help me the images are posted

Help Me The Images Are Posted
Help Me The Images Are Posted

Answers

Answer 1

Answer:

28.

a. false

b. true

c. false

d. false

2. 8.4 X 2.3 X 2.09 = 40.3788

3. $10.04 - $13.47

4. Your friend would be incorrect because their decimal is in the wrong place. Take the decimals out of it and think about it. Can 1 times 2 equal anything near 31? no, so it's not reasonable that your friend could multiply 1.2 X 2.6 and get anything near 31.2

5. It is more reasonable to say between 5 and 6 because even when you round both of the numbers up (3 X 2), you still only get 6.

Step-by-step explanation:

ill put it in the comments so I can get this to you faster.


Related Questions

what are two solutions to x < 8

Answers

Answer:

7, 3

Step-by-step explanation:

Any number less than 8 will work.

Answer:

6, 4

Step-by-step explanation:

Any number less than 8 will work

Which choice best represents the surface area of the triangular prism shown below?

264 square inches


240 square inches


284 square inches


260 square inches

Answers

Answer:

I think C

Step-by-step explanation:

1. A number squared decreased by 2

2. Twice a number increased by 16

Answers

Answer:

32

Step-by-step explanation:

The answer is 32

I hope this helped :)

which of the following improper fractions is equal to the mixed number 8 7/8

Answers

Answer:

56/8 is equal to 8 7/8 all you need to do is multiply 8 by 7 and gives you 56.

Step-by-step explanation:

Answer:

yep, the person above me is right

Step-by-step explanation:

cause they probably smarter dan meeee

give dem brainliest

Answer these please i will mark brainliest

Answers

Answer:

Lin: distance per second*time or 8.2*25= 205m

Elena: distance total divided by time  250/28= 8.9m/s

Diego: time*rate of speed or -8.1*32 = -259.2 meters from the starting point.

Andre: total distance/time -285/35= a velocity of 8.1 meters per second

Step-by-step explanation:

Since u got an answer already ima just snatch these points rq thanks!

QUESTION IS BELOW!!!!!!!!!!!!!!

Answers

Does Not Support
Does Support
Does Support

HOPE THIS HELPS!

Answer:

right left left

Step-by-step explanation:

Of the 40 students in Mr. Clayman's music class, 30 sing in the
school choir. Express the part of the class that sings in the choir as
a fraction.
a. 2/5 b. 3/10 c. 30/100 d. 3/4

Answers

Answer:

d

Step-by-step explanation:

25% of 40 is 20. 30 is 3/4 of the way there

Answer:

D.

Step-by-step explanation:

if u simplify 30/40, you get 3/4.

30 divided by 10 is 3

40 divided by 10 is 4

so therefore the answer is 3/4

Given AABC: ADEF, find x.

Answers

Answer:

14

Step-by-step explanation:


ANWSER: it’s 14 for sure

Step by step explanation;

Help Please this is hard

Answers

Answer:

1) D=1/4C

2) 4D=C its positive because it is above the sea

Step-by-step explanation:

a and b must have a product of -48

What is the least possible difference of a and b (meaning when you subtract them, they give you the lowest possible solution)? The least possible difference would be ___

Answers

Answer:

-2 is a and b=24 is b

Step-by-step explanation:

-2-24=-26, which is the least u can get.

The answer is B hopefully it will be correct

Parallelogram: ABCD∼ [tex]A_{1}[/tex] [tex]B_{1}[/tex] [tex]C_{1}[/tex] [tex]D_{1}[/tex] .

Find BC

Answers

I think it’s 3. Because bc is equal to b1 and c1. B1 and C1 is 3 so b and c would also be 3

The sequence below shows the number bacteria Arjun observed each hour for a science experiment:
5, 20, 80, 320,1,280,..
Which recursive function describes the number of bacteria observed at the nth hour?

Answers

Answer:

Hope this helps!

Step-by-step explanation:

Hope this helps


See screen shot :)

HELP
Line d is parallel to line c in the figure below.


