How does this new setting positively impact the Jewish passengers?

Answers

Answer 1

Answer:

WHAT DO you mean

Explanation:

???????? i need an aliby


Related Questions

PLEASE HELP!!! WILL GIVE BRAINLIEST, 5-STAR RATING, AND THANK YOU!
Helpful answers really appreciated!

Dissect and analyze the allegory of the man overboard from: "A man overboard!
What matters it? The vessel does not halt. The wind blows. That sombre ship has a path which it is
forced to pursue. It passes on.
The man disappears, then reappears; he plunges, he rises again to the surface; he calls, he stretches
out his arms; he is not heard. The vessel, trembling under the hurricane, is wholly absorbed in its own
workings; the passengers and sailors do not even see the drowning man; his miserable head is but a speck
amid the immensity of the waves. He gives vent to desperate cries from out of the depths. What a spectre
is that retreating sail! He gazes and gazes at it frantically. It retreats, it grows dim, it diminishes in size. He
was there but just now, he was one of the crew, he went and came along the deck with the rest, he had his
part of breath and of sunlight, he was a living man. Now, what has taken place? He has slipped, he has
fallen; all is at an end.
He is in the tremendous sea. Under foot he has nothing but what flees and crumbles. The billows, torn
and lashed by the wind, encompass him hideously; the tossings of the abyss bear him away; all the
tongues of water dash over his head; a populace of waves spits upon him; confused openings half devour
him; every time that he sinks, he catches glimpses of precipices filled with night; frightful and unknown
vegetations seize him, knot about his feet, draw him to them; he is conscious that he is becoming an abyss,
that he forms part of the foam; the waves toss him from one to another; he drinks in the bitterness; the
cowardly ocean attacks him furiously, to drown him; the enormity plays with his agony. It seems as
though all that water were hate.
Nevertheless, he struggles.
He tries to defend himself; he tries to sustain himself; he makes an effort; he swims. He, his petty
strength all exhausted instantly, combats the inexhaustible.
Where, then, is the ship? Yonder. Barely visible in the pale shadows of the horizon.
The wind blows in gusts; all the foam overwhelms him. He raises his eyes and beholds only the
lividness of the clouds. He witnesses, amid his death-pangs, the immense madness of the sea. He is
tortured by this madness; he hears noises strange to man, which seem to come from beyond the limits of
the earth, and from one knows not what frightful region beyond.
LES MISÉRABLES 114
There are birds in the clouds, just as there are angels above human distresses; but what can they do
for him? They sing and fly and float, and he, he rattles in the death agony.
He feels himself buried in those two infinities, the ocean and the sky, at one and the same time: the
one is a tomb; the other is a shroud.
Night descends; he has been swimming for hours; his strength is exhausted; that ship, that distant
thing in which there were men, has vanished; he is alone in the formidable twilight gulf; he sinks, he
stiffens himself, he twists himself; he feels under him the monstrous billows of the invisible; he shouts.
There are no more men. Where is God?
He shouts. Help! Help! He still shouts on.
Nothing on the horizon; nothing in heaven.
He implores the expanse, the waves, the seaweed, the reef; they are deaf. He beseeches the tempest;
the imperturbable tempest obeys only the infinite.
Around him darkness, fog, solitude, the stormy and nonsentient tumult, the undefined curling of
those wild waters. In him horror and fatigue. Beneath him the depths. Not a point of support. He thinks of
the gloomy adventures of the corpse in the limitless shadow. The bottomless cold paralyzes him. His
hands contract convulsively; they close, and grasp nothingness. Winds, clouds, whirlwinds, gusts, useless
stars! What is to be done? The desperate man gives up; he is weary, he chooses the alternative of death; he
resists not; he lets himself go; he abandons his grip; and then he tosses forevermore in the lugubrious
dreary depths of engulfment.
Oh, implacable march of human societies! Oh, losses of men and of souls on the way! Ocean into
which falls all that the law lets slip! Disastrous absence of help! Oh, moral death!
The sea is the inexorable social night into which the penal laws fling their condemned. The sea is the
immensity of wretchedness.
The soul, going down stream in this gulf, may become a corpse. Who shall resuscitate it?"

