HELP PLEASE I NEED THE ANSWER ASAPPPP

HELP PLEASE I NEED THE ANSWER ASAPPPP

Answers

Answer 1

Answer:

I think that it's A.

Explanation:

It's not D, because A & C contrast each other.

Answer 2
I would say A

Explanation
A keystone species is an organum that that helps define an entire ecosystem. Without its keystone species, the ecosystem would be dramatically different or cease to exists altogether. Any organism, from plants to fungi, may be a keystone species;they are not always the largest or most abundant species in an ecosystem.

Hope this helps.

Related Questions

If two different species belong to the same family, then they also belong to the same _______. *
Kingdom
Class
Order
All of the above are correct

Answers

Answer:

All of the above

Explanation:

The order is Domain, Kingdom, Phylum, Class, Order, Family, Genus, Species.

If it is a smaller one it is always in the ones above it.

What’s the corresponding mRNA strand for this DNA strand: TACGGGATAAGGCCACCTCTGGTAGACCACATT

Answers

Thymine(T) pairs with adenine(A)

Adenine(A) pairs with uracil(U)

Cytosine(C) pairs with guanine(G)

therefore the corresponding mRNA strand for TACGGGATAAGGCCACCTCTGGTAGACCACATT

is

AUGCCCUAUUCCGGUGGAGACCAUCUGGUGUAA

Which is an example of the use of plants in human societs?

Answers

Answer:

|

v

Explanation:

photosynthesis creates oxygen, water and glocose(starch) and we take in those and use it in our mitochondrias to create atp so it can hapen all over again.

Human uses of plants include both practical uses, such as for food, clothing, and medicine, and symbolic uses, such as in art, mythology and literature.

Cellular respiration is a process in which animal cells use ____ taken in from the atmosphere.

1) carbon dioxide

2) hydrogen

3) oxygen

Answers

Answer:

How does cellular respiration work in animals?

When an animal breathes, it takes in oxygen gas and releases carbon dioxide gas into the atmosphere. This carbon dioxide is a waste product produced by the animal's cells during cellular respiration. Cellular respiration occurs in the individual cells. Digested foods have chemical energy stored in them.

Explanation:

1) carbon dioxide I think hope it helps

What are two ways in which cells use the energy temporarily stored in ATP?

Answers

Answer: Energy provided by ATP is used in active transport, to contract muscles, to make proteins, and in many other ways

The two main ways in which cells use the energy temporarily stored in the form of ATP is in active transport, and to make proteins.

What is Active transport?

Active transport is the movement of molecules, ions, solutes, solvents against the concentration gradient. The flow of material takes place from the region of their lower concentration to the region of their higher concentration. The transport is against the gradient and hence requires energy to proceed which is given by ATP.

ATP is required to synthesize proteins in the ribosomes of the cell through the process of translation. This is a highly energy-consuming energy and thus required large amount of ATP.

Learn more about ATP here:

https://brainly.com/question/14637256

#SPJ2

Which is a term for a type of detritivore?
Carnivore
Decomposer
Herbivore
Omnivore

Answers

Answer:

Decomposer

Explanation:

Decomposers eat dead organsims carnivores rarely

Answer:

C. Decomposer

Explanation:

A.P.E.X

Three samples of cells from three different patients were unlabelled. One sample was from an 85-year-old man, one was from a 5-year-old boy, and one was from a person with skin cancer. How could you determine to which patient they belonged?

Answers

The 85 year old man will have shorter telomeres.

The 5 year old will have long telomeres.

The person with skin cancer will have an abnormal karyotype and abnormal nucleus shape and size during interphase.

Which of the following solutions would have solute concentration that is lower than the concentration found inside the cell

Answers

Answer:

hypotonic solution

A hypotonic solution has a lower solute concentration than inside the cell (the prefix hypo is Latin for under or below). The difference in concentration between the compartments causes water to enter the cell.

Thank you and please rate me as brainliest as it will help me to level up

Answer:

A. Hypotonic Solution

Hemoglobin is:
1) hormone;
2) Enzyme
3) protein;
4) Amino acid


HELPPP PLEASE!!!!

Answers

Answer:

The oxygen- carrying pigment and predominant protein in the RBC.

what dose cloraplast do​

Answers

n particular, organelles called chloroplasts allow plants to capture the energy of the Sun in energy-rich molecules; cell walls allow plants to have rigid structures as varied as wood trunks and supple leaves; and vacuoles allow plant cells to change size.

Answer:

Chloroplasts are a plant cell organelles and help. plants capture the energy of the sun.

Explanation:

they convert light energy to the sun relatively stable chemical energy via the photosynthetic process. By doing so, they sustain life on Earth

1. Peer review allows others in the field to assess a scientist's investigations and results.
a. True
b. False

Answers

Answer:

False.