Parallel lines d and c are intersected by lines q and p to form 2 triangles. At lines d and p, the angle is 2, at d and q, the angle is 1, and at q and p, the angle is 3. At lines c and q, the angle is 4, at p and c, the angle is 5, and the third angle is 6.


Which statements about the figure are true? Select three options.

Vertical angles prove that Angle 2 is congruent to angle 5.

In the two similar triangles, Angle 1 and Angle 4 are alternate interior angles.

Vertical angles prove that Angle 3 is congruent to angle 6.

The triangles are similar because alternate interior angles are congruent.

In the two similar triangles, Angle 2 and Angle 4 are corresponding angles.

The triangles are similar because the corresponding sides are congruent.

Answers

Answer:

srry think its to late

Step-by-step explanation:

IF YOU ANSWER CORRECTLY IN THE NEXT 5 MIN I WILL GIVE YOU BRAINLIEST
Points (−7, 5) and (7, 5) on the coordinate grid below show the positions of two players of a football team:
Which statement best describes the relationship between the positions of the two players? (4 points)

Player 1's position is Player 2's position reflected across the x-axis; only the signs of the x-coordinates of Player 1 and Player 2 are different.
Player 1's position is Player 2's position reflected across the x-axis; only the signs of the y-coordinates of Player 1 and Player 2 are different.
Player 1's position is Player 2's position reflected across the y-axis; only the signs of the x-coordinates of Player 1 and Player 2 are different.
Player 1's position is Player 2's position reflected across the y-axis; only the signs of the y-coordinates of Player 1 and Player 2 are different.

Answers

Answer:

answer is Player 1's position is Player 2's position reflected across the y-axis; only the signs of the y-coordinates of Player 1 and Player 2 are different.

Step-by-step explanation:

becuase it is

Player 1 position is players 2 position reflected across the y-axis, only the signs of the x coordinates of player 1 and 2 are different

HELP ME PLEASE! I NEED HELP, ASAP! THX

Answers

Answer:

6

Step-by-step explanation: so 3x2 is 6 because you have 2 color and 3 different options of shirts.

Answer:

5

Step-by-step explanation:

will the defenders be able to reach the ball carrier explain why or why not plz

Answers

Answer:

if your going based off of the  path that they are taking i say yes because the will meet at the end point or in this case the 1 yard line

Step-by-step explanation:

Fill in the blanks: In similar figures, the shapes are __________, angles are ___________, and sides are ____________.

Answers

Answer:

I think it is similar, congruent, proportional

Step-by-step explanation:

What is the probability of rolling an even number and then an odd number when rolling two number cubes?
Size of sample spaces =
Number of desired outcomes =
P(first is even and second is odd) =

Answers

Answer:

First answer = 36

Second answer = 9

Third answer =1/4

Step-by-step explanation:

The probability of rolling an even number and then an odd number is 1/4.

What is Probability?

Probability is simply the chance of getting an event from a sample space. Total probability of all the outcomes in an experiment will be always 1.

Probability of an event can be found by dividing the number of desired outcomes with the total number of outcomes.

Here two number cubes are rolled. Each number cube has total 6 outcomes.

If the sample space consists of all the outcomes of first and second number cubes,

Size of sample space = 6² = 36

We have to find the probability of rolling an even number on the first cube and then an odd number on the second cube.

There are 3 chances of having an even number for the first cube which are 2, 4 and 6.

There are 3 chances of having an odd number for the second cube which are 1, 3 and 5.

Therefore number of desired outcomes = 3² = 9

Probability (first is even and second is odd) = Number of desired outcomes / Size of the sample space

Probability (first is even and second is odd) = 9/36 = 1/4

Hence the probability of getting an even number on the first number cube and then an odd number on the second cube is 1/4.

To learn more about Probability, click :

https://brainly.com/question/11234923

#SPJ2

If necessary, use / for the fraction bar. Please reduce to simplest terms

What ratio value is shown by the following double number line? Use / for the fraction bar and do not use spaces.