Answers

Answer:

Hamkoosd

Explanation:

Which sentence from “Island of Hope, Island of Tears” contains both a cause and an effect?

“Salvatore, Giuseppe Sicurella's brother, was employed as a barber.”
“Her brother placed a housework-wanted ad in a local paper, and Katherine was soon hired as a governess with a wealthy family.”
“He was 22 years old and felt a responsibility to help his mother and 12 brothers and sisters.”
“His brother Salvatore followed in 1908 and their siblings Antonio, Maria Anna, and Angelina joined them in 1913.”

Answers

Answer: is B

Explanation:

:)

Answer: the answer is B

Explanation: I took the assignment in edge

Hope this is helpful

Write an antonym for each of these comments made about a buffet dinner. Preposterous, Gigantic, Extravagant, Fetid, Superfluous, Colossal.​

Answers

Answer:

preposterous-reasonable

gigantic-tiny

extravagant-thrifty

fetid-fragrant

superfluous-neccesary

collosal-tiny

Explanation:

if you think its wrong dont answer

What are you most thankful for this year?

Answers

Answer:

my dog

Explanation:

his name is chester and hes an adorable and sweet boi

I am most thankful for my family, friends, and God!!

Most importantly my baby puppy Louie

vision of the future exposition

Answers

Answer:

Are you talking about the Stars Wars novel if not tell me I can help you through chat time

Explanation:

Answer: is this supposed to be an question or just an random

Explanation:

what is the effect of density on rocks?

Answers

Answer:

density is defined as the mass of a substance per unit volume, and is highly variable in crustal rocks. Rock density is a physical characteristic that is governed by the chemical composition (in situ minerals) and pore spaces of a specific rock or rock type.

Explanation:

Which revision is needed to correct the following sentence?
"The new student council officers will suggest easy fun activities at the short planning meeting."
A. Add a comma after the word easy.
B. Add a comma after the word new.
C. Add a comma after the word short.
D. Add a comma after the word council.​

Answers

Answer:

The new student council officers will suggest easy fun activities at the short planning meeting."

A. Add a comma after the word easy.

Explanation:

The new student council officers will suggest easy, fun activities at the short planning meeting."

Answer: add a coma after the word easy

Read the following excerpt from the article "Volunteers Count Every Street Tree in New York City." As you read, think about which statements are opinions and which ones are facts.

Did you know? Over 80 percent of the U.S. population lives in cities or metropolitan areas, making urban trees more important than ever. Trees bring many benefits to human health--they filter air pollution, release oxygen, reduce mental stress, and absorb rainwater and noise. Trees in cities connect rural forests and parks to the urban landscape, creating habitat linkages for wildlife species like migratory birds. These are some of the many reasons the U.S. Forest Service supports trees in urban areas, and why the City of New York has been recruiting residents to count its trees for decades.

Which of these statements is an opinion?

a. "Trees in cities connect rural forests and parks to the urban landscape. . . ."
b. "[U]rban trees [are] more important than ever."
c. "Over 80 percent of the U.S. population lives in cities or metropolitan areas. . . ."
d. "Trees bring many benefits to human health. . . ."

Answers

Answer:

B

Explanation:

Can everybody that sees this go subscribe to my YT Channel KingEli322  please I'm trying to get to 1,000 subs before January 1, 2021 Please help me reach my goal

The correct response is - "[U]rban trees [are] more important than ever.". Therefore option B is correct.

What is Population?

The term "population" usually refers to the total number of people living in a certain area, such as a city or town, region, nation, continent, or entire planet.

Making decisions can be aided by knowledge of how population parameters, such as size, regional distribution, age structure, or birth and death rates, vary over time.

By 2022, the global population is expected to increase at a pace of around 0.84% annually, down from 1.05% in 2020, 1.08% in 2019, 1.10% in 2018, and 1.12% in 2017. Currently, 67 million individuals are added to the population annually, according to estimates.

