y/difference of x = (-1 - 0) / (2 - 0) = - 1/2

y = - 1/2 x

A bag of Jolly Ranchers contains:

2 red
1 blue
4 pink
3 green
5 purple

Ms. McCorkle will select 2 Jolly Ranchers, without replacement. What is the probability that she will select a purple, then a green? Your answer should be a simplified fraction.

Answers

the chance she takes a purple is 5/15
simplified is 1/3
the chance she selects green is 3/15
simplified is 1/5
1/3 times 1/5 is 1/15

Which of the following expressions is equal to 5 - 2m?

7 - 2(m + 1)
7 - (2m - 5)
7 - 2(m - 2)

Answers

Answer:

the second one

Step-by-step explanation:

7 - (2m - 5)

Hey there!

In order for us to find out which one is equivalent to 5 – 2m , we can go through all of your options to see which one gives us that!

“Equivalent to 5 – 2m”

Option A.

7 – 2(m + 1)

Distribute

7 – 2(m) + 2(1)

7 – 2m + 2

COMBINE LIKE TERMS

7 – 2 = 5

Option Answer: 5 – 2m

Option A can be a possible ANSWER ✅

Option B.

7 - (2m - 5)

DISTRIBUTE

7 – 2m + 5

COMBINE LIKE TERMS

7 + 5 = 12

–2m = –2m

Option Answer: –2m + 12

Option B CAN’T possibly be your ANSWER ❌

Option C.

7 - 2(m - 2)

DISTRIBUTE

7 - 2(m) + (–2)(–2)

7 – 2m + 4

COMBINE YOUR LIKE TERMS

7 + 4 = 11

–2m = –2m

Option answer: –2m + 11

Option C. CANT possibly be your ANSWER ❌

Now that we have went through ALL of your choices, this leaves “Option A” as your answer

Answer: Option A). 7 - 2(m + 1) ☑️

Good luck on your assignment and enjoy your day!

~LoveYourselfFirst:)

A wallet contains the following coins:

3 quarters
2 dimes
4 nickels
1 penny
What is the probability of randomly selecting a quarter, spending it , then selecting a dime? Your answer should be a simplified fraction.

Answers

Answer:

1/5 or 20%

Step-by-step explanation:

if there is a total of 2 dimes out of 10 coins there is a 20% chance of you picking a dime

Answer:

well- the answer needs to be only in fraction so it's 1/5-

Step-by-step explanation:

Y'all help, it's due at 12 ;-;

Answers

Step-by-step explanation:

people get the oxgyen throught plants as we know plant helps to in hale the carbondioxide and exhale the oxygen that is needed for the people in respiration like wise people inhale and exhale the co2 ( carbon dioxide) .

Answer:

We get oxygen by breathing in fresh air, and we remove carbon dioxide from the body by breathing out air that already went in. Respiration is carried out bc when air is sucked in through our mouth/nose, it follows the windpipe and splits into 1 bronchi for each lung.

HELP PLz Now!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!

Answers

Answer:

It will take 16 months to grow which is C

Step-by-step explanation:

Answer: 16 months

Step-by-step explanation:

8 / 1/2 = 16

16 x 1/2 = 8

So it would take her 16 months to grow her hair 8 inches.

Please help me. 30 points.

Answers

Ed 132 LN 129 XY 90
The reason for this is the triangles go at slim rates all you need to do is add up and look at the right side

please help 50 points


Alicia rented bowling shoes for $3 and played 4 games at $2 each. Write and
evaluate an expression for the total cost of bowling.

Answers

3+4=(2) = 3+8 = $11

need help, please
brainly

Answers

Answer:

a

Step-by-step explanation:

The answer is A.:)..

one stone on easter island is 12 meters high. the nose of the statue is 3.3 meters long. If the proportional statue is only 10 meters high. How long will the nose be? write your answer in a decimal

Answers

Answer:

The nose will 2.75 meters long.

Step-by-step explanation:

Answer: 2.5 meters long

A roller coaster can accommodate 18 riders in 8 minutes. Complete the table with equivalent ratios.

Answers

Answer:C. 32

Step-by-step explanation:

18 X 4 = 72

8 X 4 = 32

So therefore there both equivalant

Bottom right: 32

After 8 is 16

After 16 is 24

After 18 (top) is 36

After 36 (top) is 54

After 54 is 72

The graph

Top row: 18, 36,54,72

Bottom row: 8, 16, 24, 32

At Breakfast Break, 2 eggs and 1 sausage patty cost $2.23 and 3 eggs with 2 sausage patties cost $3.76. Assuming that these amounts only pay for the eggs and sausage, how much does one sausage patty cost?

Answers

I am thinking one sausage patty cost $4.25

Cost of one sausage patty is $0.83.

What is an equation?

An equation is a combination of different variables, in which two mathematical expressions are equal to each other.

Given that,

Cost of 2 eggs and 1 sausage patty = $2.23,

Cost of 3 eggs and 2 sausage patties = $3.76.

Write above expression in equation form,

2 eggs + 1 patty = 2.23             (1)

3 eggs + 2 patties = 3.76         (2)

To find the cost of patty, multiply equation (1) with 3 and equation (2) with 2,

6 eggs + 3 patties = 6.69         (3)

6 eggs + 4 patties = 7.52          (4)

By solving equation (3) and (4)

1 patty = 0.83

The cost of 1 sausage patty is $0.83.

