Answer:
Rocks within the mantle contain more magnesium and iron than the ones in the crust. Difference: Rocks in the deep mantle are under intense heat and pressure.
List some animals affected by soda cans and plastic bottles
Answer:
turtles, fishes, birds, whales, cats, dogs, really any animal can be affected
Explanation:
(any animal in the ocean) mark as brainliest plz
which describes a eukaryotic cell,but not a prokaryotic cell?
A student states that petrification occurs when pore spaces in an organism's remains are filled with minerals that precipitate out of solution. What is wrong with this statement?
A.
Permineralization occurs when pore spaces in an organism's remains are filled with minerals that precipitate out of solution.
B.
Petrification occurs when once-living tissues are replaced by minerals, preserving the organism's structure.
C.
Both A and B describe errors in the statement.
D.
Nothing, this statement is correct as is.
Answer:
C. Both A and B describe errors in the statement.
Explanation:
In fossilization i.e formation of fossils, two terms are used as follows: permineralization and petrification.
- Permineralization is a process whereby the pore spaces of an organism's remains are filled with mineral matter that precipitates from lake and ocean solutions.
- On the contrary, petrifaction or petrification is the process whereby a once-living tissue (matter) are REPLACED by minerals, hence, preserving the organism's structure by turning it into a stone (petros).
According to this question, the student mixed up their definitions by giving the definition of permineralization instead, however, options A and B have described the errors associated with the statement.
(GIVING BRAINLIEST!!)
James made the following table to compare the common characteristics of planets. Which of the following would best replace X?
A) Asteroids
B) Comets
C) Moons
D) Stars
Answer: moons
Explanation:
Mars and Neptune both have moons
Answer:
hi answer is moons
Explanation:they have moons :)
Fossil remains of Glossopteris (an extinct plant with large leaves) have been discovered in India and Australia. When they were living, all the Glossopteris were located together on land, but now the Glossopteris fossils are separated by an ocean. What could explain how these fossils got so far apart?
Answer:
Due to splitting of lands.
Explanation:
These Glossopteris fossils got so far apart from each other because of the splitting of super continent about 175 million years ago. Before 175 million years, India and Australia are attached to each other and these Glossopteris plants are present on these lands but with the passage of time, the lands of India and Australia split and go far away from each other so due to splitting of lands, these fossils got so far apart from each other.
What is mass transport across the cell membrane
What is the difference between a detritivore and a decomposer?
A.While detritivores consume animals, decomposers only consume plants.
B. While detritivores feed on dead organic matter, decomposers actually break down dead or decaying organisms.
C. While detritivores consume both plants and animals, decomposers only consume dead animals.
D. While detritivores are heterotrophic, decomposers are autotrophic.
Detritivores are organisms that feed on the organic waste of dead plants and animals
What are decomposers?Decomposers are organisms that break down dead or decaying organisms; they carry out decomposition, a process possible by only certain kingdoms, such as fungi. Decomposers are the organisms that decompose dead plants and animals.
Difference between detrivores and decomposersOption C is the the correct answer
While detritivores consume both plants and animals, decomposers only consume dead animals.
Read more about organisms
https://brainly.com/question/25832580
Answer:
While detritivores feed on dead organic matter, decomposers actually break down dead or decaying organisms.
Explanation:
The answer explains itself. It is accurate information. :) Have a good day!
PLEASEE help me answer this question!??
Answer:
a or b.
Explanation:
it can be in ts regular form solid or it just formed like a liquid
Answer:
B. liquid I think.
Explanation:
or solid bc coal is a solid.
thats all i got.
1. DNA: ATACGAAATCGCGATCGCGGCGATTCGG
mRNA:
Codon:
Anticodon:
Amino Acids:
The cell membrane is made up of a lipid bilayer as shown in the model. Which of the following describes the structure and function of the cell membrane?
56 points!!!!!!
Answer:
The hydrophilic head groups of the lipid molecules are exposed to the outside of the cell and the cytoplasm, which is a water-like environment. The hydrophobic tails form an oily layer inside the membrane that keeps water out of the cell
Explanation:
Cell membrane is selectively permeable in nature. The hydrophilic head groups of the lipid molecules are exposed to the outside of the cell, which is a water-like environment and hydrophobic tails form an oily layer inside the membrane. Thus, correct option is A.
