Help please, por favor for 10 points

Answers

Answer 1

2. Tengo
3. Roja
4. Ir
5. Esta
6. Nerviosa
7. El
8. Guardar
9. Gusta
10. Estaré

Related Questions

Empareja el artista con la descripción. Match the artist with the description. (4 points)
1.
Un expresionista mexicano, fue un revolucionario con su arte y formó parte del grupo.
2.
Sus obras de colores pasteles e imágenes livianas parecen una foto rápida. Su meta era capturar la luz y los reflejos de la luz contra los objetos mundanos. Así se inspiró el impresionismo.
3.
Es el padre del movimiento que relata con la vista de la emoción y la mente. Su motivo era realizar el arte de los sueños y traer la fantasía a la realidad. Sus obras reflejan lo imaginado con la realidad.
4.
Sus obras abstractas son influidas por el arte de Jean Michel Basquiat y Jackson Pollock. Inició la idea de las cajas pintadas que representan la paz. La idea fue muy popular y sus cajas vacías son obras de arte también.
a.
José Clemente Orozco
b.
Franck de las Mercedes
c.
Salvador Dalí
d.
Joaquín Sorolla

Answers

De acuerdo con la información podemos inferir que los personajes se relacionan con las definiciones de la siguiente manera: 1. José Clemente Orozco, 2. Joaquín Sorolla, 3. Salvador Dalí, 4. Franck de las Mercedes.

¿Cómo coinciden los personajes y la descripción?

Para encontrar al descripción que corresponde con cada personaje debemos tener en cuenta la profesión y los estilos que destacaron a cada artista. De acuerdo con lo anterior, podemos inferir que la relación es:

Un expresionista mexicano, fue un revolucionario con su arte y formó parte del grupo. - José Clemente Orozco (a)Sus obras de colores pasteles e imágenes livianas parecen una foto rápida. Su meta era capturar la luz y los reflejos de la luz contra los objetos mundanos. Así se inspiró el impresionismo. - Joaquín Sorolla (d)Es el padre del movimiento que relata con la vista de la emoción y la mente. Su motivo era realizar el arte de los sueños y traer la fantasía a la realidad. Sus obras reflejan lo imaginado con la realidad. - Salvador Dalí (c)Sus obras abstractas son influidas por el arte de Jean Michel Basquiat y Jackson Pollock. Inició la idea de las cajas pintadas que representan la paz. La idea fue muy popular y sus cajas vacías son obras de arte también. - Franck de las Mercedes (b)

Aprenda más sobre descripción en: https://brainly.com/question/32171827
#SPJ1

Complete the story about Héctor's childhood using the imperfect tense of the verbs in the list.

Answers

La infancia de Héctor estaba llena de recuerdos entrañables. Solía pasar sus veranos en casa de sus abuelos en el campo. Todos los días, se despertaba temprano al sonido del canto de los gallos. El sol brillaba intensamente, iluminando los campos con un resplandor dorado.

A Héctor le encantaba explorar los extensos prados y jugar cerca del río. Pasaba horas persiguiendo mariposas, recolectando coloridas flores silvestres y trepando árboles. Sus risas llenaban el aire mientras jugaba al escondite con sus primos.

Durante las tardes, Héctor y su familia se reunían alrededor de la mesa de la cena. El aroma de las deliciosas comidas caseras de su abuela impregnaba la habitación. Compartían historias, chistes y risas, creando recuerdos entrañables que perdurarían toda la vida.

Los fines de semana, Héctor solía ir al parque local con sus amigos. Montaban en bicicleta, volaban cometas y jugaban al fútbol hasta que se ponía el sol. Los días parecían interminables mientras disfrutaban de la libertad y la alegría de la infancia.

Héctor tenía un vínculo especial con su perro, Bruno. Pasaban innumerables horas juntos, explorando el vecindario y viviendo aventuras. Bruno meneaba la cola con entusiasmo mientras descubrían nuevos lugares, creando un lazo que nunca podría romperse.

Mientras Héctor rememora su infancia, se da cuenta de cómo aquellos días despreocupados lo moldearon en la persona que es hoy en día. Los recuerdos de aquellos momentos imperfectos le arrancan una sonrisa y los guarda cerca de su corazón, agradecido eternamente por el amor y la alegría que experimentó en sus primeros años.

Yo le (DECIR) "Te quiero" a mi abuela todos los días.

Answers

Answer:

Yo le digo "Te quiero" a mi abuela todos los días.

Explanation:

im fluent in spanish so :)

complete the following sentence with the appropriate present tense of verb in ( )
11. Los profesores___ (pedir) mucho trabajo de nosotros.
12. Yo____(traer) todos los días.
13. Mi mamá____ (servir) cena a las siete de la tarde.
14. Yo___(tener) muchos amigos
15. Mis abuelos___ (querer) que yo les visite.
complete with appropriate direct object pronouns
me trae la leche. me___ trae.
le recomiendo el pollo asado. se___ recomiendo.