Any whole group that shares at least one trait is referred to be a population. People do not make up all populations. People, animals, and other types of life are all examples of populations.

To read more about Population, refer to - https://brainly.com/question/27779235

#SPJ2

The soldiers most likely know about the Highwayman returning to the inn because

Answers

Answer:

plz give more info

Explanation:

The Redcoats knew that the highwayman was coming to the inn because Tim reported what he had overheard. How did the soldiers tie Bess up? ... The Redcoats kill the highwayman, but he and Bess return to the inn as ghosts.

Select the correct answer.
Which statement about understanding the meaning of a poem is true?
A.
There is only one interpretation of a poem’s meaning.
B.
The meaning of a poem could be anything.
C.
It may take several readings to understand a poem’s meaning.
D.
A poem’s meaning becomes clear in the first reading.

Answers

Answer:

C but see below.

Explanation:

A or B are exact opposites. They are both too shallow and too extreme.

Good poetry is sometimes too subtle to be understood on the first reading. Not D.

C

Which of the following statements reflects the main message of Lincoln's address?

All African Americans were entitled to the same rights as white Americans.

The Civil War was unnecessary and ridiculous and the fighting needed to stop immediately.

Slaves should be freed and should receive the rights to vote and to own property.

None of the choices are correct.

Answers

The answer is
None of these choices are correct
I got this question for my test


please help me


What is the difference between substance-use disorders from substance-induce disorders?What is the difference between substance-use disorders from substance-induce disorders?​

Answers

Answer:substance ise disorder is non immediate but occurs overtime as addiction progresses while subtsance induced is immediate affect of substance use

Explanation:

A substance-use disorder is an addiction to some substance, the person thinks that they can’t live without that substance.
A substance-induced disorder is a disorder that is caused or worsened by the said substance.

i have to type a page of Informational what should i do afton family mha or 5 nights at freddys

Answers

Answer:

5 nights at freddys5 nights at freddys5 nights at freddys5 nights at freddys5 nights at freddys5 nights at freddys

Explanation:

Answer:

mha totally

Explanation: its a cool anime

:p

What is the difference between the phrase "Live the actual moment," which appears in the poem, and "Live IN the actual moment," which is a commonly used phrase in conversation and on inspirational posters?

Answers

Answer:

though the phrase "Live the actual moment" is similar to "Live in the actual moment", there is a difference in the meaning of these two phrases.

Explanation:

In the poem "Drink Your Tea", though the phrase "Live the actual moment" is similar to "Live in the actual moment", there is a difference in the meaning of these two phrases.

When we say 'live in the actual moment', it sounds like a suggestion we can choose. It does direct nor commands us but suggests that we should focus on what we are doing while we are doing it.

However, when the author says "Live the actual moment", he commands us to be the reason why the entire action is taking place while we are doing something. It is not only about focusing and being present in the action but becoming the reason of the action itself.

Use the adjective ________ to describe something or someone open to being physically or emotionally wounded, like a newborn chick or an overly sensitive teenager.

Answers

Answer: vulnerable

Explanation:

A dash is most often used to do which of the following?
Select one:
mark the beginning of a quotation
indicate a sudden change in thought
begin a dramatic monologue
o о
set up a series of items in a list

Answers

Answer:

indicate a sudden change in thought

Explanation:

"The dash (–) is used to set off additional material within a sentence, often in order to emphasize it, to set off appositives that contain commas, or to indicate missing words."

What does the word idle mean in the sentence from The Hobbit?

Did you come here to ask me idle questions?

dangerous
unimportant
emotional
confusing

Answers

The correct answer is B. Unimportant

Answer:

THE ANSWER IS D

Explanation:

8. The author of "Nolan Bushnell" states that "It's very clear that game playing grows


dendrites. So people are smarter. The brain is something that if you exercise it you can be


smarter. It turns out that games are that exercise." because


he believes that gaming and technology can hinder the chao

Answers

Answer:

The author believes that games and technology stimulate the brain and this trains people to reason and solve complex problems, such as problems that generate chaos.

