How many protons, neutrons, and electrons does Sr^2+

Answers

Answer 1

Answer:

36 electrons

Explanation:

The # of protons is always equal to the atomic number. In the case of Sr (Strontium), it is 38 protons.

The 2+ at the end means that it has a charge of +2, meaning that it LOST two electrons to become a cation with a full valence shell. So, 38 - 2 = 36 electrons

Answer 2

Answer:

38 protons 36 electrons 30 neutron because of 29 isotope


Related Questions

what is the volume of the rock? if the water rose from 50L to 70mL

Answers

20 I think that’s the volume of it because 50-70 is 20 so it must’ve been 20 volume that lifted the water to 70 ML

How would a long period without sunlight affect the food web? PLEZZ HELP MEH IF YOU WANT BRAINEIST AND LIKE COMMENTED


It would cause consumers to consume more food.

It would have no effect on the food web.

It would stop decomposers from breaking down matter.

It would stop producers from producing food.

Answers

Answer:

im pretty sure its the last one

Explanation:

if plants dont have sun light they will die because the sunlight gives them the nutrients to survive

What is molarity measured the concentration of

Answers

Molarity (M) indicates the number of moles of solute per liter of solution (moles/Liter) and is one of the most common units used to Measure the concentration of a solution

What is the molarity of a solution of 10% by mass cadmium sulfate, CdSO4 (molar mass = 208.46 g/mol) by mass? The density of the solution is 1.10 g/mL.

a. 0.528 M
b. 0.436 M
c. 0.479 M
d. 0.048 M
e. 22.9 M

Answers

Answer:

a. 0.528 M .

Explanation:

Hello!

In this case, since the given by-mass percent can be written as:

[tex]\frac{10gCdSO_4}{100g\ sol}[/tex]

By using the density and molar mass of the solute, cadmium sulfate, we can compute the molarity, by also making sure we convert from mL to L of solution:

[tex]M=\frac{10gCdSO_4}{100g\ sol}*\frac{1molCdSO_4}{208.46gCdSO_4} *\frac{1.10g\ sol}{1mL\ sol}*\frac{1000mL}{1L} \\\\ M=0.528M[/tex]

Thereby, the answer is a. 0.528 M .

Best regards.

The molarity of the solution of 10% by mass cadmium sulfate [tex](CdSO_4)[/tex] is approximately 0.479 M. The correct option is C.

To calculate molarity we need to find out how many moles of CdSO4 are present in the solution.

Given:

Mass of [tex]CdSO_4[/tex]= 10% by mass of the solutionMolar mass of [tex]CdSO_4[/tex] = 208.46 g/molDensity of the solution = 1.10 g/mL

We need to calculate the mass of [tex]CdSO_4[/tex]:

Mass of [tex]CdSO_4[/tex] = (10% / 100%) * Total mass of the solution

Mass of [tex]CdSO_4[/tex] = (10 / 100) * 1000 g (since the volume is 1 L, and the density is 1.10 g/mL)

Mass of [tex]CdSO_4[/tex] =  100 g

So, the number of moles of CdSO4:

Number of moles of [tex]CdSO_4[/tex] = Mass of CdSO4 / Molar mass of CdSO4

Number of moles of [tex]CdSO_4[/tex] = 100 g / 208.46 g/mol

Number of moles of [tex]CdSO_4[/tex] ≈ 0.479 moles

Then, we calculate the molarity of the solution:

Molarity = Number of moles of CdSO4 / Volume of the solution (in liters)

Molarity = 0.479 moles / 1 L

Molarity ≈ 0.479 M

Hence, the molarity of the solution of 10% by mass cadmium sulfate [tex](CdSO_4)[/tex] is approximately 0.479 M. The correct option is C.

Learn more about Molarity, here:

https://brainly.com/question/31545539

#SPJ6

What is the molar mass of magnesium sulfate, MgSO4?