Answers

Answer:

11.) Los profesores piden mucho trabajo de nosotros

12.) You traigo todos los días

13.) Mi mama sierve cena a las siete de la tarde.

14.) Yo tengo muchos amigos

15.) Mis abuelos quieren que yo les vesite

me trae la leche. me la trae

le recomiendo el pollo asado. se lo recomiendo

Explanation:

In number 11, the plural form of profesores implies that you would be conjugating the word pedir in the ellos form

(Yo Pido, Tú pides, el pide, nos. Pidemos, vos pidéis, ellos piden)

In number 12, the verb traer, needs to be conjugated in the you form.

(Yo traigo, tú traigas, el traiga, nos traigamos, vos traigáis, ellos traigan)

In number 13, mamá indicates that the verb needs to be conjugated in the El/Ella form

(Yo sirvo, tú sirves, el/ella sirve, nos servimos, vos servéis, ellos sirven)

In number 14, you would need to conjugate tener in the yo form

(Yo tengo, tú tienes, el tiene, nos tenemos, vos tenéis, ellos tienen)

In number 15, abuelos indicate that you would need to conjugate querer in the ellos form

(Yo quiero, tu quieres, el quiere, nos queremos, vos queréis, ellos quieren)

In number 16, leche uses the word la beside it which means you would use it accordingly. In this case, it would be "me la trae"

Number 17 is the same way. el pollo is male which means you would have to use lo to fit the sentence

I really hope this helps! Let me know if you have any questions!

Choose the form of the verb "dormir" that correctly completes each sentence. Some answers may be used more than once and some may not be used at all.

Word Bank: duerme, duermen, dormimos, duermo, dormís, duermes

1. En mi familia, nosotros nunca ___ ocho horas.
2. ¿___ Ana ocho horas?
3. ¿___ tus hermanos ocho horas?
4. ¿___ tú ocho horas?
5. ¿___ tu madre ocho horas?

Answers

1. Dormimos
2. Duerme
3. Duermen
4. Duermes
5. Duerme

Select the command that best fits in each blank.

Word Bank: arregla, corta, pon, haz, da

1. Primero, ____ el césped.
2. Entonces, ____ los dos cuartos. Están muy desordenados.
3. Por favor, ____ la mesa en el comedor.
4. En el dormitorio, _____ la cama, por favor.
5. ___ de comer al perro también.

Answers

1. corta
2.arregla
3.haz
4.pon
5.da

Answer:

Explanation:

cortaarreglaponhazda

Yo lo. Ayer y le. El libro.(ver,dar)

Answers

Answer:

- vi, di.

Explanation:

Yo lo vi ayer y le di el libro.

...

Explain IN ENGLISH how to form the usted form of the imperative of the regular -ar verb hablar.

Answers

The usted form of the imperative of the regular verb -ar hablar can be formed by adding the stem "e" which is used for verbs ending in "ar". In this way, the usted form to hablar in the imperative will be:

HableWhat is the imperative?

It corresponds to a verbal mode that is used as a way to demonstrate verbal actions of orders, requests, suggestions, etc. The form of the verb usted in the imperative for the verb hablar applied in a sentence could be:

Hable mais despacio, please.

Therefore, usted is used in a context when one wants to increase the degree of formality in the address and its imperative form will follow the standard form of regular verb conjugations.

Find out more about imperative at:

https://brainly.com/question/1213815

#SPJ1

Assignment: 04.09 Evaluación Oral

Answers

De acuerdo con la información, la evaluación oral es un tipo de prueba con le que se evalúa el nivel de habla de un estudiante en otro idioma.

¿Qué es una evaluación oral?

Una evaluación oral es un tipo de prueba en la que se evalúa el habla y la capacidad de comunicación de un individuo por medio de habla.

Generalmente este método se utiliza para evaluar la fluidez, la pronunciación, el vocabulario, la gramática, la coherencia y la cohesión del discurso. Las evaluaciones orales se utilizan comúnmente en la enseñanza de idiomas y en la evaluación de habilidades de comunicación.

Nota: Esta pregunta está incompleta. Aquí está la información completa:

¿Qué es una evaluación oral?

Learn more about evaluation in: https://brainly.com/question/20067491

#SPJ1

Plssss help this is due today unit 7 writing assignment

Answers

Answer: man i think it late.....

Explanation:

What outdoor activities do you like to do? Why do you enjoy those activities? What activities don't you like to do? Why?

Write 5 complete sentences in Spanish answering the above questions.

You will be graded on (a) use of correct verb forms (b) appropriate vocabulary usage, and (c) overall quality of each response.

Answers

The outdoor activities that you like in complete sentences in Spanish, could be the following:

Los sábados tengo clases de tenis, que es un deporte muy divertido y trabaja todo el cuerpo.No me gusta el culturismo, prefiero las actividades al aire libre como el senderismo.Todos los días después de la escuela ando en bicicleta por mi barrio, es muy divertido y también practico actividad física.Antes me gustaba hacer yoga, pero ahora prefiero una actividad más intensa, como trotar en el parque.Me gusta jugar al fútbol con mis amigos en el campo de la plaza todos los viernes por la noche.How to learn Spanish?

