HELP ME ASAP!!!

what is some outliers for putting cabbage water, baking soda, and vinegar experinment?

Answers

Answer 1
Adding baking soda to the cabbage juice makes it a neutral base. When you add liquids to the cabbage juice, very acidic solutions will turn it a red color; neutral liquids make a purplish color; and basic solutions will make cabbage juice a greenish-yellow.

I chose this idea beause i will learn all about the acid and bases of this experiment.


Hope this helps ^v^

Related Questions

What makes erythrocytes unique from other cellular components of the blood?.

Answers

Answer:They contain hemoglobin.

Explanation:

In photosynthesis, what type of energy do we end up with?
I need the answers asap
I will mark it

Answers

Explanation:

Adenosine triphosphate energy

Answer:

In photosynthesis, light energy is converted to chemical energy.

What are the thin fibers of the human nervous system called?.

Answers

Description of the nervous system
Neurons send signals to other cells through thin fibers called axons, which cause chemicals known as neurotransmitters to be released at junctions called synapses

Answer:

Axons should be your answer.

Explanation:

The individual thin fibers in which neurons send signals to other cells are axons. When individual fibers are bundled together, it is called nerve fiber.

In what phase of meiosis does crossing-over take place? why is crossing over important?.

Answers

Answer:

prophase I

Explanation:

This is important because it increases genetic variation.

hope this helps

pls mark brainliest

How is gravity simulated on the hermes spacecraft?.

Answers

Answer:

A section of the spacecraft is slowly rotated in order to simulate the force of gravity.

Explanation:

The rotational force of the spacecraft makes an artificial sort of gravity, which can be altered by changing the speed of the spinning or by moving the rotating part further/closer to the center point of rotation.

An organism must have provided all of the following to survive EXCEPT

Answers

Answer:

The answer is the one that is not on this list

List of criteria for a living organism:

1.) Can Reproduce

2.) Goes through homeostasis

3.) Needs Energy

4.) Is organized/ has cells

5.) Grows and Develops

6.) Responds to stimuli.

Explanation:

Purple petal color in pea plants is dominant to white petal color. Two heterozygous pea plants are crossed. What is the ratio of the offspring with white petals to the total number of offspring?

Answers

Answer:

25%

Explanation:

crossing two heterozygous plants would look like this Pp x Pp

making a chart

                      P     p

P              PP        Pp

p             Pp          pp

what this means is that the capital P isdminant so thats what will show is the dominant purple petal whereas lower case p is the ressecive white petal

this means 25% of offspring will be white :)

How are the bodies of the three animals similar to one another? How are they different?

Answers

Answer:

How are animals similar? All animals are made of many cells. Most animals can move on their own. Like all living things, animals grow, change, reproduce, and respond to their environment.

Animals are made up of several cells. Most animals have independent movement. Animals develop, transform, reproduce, and react to their surroundings like all other living creatures do.

What are considered as animals?

Any eukaryotic multicellular organism of the biological kingdom Animalia is referred to as an animal.

The majority of creatures in this kingdom lack a cell wall, are heterotrophic, motile, have specialised sensory organs, and originate from blastulae during embryonic development.

According to some, the fundamental distinctions between humans and other animal species are our capacity for complex reasoning, our use of complex language.

Also, the capacity for problem-solving, and the capacity for introspection (this means describing your own thoughts and feelings).

Multiple cells make up an animal. The majority of animals can move on their own. Like all other living things, animals grow, change, reproduce, and respond to their surroundings.

Thus, this way, many animals contrasts each other.

For more details regarding animals, visit:

https://brainly.com/question/12985710

#SPJ2

Can someone please help me with these three questions for my biology project?

It asks for a 250-word report on these questions. Doesn't have to be 250 but I'd really appreciate it.

What happens in the light reaction of photosynthesis?

What happens in the dark reaction of photosynthesis?

What five factors affect photosynthesis and its rate? How?

Answers

Answer:

Explanation:

light reaction - chlorophyll absorbs light energy

dark reaction -  

happens in the stoma when light is not present

factors - chlorophyll, carbon dioxide concentration, light intensity , temperature ,water

how do homologous structures show common ancestry?

Answers

Answer:

Homologous structures provide evidence for common ancestry, while analogous structures show that similar selective pressures can produce similar adaptations (beneficial features). Similarities and differences among biological molecules (e.g., in the DNA sequence of genes) can be used to determine species' relatedness.