What is Plasma Membrane?Plasma membrane is also known as the cell membrane. It is found in all types of cells that separates the interior of the cell from the outside environment. In bacterial and plant cells, a cell wall is also found which covers the cell membrane.
The cell membrane consists of three classes of amphipathic lipids: phospholipids, glycolipids, and sterols. Plasma membrane is selectively permeable in nature, it allows only some material to pass through it while blocks other material from entering through it.
The portions of the integral membrane protein found inside membrane are hydrophobic, while portions which are exposed to the cytoplasm or extracellular fluid tend to be hydrophilic in nature. Molecules that are hydrophobic can easily pass through the plasma membrane while hydrophilic particles cannot pass through the membrane easily.
Therefore, correct option is A.
Learn more about Plasma membrane here:
https://brainly.com/question/24588191
#SPJ5
A molecule of oxygen gas contains two:
O molecules
O elements
O atoms
Answer:
O atoms
Explanation:
:)))
A molecule of oxygen gas contains two atoms of oxygen bonded together.
Answer: your answer will be C
During which phase of mitosis do the chromosomes pull away from the middle of the cell?
In Anaphase of mitosis chromosomes pull away from the middle of the cell.
During this period the replicated chromosomes are split and moved to the opposite poles of the cells.What is mitosis?It is the process by which cell replicates its chromosomes and then segregates them, producing two identical nuclei in preparation for cell division.
What are chromosomes?It is along DNA molecule with part or all of the genetic material of an organisms.
To know more about mitosis here
https://brainly.com/question/26678449
#SPJ2
Are gender traits completely a result of societal expectations?
Answer:
No. Gender traits in humans are largely determined by biophysical processes. There seems to be a vocal political faction that is trying to convince people in the name of liberty and equality that gender traits are completely learned, and therefore arbitrary. But this claim disagrees with scientific evidence. In general, boys play more with cars and girls play more with dolls not because their parents are perpetuating outdated gender stereotypes, but because their brain is telling them to. This fact does not mean that boys have to play with boy toys, or that boys who play with dolls aren't really boys. It is just a scientific observation about average behavior and its link to fetal development.
What two elements of weather are affected by air masses
Answer:
The air masses separated by a front usually differ in temperature and humidity. Cold fronts may feature narrow bands of thunderstorms and severe weather, and may on occasion be preceded by squall lines or dry lines. Warm fronts are usually preceded by stratiform precipitation and fog.
Which model below shows a prokaryotic cells?
Answer:
Modle two as it is singular, simple with a flagellum
Explanation:
What do we mean when we say that the resulting ADP molecule is recycled?
Which ecosystem most likely has the greatest biological diversity and therefore the highest sustainability A. A tank that includes several goldfish B. Tundra region that has many penguins C. A pine tree in which three groups of birds live D. A rainforest that has many different types of plants and animals
Answer:
definitely D because a rainforest is extremely vast when it comes to different species
Explanation:
brainliest plz?
The ecosystem which is most likely has the greatest biological diversity and therefore the highest sustainability is a rainforest that has many types of plants and animals. Therefore, the correct option is D.
What is ecosystem?An ecosystem refers to the biological community where the biotic as well as the abiotic components interact with each other and influence each other.
It encompasses all the living organisms in a specific area as well as physical and chemical factors that shape their environment such as air water soil climate and environment. They play an important role in functioning the earth's biosphere, as they provide a range of essential services.
The study of ecosystem and interaction between is components is referred to as ecology. Hence, the correct option is D.
For more details regarding ecosystem, visit:
https://brainly.com/question/15011558
#SPJ6
Atmospheric nitrogen, in its gaseous form, is useful to plants. *
True
False
Answer:
true
Explanation:
Answer:
False.
Explanation:
Atmospheric Nitrogen, in its gaseous form, is harmful to Plants and Animals.
Have a great day! (:
In what ways is the composition of the sun different from the Earth? Choose all that apply.