Answers

Answer:

120.37 g/mol is the molar mass of magnesium sulfate

120.37, hopefully this helps <3

Atoms are stationary and don't move when in solid form.

False

True

Answers

Answer:

True? The don't stay exactly still i dont think, but i'd say true.

Explanation:

Answer:

TRUE

Explanation:

In a solid, atoms are packed tightly together and move very slowly. In fact, they do not flow at all: they simply vibrate back and forth.

Key words vibrate, not movement.

Correct me if I'm wrong of course

One mole of a substance has a different number of particles as one mole of another substance.
O True
O False

Answers

False
Explain: I just did this question on my quiz and I got it right
Hope that helps please like my answer
Have a good day ❤️

1pt Copper chloride and aluminum react to produce
aluminum chloride and copper. Which of the
following is the correctly balanced chemical
equation for this reaction?
O A. CuCl, + Al -> AICI, + u
O B. 3CuCl, + Al -> AlCl, + 2Cu
OC. 3CUCI, + 2Al -> 2AICI, + 3Cu
OD. CuCl, + 3Al -> AICI, + 2Cu

Answers

Answer:

None of the above

but it must be:

for Copper(I)chloride

3CuCl + Al ==> AlCl3 + 3Cu

for Copper (II) chloride

3CuCl2 + 2Al ==> 2AlCl3 + 3Cu

Why is your body going through physical and chemical changes?

Answers

Answer:

Physical and chemical changes can occur almost everywhere, even in our bodies! Food must be broken down into a form that our cells can use. When we eat, our bodies physically break down food into small pieces. Our bodies also chemically break down those small pieces of food into tiny organic molecules.

Explanation:

A 52 gram sample of an unknown metal requires 714 Joules of energy to heat it from
30.5◦C to 82◦C. What is the specific heat of
this metal?
Answer in units of J/g ·
◦ C.

Answers

Answer:  Approximately [tex]0.267 \frac{\text{J}}{\text{g}^{\circ}\text{C}}[/tex]

===================================================

Work Shown:

We have the following variables

Q = 714 joules = heat requiredm = 52 grams = massc = specific heat = unknown[tex]\Delta t[/tex] = 82-30.5 = 51.5 = change in temperature

note: the symbol [tex]\Delta[/tex] is the uppercase Greek letter delta. It represents the difference or change in a value.

Apply those values into the formula below. Solve for c.

[tex]Q = m*c*\Delta t\\\\714 = 52*c*51.5\\\\714 = 52*51.5*c\\\\714 = 2678*c\\\\2678*c = 714\\\\c = \frac{714}{2678}\\\\c \approx 0.26661687826737\\\\c \approx 0.267\\\\[/tex]

The specific heat of the unknown metal is roughly [tex]0.267 \frac{\text{J}}{\text{g}^{\circ}\text{C}}[/tex]

Fungus is an example of a/an-

A:tissue
B:cell type
C:organ
D:organism

Answers

Answer:

D.organism

Explanation:

A fungus from the kingdom fungi is an organism

Answer:

D. organism

......................

Solid mercury (II) oxide produces liquid mercury and oxygen gas

Answers

Mercury(II) oxide, a red solid, decomposes when heated to produce mercury and oxygen gas. Mercury(II) oxide is a red solid. When it is heated, it decomposes into mercury metal and oxygen gas. A reaction is also considered to be a decomposition reaction even when one or more of the products are still compounds.

how are Ionic and Covalent Bonds are formed with examples ?

Answers

Answer:Comparison of Ionic and Covalent Bonds

In an ionic bond, the atoms are bound together by the electrostatic forces in the attraction between ions of opposite charge. ... For example, sodium (Na), a metal, and chloride (Cl), a nonmetal, form an ionic bond to make NaCl. In a covalent bond, the atoms bond by sharing electrons.

     

pls   add  Brainliest

Write down the possible types of atomic
Orbitals of n=4​

Answers

Answer:

2

Explanation:

because first shell ( k shell ) needs only 2 electron to complete its octet .

hope it helps

It’s actually 16 orbitals for n = 4!