Explanation:

The correct statement is C. They demonstrate how different species differ and which creature created the structure first. Anatomical characteristics observed in several species that have a common ancestor include what are known as homologous structures.

Although these structures may have diverse purposes in many creatures, their similarities suggest that they had an ancestor.

The anatomical characteristics of several creatures may be compared to find homologous structures and deduce evolutionary links.

Because diverse kinds of creatures have homologous features, it is likely that these qualities were passed down from a common ancestor.

Similarity levels and common anatomical patterns might shed light on a species' evolutionary path.

To know more about Anatomical characteristics:

https://brainly.com/question/32344097

#SPJ2

how much water is in our bodies

Answers

Answer:

60%

Explanation:

Water makes up up to 60% of the adult human body. Water makes up 64 percent of the skin, 79 percent of the muscles and kidneys, and even 31 percent of the bones.

I hope this helps you

:)

Which mrna sequences would form a structure that is a cue for transcription termination of some genes?

Answers

Answer:

First, you must know what the stop codons are: UAA, UAG, and UGA

Whenever this sequence is read, it signals for an end in transcription and amino acids will stop being formed

Thus, 5′−GGCCCUUUUAGGGCCUUUUU−3′ contains a cue for transcription termination as it will stop after the codon "UAG"

Explanation:

Those mRNA sequences that consist of the stop codons like UAA, UGA, and UAG would form a structure that is a cue for transcription termination of some genes.

What do you mean by Transcription?

Transcription may be defined as the process by which the information in a strand of DNA is copied into a new molecule of messenger RNA (mRNA).

Stop codons are responsible for the termination of transcription of almost all the genes. They are necessary for inhibiting the excessive expression of some genes.

Therefore, those mRNA sequences that consist of the stop codons like UAA, UGA, and UAG would form a structure that is a cue for transcription termination of some genes.

To learn more about Transcription, refer to the link:

https://brainly.com/question/1048150

#SPJ4

Why does aneuploidy in animals generally result in phenotypic abnormalities?.

Answers

Answer:

I think it results in an imbalance of gene products from affected chromosomes, which alters normal development

Explanation:

Why: Why is aneuploidy in animals generally detrimental?

Explanation and Answer: Well it does result in an imbalance of gene products from affected chromosomes, which modify normal development. It results in DNA replication mistakes due to the aberrant number of chromosomes.

                           I expect this to help you!

                        Have a wonderful weekend!

A blood sample containing erythrocytes with only surface antigen B on the plasma membrane is ABO blood type ______.

Answers

Answer:

ABO blood type B

Explanation:

The blood sample only contains B as a surface antigen (simplified as the sugars clinging to the blood embedded halfway inside) making any other blood type unviable. B would be the only option.

Which repair process in e. Coli uses visible light to repair thymine dimers?.

Answers

Answer:

photoreactivation repair

Explanation:

Photoreactivation utilizes the enzyme photolyase to break the bonds formed during pyrimidine dimerization. A thymine dimer produced by UV irradiation is bound by photolyase. Visible light energy is absorbed by photolyase and is redirected to break the bonds forming the dimer.

In addition to bacteria, this DNA repair mechanism is also found in single-celled eukaryotes, plants, and some animals such as Drosophila.

Under what circumstances would a food pyramid be a more useful model than a food chain?

Answers

Answer:

A food chain represents the linear relationship between organisms for food. On the other hand, a food pyramid represents the optimal number of servings to be eaten each day from each of the basic food groups.

Food pyramid represents the total number of food to be eaten each day from each of the basic food groups .A food chain represents the linear relationship between organisms for food.

What is food chain?

Food chain is a linear sequence of organisms through which nutrients and energy pass as one organism eats another.

What is food pyramid?

Food pyramid is a depiction of the optimal number of servings to be eaten each day from each of the basic food groups.

To learn more about Food pyramid , here

https://brainly.com/question/17234521

#SPJ2

.......................................................
..........................................................
///////////////////////////

Answers

Answer:

2 2/9

Explanation:

5 x 4/9

20/9

divide 20 by 9

= 2 2/9

Answer:

2[tex]\frac{2}{9}[/tex] is the answer

Explanation:

hope this helps

Introducing a vascular catheter directly into a vessel without further advancement past the punctured vessel is called __________ vascular catheterization.

Answers

It is called central vascular catheterization

Importance of catheterization

Catheterization is defined as the use of medical devices that can be inserted into the body and used for different medical purposes.

Vascular catheterization is a peripheral catheterization that is used to detect certain upper and lower peripheral extremity conditions.