Explanation:

Peer review provide others scientist in the field to assess a scientist's investigations and results.

Peer Review:

It is the reviewing or evolution of the work by many professionals and experts in the field.

For example-  A scienfic manuscript is send to the many scientist for evolution before publication.

This peer review is unbiased because the reviewer does not know the name or other information about writter.

To know more about  Peer Review:

https://brainly.com/question/10853815

Which of these are true of physical therapists? Check all of the boxes that apply.

All physical therapists can diagnose.

Physical therapists strengthen muscle and improve balance.

Physical therapists do not prescribe medication.

Physical therapists are considered doctors.

Physical therapists are commonly called physiatrists.

Answers

2nd, and the last one

Which is an example of active transport?
a
Cells move sugar into their cells with energy
Water moves from where there is more water to where there is less
b
с
Salt moves from a 15% solution to a 2% solution
d
Dye moves from where it is dropped throughout an entire glass of water

Answers

Answer:

с ) Salt moves from a 15% solution to a 2% solution

Explanation:

In active transport, the particles move across a cell membrane from a lower concentration to a higher concentration. Active transport is the energy-requiring process of pumping molecules and ions across membranes "uphill" - against a concentration gradient.Aug 14, 2020

I could really use some help on this question l, please help!?! Thank you ❤️ much love stay safe 2020

Answers

Answer: its B and D

Explanation:

4. Which is an example of a fungus?
O blue-green algae
slime mold
O bread mold
O brown algae

Answers

Answer:

Bread mold is an example of a fungus.

hope it helps!

What three things regarding cell organelles are different between plant and animal cells?

Answers

Answer:

Plant cells have a cell wall, but animals cells do not. ...

Plant cells have chloroplasts, but animal cells do not. ...

Plant cells usually have one or more large vacuole(s), while animal cells have smaller vacuoles, if any are present

I'll give you a brainliest if is right or at least shows some effort
(thanks & i hope your having a good day)

In your own words, explain how background noise detected in space provides evidence for the Big Bang Theory.

Answers

Answer:

Celestial microwave radiation found a strange microwave signal causing background noise in the radio telescope. The signal came from every direction. The young universe would have been very hot. The microwave background radiation is the remaining heat from the Big bang.

I tried my hardest and this is what I put on MY test so good luck

Genetic engineering involves _______ to achieve desired results. a. enzyme production b. modifying products and processes c. changing one organism into another d. introducing traits into organisms Please select the best answer from the choices provided A B C D

Answers

Answer:

D

Explanation:

the answer is d bruv like fr

Answer:

D

Explanation:

DDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDD

describe and explain how the rate of photosynthesis is affected by light intensity​

Answers

Increasing the light intensity increases the rate of photosynthesis, until some other factor - a limiting factor - becomes in short supply. At very high light intensities, photosynthesis is slowed and then inhibited, but these light intensities do not occur in nature.

Which of the following IS NOT a part of the cell theory? *
All organisms are made of one or more cells
All cells contain nuclei and membrane bound organelles
Cells arise from pre-existing cells
Cells are the basic units of structure and function

Answers

Answer:

all cells contain nuclei.

Explanation:

prokaryotes dont have a nuclei

PLEASE help its a question about rocks I'm tryna score a 80

Answers

Answer: The answer is C

Explanation:

lavas cool quickly at the earth's surface and are characterized by fine-grained texture, in which the crystals are too small to be seen by the unaided eye. Very quickly cooled lavas, typically those quenched in water, will have a glassy texture. They cool too quickly to form crystals.

1. what is an organelle?

2. give me an example of an organelle.

3. Which organelle is the "command center" of
the center?

Answers

Answer:

1. a subcellular structure that has a job to do within the cell

2. mitochondria

3. the nucleus

A student observes that a plant has droopy leaves and stems and infers that the rate of photosynthesis has slowed in the plant. Which statement provides evidence to support the student’s inference?

Answers

Answer:

A. The water pressure in the plant's vacuole is low, and without water, the chloroplasts cannot convert carbon dioxide to glucose during photosynthesis.

Explanation:

Photosynthesis occurs on chloroplasts which are located on the surface of leaves. Photosynthesis is the conversion of carbon dioxide, water, and light energy to produce glucose and oxygen for plants.

The vacuoles inside the plant's cell contain stored food and absorb water through osmosis. Water in the vacuole has more solutes than water outside the vacuole. This causes the Turgor Pressure which the vacuole impacts on the plants. If the reverse becomes the case, water is lost from the vacuole causing it to shrink.