Explanation:

The author claims that a person with smart intelligence has a well-trained brain. This allows these people to be able to develop strategies and quick solutions to serious and complex problems. One way to train the brain is through the execution of games that pose challenges of different difficulties, through technology.

Thus, the author shows that technology and games can promote people capable of solving serious problems that could cause chaos in society.

Select all that apply.

The second and third levels of importance represented in Figure 2 are: _____.

Paragraph headings
Chapter subsections
Title
Chapters

Answers

title and paragraph headings .

do gender stereotypes still impact today's society?​

Answers

Answer:

yes

Explanation:

Answer:

Yes, they do. Gender stereotypes are everywhere, if you think about it. If you go to the store, and look at the little girl's section, what color dominates that section? Pink. Pink has been considered a feminine color for decades, and that is an example of a common stereotype.

Explanation:

I'm a big nerd about this stuff, so I hope I helped! :)

Read the adapted excerpt from Gulliver's Travels by Jonathan Swift.
"But I should have mentioned that before the principal person began his oration, he cried out three times, Langro debul san (these words,
and the former, were afterwards repeated, and explained to me). Whereupon Immediately about fifty of the inhabitants came and cut the
strings that fastened the left side of my head, which gave me the liberty of turning it to the right, and of observing the person and gesture of
him that was to speak. He appeared to be of a middle age, and taller than any of the other three who attended him, whereof one was a
page that held up his train, and seemed to be somewhat longer than my middle finger, the other two stood one on each side, to support
him. He acted every part of an orator, and I could observe many periods of threatenings, and others of promises, pity, and kindness."
Which choice provides the best objective summary of the excerpt?
A. The narrator is bound but an orator comes out and orders his ties to be cut. This orator seems to be the leader as he is dressed formally and has others to support him. All follow his commands.
B. The narrator, tied down, watches as a leader of the group orders his ties to be cut so that he can turn his head. This leader seems to issue threats but also shows kindness.
C. The narrator is very confused as he is tied and cannot move, the inhabitants are speaking a language he does not understand,
and now an orator is both threatening him and showing pity.
D. The narrator is tied down and cannot move until a leader orders his ties be cut. This leader, whom the narrator cannot understand, seems to show a variety of different moods.

Answers

The statement that provides an objective summary of this passage is

B. The narrator, tied down, watches as a leader of the group orders his ties to be cut so that he can turn his head. This leader seems to issue threats but also shows kindness.

In this excerpt, the narrator describes how an orator issues an order for him to be untied from a place where he was made to undergo some form of punishment.

His description of this orator is that of a person who commands followership. He has powers in his hands and is capable of showing both kindness and meanness.

In the narrator's case, he had just benefitted from his kindness.

In summary, Option B provides an objective summary of the excerpt.

Learn more about Gulliver's Travels here:

https://brainly.com/question/15979299

Answer:

B. The narrator, tied down, watches as a leader of the group orders his ties to be cut so that he can turn his head. This leader seems to issue threats but also shows kindness.

Explanation:

Which states how the main text convinces readers that microbes help humans? It argues that more needs to be done to understand microbes. It compares microbes to fungi, protozoa, and viruses. It lists details about what scientists have learned about the benefits of microbes. It tells the story of how scientists have learned about microbes.

Answers

Answer:

It lists details about what scientists have learned about the benefits of microbes.

Explanation:

Hello. You did not provide the ceiling to which this question is related, but the only statement that shows a way that scientists would use to show that microbes help humans is by making a list of what they have learned about the benefits that microbes can to tease. These benefits, in fact, are many, such as the manufacture of food, medicines, agricultural products, the composition of the intestinal flora, the ability to decompose matter, among others.

Answer:

It lists details about what scientists have learned about the benefits of microbes

Explanation:

i took the test

which sentence shows future tense. 10 points
1. the dog followed me home
2.grandma will visit us tomorrow
3. i am learning to cook
4. the bear climbed the tree

Answers

sentence 2 shows future tense

Answer:

Grandma will visit us tomorrow.