There are different types of vascular catheterization which include:

Arteriovenous (AV) fistula,

Arteriovenous (AV) graft and

Central venous catheter (CVC)

Central vascular catheterization involves Introducing a vascular catheter directly into a vessel without further advancement past the punctured vessel.

Learn more about catheterization here:

https://brainly.com/question/3911876

A rural, forested area receives a lot of rain in a short amount of time. What would most likely cause potential flooding in the area?

Answers

The most likely cause potential flooding in the area will be saturation of the ground with water.

What is Flooding?

This is defined as a situation in which an overflow of water submerges land that is usually dry.

When the ground is already saturated with water, a forested area receiving a lot of rain in a short amount of time will lead to flooding.

Read more about Flooding here https://brainly.com/question/12686086

There was a change in the environment between generations 10 and 30. the change likely .

Answers

These adjustments are in all likelihood genetic mutations evolution is the technique of alternating all existing paperwork from one era to the next and evolutionary biology research how this evolution takes place.

Every era of organisms inherits trends owned via way of means of their mother and father via genes. Changes (known as mutations) in this gene will new trends withinside the offspring of an organism. In an organism's populace, a few trends become greater common, even as others will disappear.This technique is known as herbal selection. The profits of greater offspring than the variety of mother and father at the side of the inheritance.

What are heredity mutations?

Hereditary mutations encompass cystic fibrosis, hemophilia, and sickle mobileular disease. Other mutations can occur on their very own at some stage in a person's existence. These are known as sporadic, spontaneous, or new mutations.

Thus it is well explained.

To learn more about evolution refer to the link :

https://brainly.com/question/1144962

Answer:

✔ favored trait A

Explanation:

An organism has two different possible traits, A and B. A graph of the population is shown right. Which of the following statements is true about Trait B? Check all that apply.

It decreased in frequency over time.

It became extinct.

It is carried on a recessive allele.

There was a change in the environment between generations 10 and 30. The change likely

✔ favored trait A.

When two protein chains combine to form an active protein, the structural level is ________

Answers

When two protein chains combine to form an active protein, the structural level is quaternary.

What is a quaternary structure?

The quaternary and tertiary structure of a protein is the tridimensional shape of the protein, which involves protein domains.

The quaternary protein structure refers to the different arrangements generated by different protein subunits.

The primary structure of a protein involves its amino acid sequence, whereas the second structure involves protein chains.

Learn more about quaternary structure here:

https://brainly.com/question/5286438

When two protein chains combine to form an active protein, the structural level is the quaternary arrangement.

What do you mean by Proteins?

Proteins may be defined as naturally emerging, extremely intricate substances that comprise amino acid residues joined by peptide bonds.

The Quaternary structure of a protein is very complex and 3-dimensional as compared to other protein structures which involve numerous motifs and domains.

Therefore, when two protein chains combine to form an active protein, the structural level is the quaternary arrangement.

To learn more about Protein structures, refer to the link:

https://brainly.com/question/14207491

#SPJ4

A mother has hemophilia, and the father is unaffected. What is the probability that their son will have hemophilia? Their daughter?

Answers

Answer:

A 25% (one in four) chance of having a son with hemophilia. A 25% chance of having a son with normal blood clotting. A 25% chance of having a daughter who is a carrier. A 25% chance of having a daughter who has hemophilia.

Explanation:

In the extremely rare event that both the mother and the father have the affected X chromosomes then there is a 50% chance that their sons will be born with hemophilia. There will be a 50% chance their daughters will be carriers and a 50% chance they will also have the condition.

please what is meant by photosynthesis​

Answers

Answer:

Photosynthesis is a process used by plants and other organisms to convert light energy into chemical energy that, through cellular respiration, can later be released to fuel the organism's activities. Some of this chemical energy is stored in carbohydrate molecules, such as sugars and starches, which are synthesized from carbon dioxide and water, In most cases, oxygen is also released as a waste product that stores three times more chemical energy than the carbohydrates. Most plants, algae, and cyanobacteria perform photosynthesis; such organisms are called photoautotrophs. Photosynthesis is largely responsible for producing and maintaining the oxygen content of the Earth's atmosphere, and supplies most of the energy necessary for life on Earth.

Explanation:

What do we call a natural resource if it can be used up faster than it can be replaced?

a: depletable
b: renewable
c: sustainable

Answers

Depletable

Renewable is energy we can “renew” or “get back”.

Sustainable is if it “sustains” or works for the present and doesn’t affect the future.