The Sun does not have continents.
O The Sun has a thick, solid core.
O The Sun does not have a solid surface
The Sun does not have a solid core.
The Sun has continents known as plasma zones.
Answer:
1,3,4
that's my answerrrr
How many chlorine atoms are there in the molecule NiCl2
Answer:
2, that’s what the 2 means.
Explanation:
please answer asap! anatomy final exam!! thanks:)
Describe what lymph is and how it travels throughout the body. What would happen if the lymphatic system did not drain interstitial fluid from the body?
Answer:
A fluid that flows through the lymphatic system is called lymph. it travels when you breathe and move your muscles the lymph continuously get pushed towards the heart from the outer reaches of your body. if the lymphatic system didn't drain interstitial fluid then the lymph fluid would build up in the body's tissues, making them swell.
A _______________ from the sun hits chlorophyll and excites an electron, known as __________________________________.
Answer:
Photon, light dependent reaction of photosynthesis
Explanation:
Photosynthesis is the process by which green plants make their own food in the presence of sunlight and water.
There are two steps of Photosynthesis that include light dependent reaction and light-independent reaction.
In light dependent reaction, a photon from the sun is absorbed by the green pigment in leaves called chlorophyll that allow the electron to excite from ground energy level to high energy level. It converts the solar energy into chemical energy and called light dependent reaction of photosynthesis.
Hence, the correct answer is "Photon, light dependent reaction of photosynthesis".
Which is required for sexual reproduction
Answer:
meiosis
Explanation:
meiosis is used to produce gametes for sexual reproduction
Answer:
Meiosis, and female and male
Explanation:
Sexual reproduction is a reproduction that requires a male and a female of the same species to contribute genetic material. Special cells called gametes are produced through meiosis, which halves the number of chromosomes in each resulting cell. These cells are called haploid gametes.
what would be the most beneficial towards maintaining equilibrium in an ecosystem over a long period of time?
a)organisms imported by humans from other environments
b)a sudden change in climate
c) a diversity of organisms
d)predators eliminated from the food chains
Answer:
c) a diversity of organisms
Explanation:
Biodiversity refers to the number of different species of animals,plants and microorganisms.Biodiversity increases ecological stability in changing environments.Biodiversity reduces competition ,provide more food resources,increases ecosystem productivity etc.
As scientists advise about potential risks due to climate change, many coastal areas are preparing for a higher risk of impact Predict
which of these has a greater impact on human health in coastal areas due to climate change.
Since the coast water is rising,it would be hard to find fresh water. The people would not be able to use the water,because it would be contaminated with bacteria. If all of the ice does melt,most of the fresh water will turn to salt water,and we would have to adapt to a new way of life. People would have to live on higher land,there would be no one to grow crops,and their would be no way that trees would survive,meaning we would not be able to breathe.The worst part of this all is that the Earth's temperature will sky rocket,and it will be so hot,the Earth will kinda be like a huge hurricane.(lol)
Hope this helped and good luck!
-Nea
Answer:
C. Increased severity of tropical storms
Explanation:
Due to increased water temp and increased evaporation
According to Vince Carter, "...the most important aspect of getting his degree was the sense of accomplishment it brought. " Use information from the selection and your own ideas to explain what he meant by this statement.
Answer:
the hard work he went through
⚠️Second time posting this⚠️
the factors that control genes are called "alleles".
True
or
false
Answer
Explanation:
I think its true
What is the function of a phospholipid bilayer
Answer:
Phospholipid bilayers create a selectively permeable barrier to the movement of ions and molecules important for cellular function.
Answer: The phospholipid bilayer acts as a barrier to the passage of molecules.
What are the advantages and disadvantages of a honey bees sexual reproduction
Answer:I just learned this.
Explanation: The Advantage is that they have plant pollination and honey.
⦁ In what stage of an animal’s life cycle do most cells differentiate?
Answer:
Reproduction
Explanation:
Answer:
Animals and plants produced by sexual reproduction begin life as a single cell, a fertilised egg or zygote . These cells must divide by mitosis to produce a multicellular organism.