To know more about Equation on:

https://brainly.com/question/187506

#SPJ2

round 0.615 to the nearest Hundreth pLEASEEEE HSLPPPP

Answers

Answer:

0.62 is the answer

Step-by-step explanation:

Answer:

0.62

Hope this helped have a great day

davis earned $32.12 for making 7 touchdowns at his football game.how much does he make per touchdown

Answers

Answer:

ABOUT 4.59

Step-by-step explanation:

divide 32.12 by 7

Hope this helps :)

help please! thank you!
The ratio of cats to dogs is 8/6, which can be simplified to 4/3. The ratio of fish to birds is 20/2. Can it be simplified to 10? Why or why not? Answer in complete sentences.

Answers

Answer:

Not exactly. It can't be simplified as "10" but can be simplified as 10:1 or 10/1. (At least I'm pretty sure).

Step-by-step explanation:

Sorry if it didn't helped D:

If it did help, then thanks! :D

Ratios can only be written as 10:1. So the answer is no because you can’t write a ratio by just saying “10” you must write 10:1 or 10/1

please help will name brainliest

Answers

The answer is the one that is perhaps correct yeah
C I am sorry if I am wrong

Rewrite the equation from part Dby factoringtheeee side that contains the variable p
D p=(65-r)/60
D p=(65-r)/60

Answers

D p=(65-r)/60!!!!!!!!!!!

I will mark brainliest if correct

Answers

Answer:

E)40 Mrs. White

Step-by-step explanation:

do you need an explanation?

Joshua borrows $300 from his older sister to buy a bike. He promises to pay the total amount plus 5% simple interest in one year. How much will Joshua

Answers

the answer is $315. hope this helps !
$315 is your answer to the question

A rectangular prism is shown below. What is the lateral surface area?

Answers

Answer:

the answer is 110 because 5 times 2 equals 10 and 10 times 11 is 110

Answer:

2(11)(5)+2(11)(2)+2(2)(5)=110+44+20=174

174 Square Centimetres

(2) Clare said that 4/3:5/2 is 10/3. She reasoned: 4/3.5=20/3 and 20/3:2=10/3.
Explain why Clare's answer and reasoning are incorrect. Find the correct
quotient!

Answers

Answer:

The answer is 8/15

Step-by-step explanation:

4/3 divided by 5/2 is the same as 4/3 times 2/5

4/3 times 2/5= 8/15

8/15 is the answer

She is wrong because if you want to do it you have to multiply the fraction with 5 and then MULTIPLY it by 2 not divide it by 2.

Hope this helps :)

-ilovejiminssi♡

You answer is 8/15 hope this helps :)))


A right triangle has a hypotenuse of length 13 in. and a leg with length 4 in. What is the length of the other leg?

Answers

Answer:

Solution,

Let the hypotenuse of the right triangle be 'a' and its legs be 'b' and 'c'.

Here, a= 13, b = 4 and c=?

Using Pythagoras or Gogou theorem,

a² = b² +c²

or, 13² = 4² +c²

or, c² =153

or, c = 3√17 inch

Other Questions
How did technology contribute to the expansion of European power through imperialism? Hey guys can one of you help me pls its only one small question The plugin that changes Jenkins to use green balls instead of blue for successful builds is ________. Decide whether the pronunciation is correct or incorrect. Drag and drop the word into the correct column.encourage en-KUR-Correct PronunciationIncorrect Pronunciationexplain ik-SPLAYNjustity JUHS-tun-tahyplayful PRET-tuhmspecial SLISP-uhtheroic hi-ray-IT An architect draws a plan for a wheelchair ramp on the plan, the ramp is 2cm high and 24cm long what might the dimensions of the actual ramp be (use equivalent ratios) What is the definition of fourteen points? What became of most of the Central powers colonies after World War I? They became independent nations. They remained colonies of Central Powers nations. They became League of Nations mandates. They were run by the League of Nations. TACTTAGAGGCACCACATGGGCCTTGCACT to mRNA The slope of the line below is -1/7. Write a point-slope equation of the lineusing the coordinates of the labeled point. What might be the consequences of your choice? Political: Economic: Social: What are the two ways a subduction zone can be generated? The local lighting company found that 2 out of every 10 lightbulbs was defective. Ifthere are a total of 120 bulbs in a box, how many can they predict will be defective? Quienes intervienen en este caso de violencia? En la fragmento de la novela corazn a shop is having a sale all items are reduced by 30% work out the sale price of an item normally priced at 110 Which court would hear this case? Mr. Jones is suing Ms. Brown for the cost ($2,000) to fix his fence when her tree fell and crushed the fence. Hello can someone help me with this question please! 2 3/8 x 3 3/4 divided by 2 2/3 HELP PLEASEAt Love Canal in the 1970s, there was an environmental disaster. In response, the Superfund law was passed. Why can we view Love Canal and the creation of the Superfund as a positive environmental event? A. It allowed the EPA to find toxic waste sites and force the responsible parties to clean up the sites. B. It provided money to businesses responsible for toxic waste sites to clean up their pollutionC. It helped boost the economy among those waste sites D. It helped identify toxic waste site and move people away from them what do you understand by the term current state and define its SI unit......... help please! thank you!The ratio of cats to dogs is 8/6, which can be simplified to 4/3. The ratio of fish to birds is 20/2. Can it be simplified to 10? Why or why not? Answer in complete sentences.