The student should seek to understand more about the language in a complete way, looking for studies and activities that understand the skills of reading, writing, listening and speaking, thus strengthening their knowledge of vocabulary and grammar.

Therefore, this activity of forming sentences in Spanish helps in the understanding of several grammatical concepts such as nouns, verbs, pronouns and adjectives, being positive for the fixation of knowledge.

Find more about Spanish verbs at:

https://brainly.com/question/7150507

#SPJ1

what would go in the blank:
En nuestra escuela tenemos muchas ___ de participar en actividades

Answers

Answer:

oportunidades

Explanation:

oportunidades means opportunities, meaning:

In our school we have many opportunities to participate in activities

Answer:

- formas.

Explanation:

- En muestra escuela tenemos muchas formas de participar en actividades.

...

5. Había estado muy enfermo debido a un
en ayudarlo. (bacilo/vacilo)
que contrajo, razón por la cual no

Answers

I think it’s “Vacilo”

Other Questions

What unique feature is present only on the thoracic vertebrae?A)dens (odontoid process)B)transverse foraminaC)vertebral foraminaD)superior and inferior costal facets plurality rule with a single-member districts in which the candidate who receives the most votes wins.most widely used chester's andrews corp. ended the year carrying $41,178,000 worth of inventory. had they sold their entire inventory at their current prices, how much more revenue would it have brought to andrews corp.?]turnover rate for this year is 6.27%. this rate is projected to remain the same next year and no further downsizing will occur from automating. what would the total recruiting cost be for chester, assuming it spends the same amount extra above the $1,000 recruiting base as they did this year? a conflict theorist would argue that families are structured to which of the following group of substituents all represent activating groups in electrophilic aromatic substitution reactions Select the correct pronoun to complete this sentence.Neither Toni nor Erika completedO A. theirOB.herAmerican literature course. 10 Point Question 1 Jane figures that her monthly car insurance payment of $190 is equal to 30% of the amount of her monthly auto loan payment What is her total combined monthly expense for auto loan payment and insurance (rounded to the nearest dollar) Enter only the number without $sign S Blank 1 Blank 1 Add your answer 1 Why were reptiles better adapted than amphibians to life on land? Select all that apply. A. They had cutaneous respiration. B. They had thoracic breathing.C. They had watertight skinD.. The had amniotic eggs. Medicare is available to an individual who has worked at least:a. 5 years in Medicare-covered employment, is at least 65 years old, and is a permanent resident of the United Statesb. 10 years in Medicare-covered employment, is at least 62 years old, and is a citizen of the United Statesc. 10 years in Medicare-covered employment, is at least 65 years old, and is a citizen or permanent resident of the United Statesd. 25 years in Medicare-covered employment, is at least 62 years old, and is a citizen of the United States what problems contribute to the tense and volatile situation? consider byte-represented numbers, what are the 1's and 2's complement for the following binary numbers? 00010000? 1's: , 2's: 14 L- {(5+2)(5-5)} 8. (25 points) Use the convolution theorem to calculate L-1 a thread is always more efficient than a process for which two activities? a. thread creation b. sys5 ipc calls c. file open and file write calls d. thread termination At which root does the graph of f(x) = (x - 5)(x + 2)2 touch the x-axis?O-50-20205 Match each function with the name of a major enzyme class.1) transfer functional groups between molecules A) oxidoreductases2) catalyze intramolecular rearrangements B) transferases3) catalyze redox chemistry C) hydrolases4) catalyze the joining of two molecules together D) lyasesE) isomerasesF) ligases which market structure would likely have the highest concentration ratio? Use Pythagoras theorem calculate the length of the hypotenuse in this rightangled give your answer in centimetres and give any decimal answers to 1d. P TRANSLATE the mRNA sequence below into an amino acid sequenceusing your preferred codon chart. Type the ONE-LETTER CODES FORAMINO ACID SEQUENCE AS YOUR ANSWER. DO NOT use dashes oranything else to separate your letters.Type the amino acid sequence you get as your answer. *Use the 1-letter codes forthe amino acids* DO NOT PUT SPACES, DASHES, OR COMMAS BETWEEN THELETTERS!! NOTE: The amino acids should spell a WORD if done correctly.mRNA AACAUGAUGGCCAAAGAGUAAGCCA A cup of coffee is poured, and the temperature is measured to be 120 degrees Fahrenheit. The temperature of the coffee then decreases at a rate modeled by r(t)=55e0.03t2 degrees Fahrenheit per minute, where t is the number of minutes since the coffee was poured. What is the temperature of the coffee, in degrees Fahrenheit, at time t=1 minute? dy/dx + 2/x y = xy, y(1) = 1/2Find y(10) numerically using the following methods and h = 0.5, 0.25, 0.125 and calculate the errors in each case. You have to use MATLAB for this problem. a. Forward Euler's method b. Backward Euler's method C. Modified Euler's method d. Improved Euler's method e. Fourth-Order Runge Kutta Method