Flaccidity of the vacuole and the cell wall will cause the chloroplasts where photosynthesis occurs to shrink.

plants Which part of the carbon cycle occurs when plants, trees, or fossil fuels are burned?
A. Transpiration B. Oxidation C. Photosynthesis D. Combustion

Answers

I believe C- photosynthesis but I could be wrong.

what is a cell membrane?

Answers

Answer:

The cell membrane is the semipermeable membrane of a cell that surrounds and encloses its contents of cytoplasm and nucleoplasm.

Explanation:

Answer:

Short. The semipermeable membrane surrounding the cytoplasm of a cell.

Long. The cell membrane is the semipermeable membrane of a cell that surrounds and encloses its contents of cytoplasm and nucleoplasm. The cell membrane separates the cell from the surrounding interstitial fluid, the main component of the extracellular fluid.

Explanation:

Which describes something that occurs during translation?

Answers

Answer: In translation process, the messenger RNA (mRNA) template is used to create amino acid chain by which a protein is formed. Translation is the process of synthesis of proteins from amino acids which the help of mRNA

Answer:

c

Explanation:

Summarize the possible applications of gene knockout GMOs.

Answers

Answer:

This method involves creating a DNA construct containing the desired mutation. For knockout purposes, this typically involves a drug resistance marker in place of the desired knockout gene. ... This method then relies on the cell's own repair mechanisms to recombine the DNA construct into the existing DNA.

Explanation:

This method involves creating a DNA construct containing the desired mutation. For knockout purposes, this typically involves a drug resistance marker in place of the desired knockout gene. ... This method then relies on the cell's own repair mechanisms to recombine the DNA construct into the existing DNA.

What is the definition of cell

Answers

Answer:

Small and sparsely furnished room, especially in a prison or convent.

"the detainees are together in cells with capacity for four or five people"

Cell of a honeycomb.

Explanation:

I hope to help you

The definition of a cell: The basic membrane-bound unit that contains the fundamental molecules of life and of which all living things are composed.

Can a
Brain cell
Fat cell
Muscle cell
Red blood cell
Liver cell
Convert one type of fuel molecule to another

Answers

answer: yes

exanation:

Describe how the circulatory system allows the endocrine system to do its job?​

Answers

Answer:

The circulatory system is the transport system for endocrine info. The endocrine chemicals and hormones must circulate through the body via blood vessels.

Other Questions
Abbey receives a $40 gift card for downloading music and wants to determine how many songs she can purchase. Each downloaded song costs $2.89 a. Let m represents the number of songs downloaded. Write an inequality that represents this given situation? b. What is the maximum number of songs Abbey can download? Write the equation of the line with the given point and slope: (5, 3) slope=35 Answer the following questions.1. How do you think the environment of a family affects the character of anindividual? The Earth is broken into pieces called plates that are different sizes and shapes. true or false HELP ME PLEASE Select the answer with the correct punctuation A.She packed her bag to get on the ferry, notebook, pens, pencils, and lunchbox.B.She packed her bag to get on the ferry: notebook, pens, pencils, phone, and lunchbox.C.She packed her bag to get on the ferry; notebook, pens, pencils, and lunchboxD.O She packed her bag to get on the ferry. notebook, pens, pencils, and lunchbox which website would provide the most accurate and reliable information when doing a research How do HOT AIR BALLOONS work when ascending and descending explain in terms of gas behavior? atoms are so small that approximately _______ of them can fit at the end of a needle? What is the volume of 100 g neon at STP? The IL Governer has the power to grant which of the follwingPardons, repreives. Executionspardens, repreives, and vetosPardons, commutes, executionsCommutes,executuon and vetoes holaa donde est Jesly Mateo?? In the great leap from slavery to freedom . . . the masses of us are to live by the production of our hands . . . we shall prosper . . . as we learn to dignify and glorify common labor.According to this quotation, Washington believed thathard work had its own kind of dignity.hard work was not more important than education.people could not prosper from common labor.people had to prosper in order to achieve freedom. what was a result of headlines like the one above 1. war war 1 begin2. the union defeated the confederacy 3.the Spanish American war4. the us entered world war 1 What is a boycott?a when you harm someone else's propertyb money paid for goods or merchandisec a stamp on a newspaperd when someone refuses to buy a product The thesis of a process analysis must identify: aWhat problems exist in the process bThe outcome of the first step cThe importance of the process dWhat the process does a que altura de cada molde quedara el litro de cera liquida? What qualities enable people to perform well when facing heart- pounding fear or stress? Think about your own experiences or those of someone you know, as well as news stories or fiction youre read. Then, jot down your thoughts about people taking action when the stakes are high Jerry is working on a research project about the effectiveness of social media marketing. He found some sources with information relevant to his project, and he's trying to determine which ones are credible. Which three sources should he select to use for his project? Did the scale factor of 0.75 enlarge reduce or stay the same? Help me plsssss I need help