Answers

Answer:

Step-by-step explanation:

The value is 3

Help me

Which quotient matches the description for 525÷25

using partial quotients?

Step1: Subtract (10×25)

from 525 to get 275.

Step 2: Subtract (10×25)

from 275 to get 25.

Step 3: Subtract (1×25)

from 25 to get 0.

Step 4: Add the partial quotients.

Answers

I believe the answer that the question of step 3 because you divide 525 and 25 you get 21.

HELP PLEASE! THIS IS FOR TURN IN TODAY!

Look at the photo

Answers

Answer:

1. 2.3

2. 6.1

Step-by-step explanation:

Answer:

1. 2.3  2. 6.1

Step-by-step explanation:

hey its Eve hoped this helped have a great day! and consider marking this as brainliest if you do thank you in advanced!!

Determine the measure of the unknown angle in each triangle​

Answers

Answer:

78 degrees

Step-by-step explanation:

If you look at it, 2 of the angels are the same- those angels are A and B- the angel we are looking for. Angel A is 78 degrees and if angel A and angel B are equal then angel B is also 78 degrees.

What is the slope of the line graphed below?

A) -3/2
B) 3/2
C) -4
D) 4/3

Answers

Answer:

B) 3/2

Step-by-step explanation:

5/-6

X1= 5

Y1=-6

X2=0

Y2=-4

y1-y2

-------

x1-x2

6 - (-4)= 10

5 - 0   =  5

10/5=2

Find the expressions that have a quotient of 7 R12. choose all that apply

A. 362÷50
B.408÷60
C.492÷50
D.432÷60
E420÷60
F.502÷70

Answers

Answer:

Try D. I am not exactly sure but let's hope it works.

Step-by-step explanation:

Answer:

Its D.

Step-by-step explanation:

Almost 100% sure

The volume of a sphere is V = 4/3πr³ and the relationship between

the radius r and the diameter d is r = d/2.

Find the volume of the sphere in terms of the diameter d and simplify the expressions.

b. What is the volume of the sphere when the diameter is 2/3 centimeter?

Answers

jdjdjdj sorry that wasn’t helpful)))
U need to include what the radius is then i can tell u what the volume is

John paid $50 for renting a cycle for 5 hours. Which graph shows the relationship between the cost of renting a cycle for different hours?

Photos go from A to D. I'm guessing it's A but I still want to check.

Answers

Answer:

Step-by-step explanation:

You are correct. It is A

The cost is 10 dollars an hour. As the hours increase, so does the cost.

The variables x and y vary directly. Use the values to find the constant of proportionality, k. Then write an equation that relates x and y.

y=72; x=3

Answers

y = kx

Replace y and x to solve for k:

72 = 3k

Divide both sides by 3:

k = 24

Now replace k with 24:

y = 24x

The proportionality constant [tex]k=\frac{1}{24}[/tex], and the equation that relates [tex]x[/tex] and [tex]y[/tex] is [tex]x=\frac{1}{24}y\text{ or } y=24x[/tex]

Since [tex]x[/tex] and [tex]y[/tex] are related by direct proportion,

[tex]x \text{ }{\displaystyle \propto}\text{ }y \implies x=ky[/tex]

where [tex]k[/tex] is our proportionality constant. To find the value of [tex]k[/tex], substitute the values [tex]x=3\text{ and } y=72[/tex] into the formula, and solve for [tex]k[/tex].

[tex]x=ky\\\implies 3=72k\\\implies k=\frac{1}{24}[/tex]

Thus the equation that relates [tex]x[/tex] and [tex]y[/tex] is

[tex]x=\frac{1}{24}y\text{ or } y=24x[/tex]

Learn more about direct proportion here: https://brainly.com/question/908424

Help plz ...............