What carpet Burns in a deficiency of O2 a mixture of CO and CO2 forms.Carbon Burns in excess O2 to form only CO2 and CO Burns in excess O2 to form only CO2. Calculate ΔH for C(graphite +1/2O2) →CO(g).

Answers

Answer:

Explanation:

From the combustion of carbon, the reactions occurring in limited oxygen conditions are:

[tex]C(graphite) + \dfrac{1}{2}O_{2(g)} \to CO_{(g)}[/tex]  

[tex]C(graphite) + O_{2(g)} \to CO_{2(g)}[/tex]  

If it occurs in excess, then any leftover CO changes to CO2. i.e.

[tex]C(graphite) + O_{2(g)} \to CO_{2(g)}[/tex]   ---- (1)

[tex]CO_{(g)} + \dfrac{1}{2}O_{(g)} \to CO_{2(g)}[/tex]          ----- (2)

From (1), the enthalpy change is:

[tex]\Delta H_{rxn1} = \Delta H^0_{fCO_2(g)} - ( \Delta H^0_{f C(graphite)}+ \Delta H^0_{fCO_2(g)}[/tex]

[tex]\Delta H_{rxn1} =-393.5 \ kJ/mol -(0+0)[/tex]

[tex]\Delta H_{rxn1} =-393.5 \ kJ/mol[/tex]

From (2), the enthalpy change is:

[tex]\Delta_{rxn2} = \Delta H^0_{fCO_2(g)} - ( \Delta H^0_{fCO(g)} + \dfrac{1}{2} \Delta H^0_{fO_2(g)})[/tex]

[tex]\Delta_{rxn2} = -393.5 \ kJ/mol -(-110.5 + \dfrac{1}{2}(0))[/tex]

[tex]\Delta_{rxn2} = -283.0 \ kJ/mol[/tex]

Subtracting (2) from (1), we get:

[tex]C(graphite) + O_{2(g)} \to CO_{2(g)} \ \ \ \Delta H_{rxn} = -393.5 \ kJ/mol}[/tex]

[tex]CO_{(g)} + \dfrac{1}{2} O_2(g) \to CO_{2(g)}} \ \ \ \Delta H _{rxn2} = -283.0 \ kJ/mol[/tex]

                                                                                                   

[tex]C(graphite) + O_{2(g)} \to CO (g) + \dfrac{1}{2}O_{2(g)} \ \ \ \Delta H_{rxn} = -110.5 \ kJ/mol[/tex]

[tex]C(graphite) + \dfrac{1}{2} O_{2(g)} \to CO (g) \ \ \ \Delta H_{rxn} = -110.5 \ kJ/mol[/tex]

The enthalpy change ΔH of the reaction = -110.5 kJ/mol

flourine is more reactive than chlorine . why ? with short reason. ​

Answers

Answer:

Electronegativity is probably the biggest thing that plays into reactivity. Therefore, since fluorine has a higher electronegativity than chlorine, fluorine is more reactive.

Explanation:

I got it right

A chemist prepares a solution of barium acetate BaCH3CO22 by weighing out 52.9g of barium acetate into a 100.mL volumetric flask and filling the flask to the mark with water. Calculate the concentration in /gL of the chemist's barium acetate solution. Round your answer to 3 significant digits.

Answers

Answer:

529g/L

Explanation:

The concentration in chemistry is defined as the amount of solute in a determined amount of solution. The concentration in g/L means the amount of grams of solute (In this case, barium acetate), per liter of solution.

To solve this problem we need to find grams of solute (52.9g, already given) and the volume in liters (Converting 100mL to liters):

Volume:

100mL * (1L / 1000mL) = 0.100L

And concentration in g/L is:

52.9g / 0.100L =

529g/L

A 2.26 M solution of KOH is prepared. Calculate the moles and mass of solute present in a 15.2-mL sample of this solution. The molar mass of KOH is 56.11 g/mol.