Explanation:

President Trump’s policy and President Elect Biden’s policy on Nuclear Energy. Is nuclear energy poised to be part of America’s future? Explain why or why not.

Answers

Sorry I just need to open messeges

Can anyone answer this ASAP?

Answers

Voting is important because it’s every American individuals civic duty to get their voice heard and determine the future of their country

Answer:

Voting is important because it is what makes up democracy. Even though someone may say "Oh, I'm just one vote and it doesn't count that much." doesn't mean that's true. There are a lot of citizens in the US who don't vote and they might just be thinking that their vote wouldn't count anyway when it actually would. If all of the people who didn't vote actually voted for what they wanted and knew to be right, they could change the outcomes of elections. Each vote counts, you never know, maybe your choice if one away from losing but when you vote for them- they have more of a chance to pull through and win.

Explanation:

I hope this helps.

“Many grocers switched back to single-use plastic bags and prohibited customers from bringing their own reusable bags.” --- “One company marketing single-use menus online provides an estimate of how many throwaway menus might be needed.” What does it mean if an item is single-use?

Answers

Answer:

means you can only use it once and it can not be reused.

Explanation:

Can an audience still experience catharsis if the
tragic hero is not elevated in rank or ability?​

Answers

Answer:

NO THEY CANT

Explanation:

Answer:yes

Explanation:

Yes, an audience can still experience catharsis even if the tragic hero is not elevated in rank or ability. The key to catharsis lies in the audience's emotional connection to the character and their journey, rather than their social status or abilities. As long as the audience can empathize with the character and feel their emotional turmoil, they can experience catharsis through the character's eventual downfall and the resulting emotional release.

How did Gutzon Borglum change
the original idea for Mount
Rushmore?

Answers

Answer: look at the picture

Explanation: hope this help;)

Gutzon Borglum actually changed the original idea for Mount Rushmore because: He wanted the carvings to be made by a different artist.

About Gutzon Borglum

Gutzon Borglum was known to be an American sculptor. He is best known for his work on Mount Rushmore. Borglum is also known for his work of art on Stone Mountain in Georgia.

We can see that Borglum actually changed the original idea for Mount Rushmore because he actually wanted the carvings to be made by a different artist.

Learn more about Mount Rushmore on https://brainly.com/question/9015570

3. Let's put the camera on this so that it won't wiggle as much!
A) quadruped B) peddler
pedestrian
D) tripod
4. Most bicycles have two of these that make the wheels turn around
A) pedals B) peddlers
impediments D) pedestrians
5. Gerald looked through the peek hole in his front door and saw one of these holding a
box of candy
A) pedestrian B) millipede C) quadruped D) peddler
6. Did you see Chloe's pet? It must have a thousand legs! It's one of these.
A) centipede B) quadruped C) millipede D) biped
7. Logan, Zack, and Ryan are smart. They always look both ways and use crosswalks.
What are they?
A) peddlers B) pedestrians centipedes D) quadrupeds
8. Tanya jumped when she saw one of these crawling across her living room! She's sure it
had a hundred legs!
A) centipede B) millipede Cbiped D) quadruped
9. Although Marissa walked with a limp, she didn't let this
A) impediment B) pedestrian C) peddler
get in her way
D) pedicure
10. Most of these living things walk upright rather than crawling
A) bipeds B) quadrupeds C) millipedes
D) peddlers

Answers

Answer:

3.D

4.A

5.D

6.B

7.B

8.A

9.A

10.A

Explanation:

In this excerpt from the Emancipation Proclamation, which phrase or sentence supports the claim that President Lincoln did not want the slaves to take up arms against their former masters?
I do order and declare that all persons held as slaves within said designated States and parts of States are, and henceforward shall be, free; and that the Executive Government of the United States, including the military and naval authorities thereof, will recognize and maintain the freedom of said persons.

And I hereby enjoin upon the people so declared to be free to abstain from all violence, unless in necessary self-defense; and I recommend to them that, in all case when allowed, they labor faithfully for reasonable wages.