Answers

Answer: 888

Step-by-step explanation:

Answer:

2.2727 pound of sugar

Step-by-step explanation:

1000 divided by 440

is 2.2727

Please help, Maybelle asked each of the students on her team their favorite color. She organized the results in the circle graph below. If 39% of the students said their favorite color was Green, what angle measure, to the nearest whole degree, was used to make the green sector of the circle graph?

Answers

Answer:

please help

Step-by-step explanation:

whats grade are u

what is 2+2x 4, Delany answer it please.

Answers

Answer:

10

Step-by-step explanation:

pemdas

please excuse my dear aunt sally

first you 2x4 which is 8 then add 2

Answer:

10

Step-by-step explanation:

Original equation:

2 + 2 · 4 = ?

Multiply 2 by 4

8

Plug this value back into the equation

2 + 8

Add

10

Hope this helps :)

Other Questions
Which of the following is an arithmetic sequence?A.3, 9, 81, 6561, B.4, 1, 2, 5, C.2, 2, 2, 2, D.4, 1, 4, 7, How can you identify a linear nonproportional relationship from a table, a graph, and an equation? The scale on a map says that 4 cm represents 5 km. What distance on the map (in centimeters) represents an actual distance of 4 km? A high school basketball team scored 60 points in last weeks game. The team scored a total of 27 baskets; some were two-point shots and some were three-point shots. How many two-point shots did they make? How many three-point shots did they make?x + y = 27,2x + 3y = 60What is the solution of the system of equations, and what does it represent?options:(6, 21); 6 two-point shots and 21 three-point shots(6, 21); 6 three-point shots and 21 two-point shots(21, 6); 21 two-point shots and 6 three-point shots(21, 6); 21 three-point shots and 6 two-point shots on a beautiful day there are 65 cars in the beach parking lot 26 more cars park in the parking lot before noon but 17 car slept how many cars are in the beach parking lot Anyone know the answer to this? There are 32 Drama DVD's. The ratio of Drama DVD's to Mystery DVD's is8:5. How many Mystery DVD's are there? what would happen to new orleans lose if slavery was abolished Read this excerpt from a works cited page for an informative essay.Works CitedFerry, Christopher. Racial Change in Civil War America. New York: Sunspot Press, 2011. Print. Underground Railroad. World Book Online. 2012. Web. 20 December 2012. .Which best describes the two citations? 5. Briefly explain the first steps towards economic imperialism in China. how do i solve this? find the equation of the line that passes through the point (1,8) and is parallel to the line y=3x+6. write the equation using the slope-intercept form. Transcribe the following DNA strand into mRNA and translate that strand into a polypeptidechain, identifying the codons, anticodons, and amino acid sequence.DNA: CGATACAATGGACCCGGTATGCGATATCC 5x-7=3 whats the answer An idea,theme,or image that begins and ends a text can be referred to as a New- Muhammad taught the belief that there is only one god and believed that the other Two Semitic religions (Judaism and Christianity) were ________.not relevant to current society.valid revelations from God but were distorted by man.not truly monotheistic religions.believed in the wrong God. 2- some of your mates like Chinese cousin, don't they?Why we use some of at the first of the sentence!! Galaxy B moves away from galaxy A at 0.577 times the speed of light. Galaxy C moves away from galaxy B in the same direction at 0.731 times the speed of light. How fast does galaxy C recede from galaxy A? What are some real-life situations that require a program that is iterative? Include at least three examples in your answer. Will mark brainiest!!!1. A __ is caused by a sudden shift in the ocean crust which displaces the water. *2. A tsunamis is possible, but unlikely at a __ plate boundary where two plates are moving sideways past each other. *3. A Shallow __ is a good indicator of tsunamis, but sends data very slowly and cannot detect earthquakes. *4. Tsunamis are common at __ plate boundaries, since large earthquakes release the built up pressure, resulting in a quick vertical movement of the plate. *5. The Indonesian Earthquake of 2004 had a 9.1__, which was the third largest ever recorded in human history. *All possible answers:A. EarthquakeB. TsunamiC. MagnitudeD. SensorE. TransformF. ConvergentG. Divergent