Answers

Answer:

0.0344 moles and 1.93g.

Explanation:

Molarity is defined as the ratio between moles of a solute (In this case, KOH), and the volume. With molarity and volume we can solve the moles of solute. With moles of solute we can find mass of the solute as follows:

Moles KOH:

15.2mL = 0.0152L * (2.26mol / L) = 0.0344moles

Mass KOH:

0.0344 moles * (56.11g/mol) = 1.93g of KOH

If 10.88 moles of NH3 were produced, how many moles of N2 would be
required?

Answers

Answer:

5.44 moles of nitrogen required.

Explanation:

Given data:

Number of moles of NH₃ = 10.88 mol

Moles of N₂ required = ?

Solution:

Chemical equation:

N₂ +  3H₂         →       2NH₃

Now we will compare the moles nitrogen and hydrogen.

               NH₃          :           N₂

                 2             :           1

               10.88        :         1/2×10.88 = 5.44mol

5.44 moles of nitrogen required.

   

what element is in group 13, period 4

Answers

Answer:

Gallium

Explanation:

Answer:

Gallium

Explanation:

Which of the following is a radioactive element?Sodium, Fluorine,Oxygen
francium

Answers

Answer:

Fluorine

Explanation:

These particles stick in the atoms and make them radioactive.

All the radioactive elements are found in the last group of the Periodic Table.

True
False

Answers

Answer:

False

Explanation:

I think the awser is false

please helpppppppppp

Answers

Answer:

Environmental factors such as diet, temperature, oxygen levels, humidity, light cycles

And the presence of mutagens can all impact which of an animal's genes are expressed, which ultimately affects the animal's phenotype.

Environmental factors such as diet, temperature, oxygen levels, humidity, light cycles, and the presence of mutagens can all impact which of an animal's genes are expressed, which ultimately affects the animal's phenotype.

if 3.26 g is dissolved in enough water to make exactly 323 ml of solution, what is the molar cocentration of nitrate ion g

Answers

Divide both sides to get 104 and that’s your answer

How do sound waves travel? PLEASE HELP IF YOU WANT BRAINLEIST AND ME TO LIKE URE COMMENT!!
A. Sound causes the air near it to vibrate inwards.

B. waves radiate outward from a central point.

C. Sound moves randomly in different directions.

D. Sound transforms waves into different frequencies.

Answers

The answer is A. The vibration caused by the waves through the air eventually weaken, which is why sound diminishes easily over distance.

help please thank you​

Answers

C. F, Br, Cl, At
Explanation: you can see the periodic table

pleaseee help thank youu​

Answers

Answer:

i just took it the answers is C

Explanation:

It’s d hope it’s correct I triedjsjjddjsnsnshsje

What is the correct formula to determine density?

Answers

D=M/V I hope this helps

Answer:

density =mass/volume

Explanation:

p=m/v

p means raw

m means mass

v means volume.

Throwing a snowball during snowball fight is most like an example of

Answers

ittttt’ssss erosion.

what is the empirical formula of A compound is found to contain 39.12 % carbon, 8.772 % hydrogen, and 52.11 % oxygen by mass.

Answers

Answer:

C₃H₈O₃

Explanation:

Let's assume we have 100 g of said compound. Then we would have:

39.12 g of C8.772 g of H52.11 g of O

Now we convert those masses into moles, using their respective atomic weights:

C ⇒ 39.12 g ÷ 12 g/mol = 3.26 mol CH ⇒ 8.722 g ÷ 1 g/mol = 8.722 mol HO ⇒ 52.11 g ÷ 16 g/mol = 3.26 mol O

Then we divide those moles by the smallest number among them:

C ⇒ 3.26 mol C / 3.26 = 1H ⇒ 8.722 mol H / 3.26 = 2.68O ⇒ 3.26 mol O / 3.26 = 1

Finally we multiply those numbers by 3, so as to convert the 2.68 of H into an integer:

C ⇒ 1 * 3 = 3H ⇒ 2.68 * 3 = 8O ⇒ 1 * 3 = 3

Thus the empirical formula is C₃H₈O₃

Other Questions
A similarity between Woodrow Wilson and Theodore Roosevelt was that bothO believed monopolies were bad for the country.O kept the United States out of foreign wars.O were candidates for two different parties.O were strong champions for the environment Select the sentence that contains a noun clause. BRAINLIST Leah spent three times the amount Damean spent on CDs. Damean spent $33.87. How much did Leah spend on CDs? Choose one of the three themes (social oppression, greed, or good vs. Evil) and explain something you know about it in the real world OR explain where else you have seen the theme (a book, movie, show, etc.) Please help quick A 12,000-gallon pool is being filled at a rate of 40 gallons per minute. At this rate, how many minutes will it take to fill the pool 3/4 full? Explain the role that Benjamin Franklin played during the American Revolution.. 1. Many plants can reproduce asexually. How is this an advantage for the plant? Why can it sometimes be a disadvantagefor the plant? Use details to support your answer. PLS ANSWER ASAP. ILL GIVE BRAINLIEST! Match the system for each of the following bodily organs.1.Nose a. Skeletal System2.Skull b. Circulatory System3.Kidneys c. Urinary System4.Veins d. Respiratory System plz help timed MATHHHH 12 pointes Use the restriction enzyme EcoRi to cut DNAVictim DNA :GGAAG ATTCTACATTACTGACGGACGTGACGTGACCTTCTTAA GATGTAATGACTGCCTGCACTGACTNumber of restriction fragments ( pieces of DNA after digestion) :Size of restriction fragments ( count the number of bases on the top strand of each fragment , listed from largest to smallest ) :Suspect 1 DNA :GGAATTAAGCTTATTG AATTCTTATAG AATTCGGGGCCCAAGCTTATG AATTCAATT CCTTAATTCGAATAACTTAA GAATATCTTAA GCCCCGGGTTCGAATACTTAA GTTAANumber of restriction fragments ( pieces of DNA after digestion) :Size of restriction fragments ( count the number of bases on the top strand of each fragment , listed from largest to smallest ) :Suspect 2 DNA :CCATATAG AATTCAAGCTTAAG AATTCGGGGGAACGTTG AATTCAATTAATTGGGGGTATATCTTAA GTTCGAATTCTTAA GCCCCCTTGCAACTTAA GTTAATTAACCCNumber of restriction fragments ( pieces of DNA after digestion) :Size of restriction fragments ( count the number of bases on the top strand of each fragment , listed from largest to smallest ) :PLEASE HELPPP!!!!I WOULD APPRECIATE A LOT :) Select one of the readings in this unit, EXCEPT the Gettysburg Address, and in at least 150 words, discuss the historical context or cultural context the author demonstrates. How did Tisquantum help the Pilgrims????i will give brainliest and extra points Find the value of x in the image Read and choose the option with the regular verb in the imperfect tense.La princesa ley el libro.El rey no hablaba.La reina fue a la torre.El prncipe tom caf, Do you believe that parents should have all of the powers described in the Parents Constitution? Why or why not? kareem drew a diagram to compare flatworms and segmented worms which label belongs in the area marked X?a. can reproduce sexuallyb. are always parasites c. are all sessiled. are covered in setaePLEASE HELP Someone pls help me with both :( An ant bed contains about 230 ants. If there are 6 of these beds on the playground, how many ants are there? What was an effect of the Teapot Dome scandal?A. It increased public support for U.S. membership in the League ofNations.B. It increased public support for signing the Treaty of Versailles.O C. It resulted in laws passed by Congress to reform federal elections.D. It confirmed public concerns about relationships betweenbusiness and the Harding administration. Can yiu ANSWER ALL OF THEESE QUESTIONS :1.Its cost $10.00 for 20 oranges. Is $2.00 per orange accurate? 2.Find the unit rate for 5 cans of chicken soup that cost a total of $2.00.