And I further declare and make known that such persons of suitable condition will be received into the armed service of the United States to garrison forts, positions, stations, and other places, and to man vessels of all sorts in said service.

And upon this act, sincerely believed to be an act of justice, warranted by the Constitution upon military necessity, I invoke the considerate judgment of mankind and the gracious favor of Almighty God.

Answers

i think this one is correct:::::::

And I hereby enjoin upon the people so declared to be free to abstain from all violence, unless in necessary self-defense; and I recommend to them that, in all case when allowed, they labor faithfully for reasonable wages.

Other Questions
I need help ASAP!!!!!!!! PLEASE CORRECT ANSWER!A student writes an incorrect step while checking if the sum of the measures of the two remote interior angles of triangle ABC below is equal to the measure of the exterior angle.A triangle ABC is shown. The base of the triangle extends into a straight line. The angle formed between this straight line and the edge of the triangle is marked as w. The angle adjacent to w is marked as z, and the other two angles inside the triangle are marked as x and y.Step 1: mx + my + mz = 180 degrees (sum of angles of a triangle)Step 2: mw mz = 90 degrees (corresponding angles)Step 3: Therefore, mx + my + mz = mw + mzStep 4: So, mx + my = mwIn which step did the student first make a mistake and how can it be corrected? (5 points)Select one:a. Step 1; it should be mx + my + mz = 180 degrees (sum of corresponding angles)b. Step 2; it should be mw + mz = 180 degrees (supplementary angles)c. Step 1; it should be mx + my + mz = 90 degrees (corresponding angles)d. Step 2; it should be mw + mz = 90 degrees (alternate exterior angle) Harder equationsSolve these equations:3x + 3 = -6. X= A prime number has two factors, itself and 1? * AABB Rhythm poem christmas themed. pls can you make 3 stanza of AABB poem. pls help me what is the role of the grana in chloroplast? Which of the following will NOT help reduce the costs of car ownership? A. Carpooling and safe driving B. Performing maintenance tasks on your own C. Speeding D. All of the above 5TH GRADE LEVEL QUESTION: look at photo and answer. A school has 617 students. Each class has between 28 and 32 students. Which is the best estimate of the number of classes in the school?14 classes20 classes30 classes60 classes Whats the corresponding mRNA strand for this DNA strand: TACGGGATAAGGCCACCTCTGGTAGACCACATT 20 POINTS!!!!!!Which of the following is probably not an effect of urban sprawl?A. the loss of habitats and biodiversityB. decreased shortages of water and other resourcesC. increased temperatures in summer monthsmore air pollution that is harmful to human healthPlease select the best answer from the choices providedABCD GMMThe numbers are36XAnd 46 degrees QUESTION 10 of 10: You have a need to purchase 30 units of a product and have them delivered to your company in five days. The sale price is $35 each. Sales tax on the product is 8%. Shipping price is $15. But there is also a 25% rush charge on the sales price added for deliveries less than seven days, which is also taxable. What will be the total cost of this purchase? O a) $1,050.00 b) $1,327.50 Oc) $1,396.50 O d) $1,432.50 A 12 N net force is applied to an object as it moves a distance of 3.0 m: Use theWork-Kinetic Energy Theorem to determine the object's change in kinetic energy.Enter your answer in Joules. plz help i need help im failing Simplify as far as possible.182 Part B: A triangle has vertices A (-2, 3), B (0, 0), and C (1, 2). What are the coordinates of the vertices if the original triangle is dilated by a scale factor of 3 and then reflected over the x-axis? 6th grade history i mark as brainliest A medium artichoke contains about 14% of the recommended amount of a certain mineral an average adult should have each day. About how many grams of the mineral should the average adult have each day? I walked into that reading room a happy healthy man. I crawled out a decrepit wreck Complete each statement by choosing the correct family member that best fits the description.Select the correct answer from each drop-down menu.El padre de mi padre es miEl hijo de mi ta es miLa madre de mi madre es mivEl hijo de mi padre es miLa hija de mi to es mi