Hope this helps! :)

The physical appearance of an organism is known as its
A. genotype
B. phenotype
C. allele
D. testcross

Answers

Answer:

B.Phenotype

Explanation:

The term "phenotype" refers to the observable physical properties of an organism; these include the organism's appearance, development, and behavior. An organism's phenotype is determined by its genotype, which is the set of genes the organism carries, as well as by environmental influences upon these genes.

How is ocean acidification important to the world?

Answers

Answer:

Ocean acidification is already impacting many ocean species, especially organisms like oysters and corals that make hard shells and skeletons by combining calcium and carbonate from seawater.

How many chromosomes should be in each diploid cells after mitosis.

Answers

Answer:

46 chromosomes

Explanation:

46 chromosomes should be in each of these diploid cells after mitosis.

Lily is doing a science experiment with a substance in a sealed jar. At first, the substance’s molecules are moving around each other. What will happen to Lily’s substance if she transfers energy into the substance and causes a phase change? After the phase change, the substance’s molecules will move . . . *
1 point
a. faster, and the substance will be a liquid.
b. faster, and the substance will be a gas.
c. slower, and the substance will be a solid.
d. slower, and the substance will be a liquid.

Answers

Answer:

I think is B because when you transfer a substance through energy the practicals increase

B..Because Gas moves around Solid doesn’t it stiffens up but liquid just goes everywhere

The structural and functional units of the kidney are called

Answers

Answer:

The structural and functional units of the kidney are called nephron.

Fun Facts about Nephron:

Nephron is the structural and functional unit of the kidney.

Its primary purpose is to maintain the concentration of water and soluble chemicals such as sodium salts in the blood by filtering it, reabsorbing what is needed, and excreting the excess as urine.

The glomerulus and renal (kidney) tubule are the two primary structures in each nephron. Each human kidney contains around 1,000,000 nephrons.

The structural and functional units of the kidney are called the nephrons. Each human kidney contains 8-10 lakhs nephrons.

What do you mean by Kidney?

A Kidney may be defined as a pair of bean-shaped organs that eliminate waste and extra water from the blood and help keep chemicals balanced in the body.

Each nephron contains two structures i.e. Glomerulus and Tubules. The Glomerulus is a tough capillary through which a large amount of fluid is filtered from the blood.

Tubules are the other structure of the nephron in which the filtered fluid is converted into the urine.

Therefore, the structural and functional units of the kidney are called nephrons.

To learn more about Nephron, refer to the link:

https://brainly.com/question/832244

#SPJ4

urgent help would be appreciated

Answers

I think it’s B xxx not sure tho
Other Questions
What was the original meaning of the word ""appreciate""?. 15.5 angle relationships in circles evaluate homework and practice Scale factor word problemSomeone please help me! What must be the charge of a particle having E = 81 N/C at 49 mm from the said particle? Express in Coulombs. Use k = 9.0 x 109kgm3s2C2 Solve each system by substitution. Show all work.4x + y = 0-x - 2y =7 what property of light is suggested by the formation of shadows List one unprofessional AND one professional example of internet/social media Why are organisms classified into different kingdoms? I don't want how they are classified, I just want why they are. Which of the following is not needed by living organisms?A.alcoholB.airC.energyD.water Which sphere is the troposphere a part of?Select one:the geospherethe biospherethe hydrospherethe atmosphere A qu hora vas de compras? (5:00 p.m.) Which of the following statements describes the most likely reason whyethical employees are important for a company?O A. It can show caring.O B. It can show morality.O C. It can feel good.O D. It can save money Q. If A is a square matrix such that A = A, then write the value of 7 A (I + A), where I is an identity matrix. Chloe has 4 sundaes for her friends. She has 12 8/9 ounces of sprinkles to put equally on the sundaes. How many ounces of sprinkles will be on each sundae? Can someone help me with this please? :))) Kevin and Tiana are making soup. The recipe calls for a pound of onions. They have one onion that weighs pound and another that weighs pound. Kevin says they only have 3/7 pound of onions, so they definitely dont have enough. Why is Kevin wrong? PLSSSS HELP! Ils sont alls chez leurs grands-parents.O ils y sont alls.O ils en sont alls.O ils les sont alls.O ils leur alls. if predators and habitat do not change, which shade of frogs will have the greatest fitness Using specific details and examples from the article, explain both site andsituation factors that are considered by industries in their decision to movetheir manufacturers south of the border into Mexico. Writing how to describe someone slowly start laughing