HELP !!!!!!!!! IM SOOO CONFUSED

Different leads are used to measure the ECG because

Select one:


a.

measurement of heart rate depends on which lead is used to measure it


b.

the signal has a larger amplitude on some leads so it is easier to measure


c.

it is easier to attach some leads to the patient


d.

the interval between ECG events differs on the different leads


e.

they provide information on the spread of the heart beat and to help diagnose which areas of the heart are affected by pathology

Answers

Answer 1

Answer:

e.

Explanation:

they provide information on the spread of the heart beat and to help diagnose


Related Questions

Which of the following initiatives help harvest renewable energy in some TCS offices

Answers

The initiative (technology) which help harvest renewable energy in some TCS offices is: Solar water heaters.

TCS is an acronym for Tata Consultancy Services and it is a multinational IT services, consulting and business solutions company that was established on the 1st of April, 1968 in Mumbai, India. Also, TCS has a large network of initiative (technology), innovation and delivery centers across the world.

In 2013, TCS was deeply invested in harnessing renewable energy to generate electrical energy and reducing the emission of carbon, especially by developing solar energy. Thus, solar product solutions such as solar water heaters and lighting systems were installed in some of its offices because they were economically viable and would help meet their energy needs.

In conclusion, solar water heaters was the initiative (technology) that helped harvest renewable energy in some TCS offices.

Read more on renewable energy here: https://brainly.com/question/9963735

The gene for fur color in mice has two alleles, the allele for gray fur
(G) is dominant to the allele for black fur (g). What would be the
phenotype of a mouse with genotype gg?

Answers

Answer:

the phenotype of a mouse with genotype is g


Which of the following best describes ribosomes?
A barrier which defines the boundaries of a cell
Genetic material which controls the functions of a cell
Tiny structures which make proteins from DNA
A jelly-like filling inside of a cell

Answers

Tiny structures which mark proteins from dna

Answer:

Tiny structures which make proteins from DNA

Explanation:

The main function of ribosome is protein synthesis

Which symbol represents a hybrid

Answers

Explanation:

The three standard sex symbols are the male symbol ♂ and the female symbol ♀, and the hybrid symbol ×. They were first used to denote the effective sex of plants (i.e. sex of individual in a given crossbreed, since most plants are hermaphroditic) by Carl Linnaeus in 1751.

Proteins are synthesized based on genetic information carried by DNA. Explain In you’re own words how the structure of DNA is important in the
synthasis of different kinds of proteins, In your explanation, include a description of the two main processes involved in
protein synthesis.

Answers

Answer:

Explanation:The synthesis of proteins occurs in two sequential steps: Transcription and Translation. Transcription occurs in the cell nucleus and uses the base sequence of DNA to produce mRNA. The mRNA carries the message for making a specific protein out to the cytoplasm where translation occurs.

What is a long chain of one-ring sugar molecules?

Answers

Answer:

polysaccharide

Explanation:

Match the materials below to the BEST option describing their place in the cycles of photosynthesis and cellular respiration.



Some options may be used more than once or not at all.

Answers

1b, 2b, 3a, 4c, 5d, 6g, 7e, 8h

I’ll give BRAINLIST??What organs/organs systems does schizophrenia affect and how does it affect it?

Answers

Answer:  Schizophrenia is considered a disorder of the mind, influencing the way a person thinks, feels and behaves.

Explanation: Physical health is also important because if it is compromised, many of the benefits of improved mental health will be offset. Compared with the general population, schizophrenia patients are at increased risk of weight gain, abdominal obesity, diabetes, metabolic syndrome, and cardiovascular disease.

Answer:

Schizophrenia involves a range of problems with thinking (cognition), behavior and emotions. Signs and symptoms may vary, but usually involve delusions, hallucinations or disorganized speech, and reflect an impaired ability to function. Symptoms may include: Delusions.Schizophrenia is associated with changes in the structure and functioning of a number of key brain systems

Explanation:

Have a great day!

what are microorganisms?​

Answers

Answer:

A microorganism is a living thing that is too small to be seen with the naked eye. Examples of microorganisms include bacteria, archaea, algae, protozoa, and microscopic animals such as the dust mite.

Help help bell help help

Answers

6 units
because it is decreasing by three every time

What is natural selection? Is it similar to survival of the fittest? How are the 2 alike? How are they different?

Answers

Answer:

Difference: Survival for the fittest is the survival of species/organisms with genes better suited to the environment and are selected for survival and passed to the next generation while natural selection works by giving species who are better adapted to a given set of environmental conditions an advantage over those that are not as well adapted.

Explanation:

Evolution is the slow/gradual development of human beings from simple life forms into higher forms of life over millions of years ago as stated by Charles Darwin in his book 'The Origin of Species' in 1959. He argues that human beings evolved from simple life forms into higher forms of life through:

       1.Mutation - abrupt change in the form of a living organism as dictated by the climate or genetic components of the living thing involved.

       2.Natural selection - a process in which the stronger species out compete the weaker ones for resources (Survival for the fittest).

       3.Environmental adaptation - follows after the first two, where the surviving species isolate themselves from others as they adapt to the new environment.

what happens when fats are bieng oxidised​

Answers

Answer:

[tex]\huge\color{pink}\boxed{\colorbox{black}{Answer ☘}}[/tex]

Fats are digested through conversion into free fatty acids, which are stored in a form known as triglycerides in the adipose tissue. ... In the mitochondria, the fatty acids are oxidized in the process that creates adenosine triphosphate (ATP), the energy-producing fuel.

hope helpful~

what is Chlorophytum borivilianum ?​

Answers

Answer:

Chlorophytum borivilianum is a herb with lanceolate leaves, from tropical wet forests in peninsular India. ... It is cultivated and eaten as a leaf vegetable in some parts of India, and its roots are used as a health tonic under the name safed musli. In traditional Indian medicine it is used as rasayan or adaptogen.

Plant name = Musli

Explanation:

Hope it's helpful to you dear❤ :-)

sorry

Which clouds are best associated with a thunderstorm?
o towering funnel clouds
o swirling clouds with a calm center
o high cumulonimbus

Answers

B
Should be the right answer
answer

C

Hope this is it!

the components of every food chain are​

Answers

Answer:

Explanation:

A food web consists of several components; primary producers, primary consumers, secondary consumers, tertiary consumers, and so on. Primary producers include green plants and are the foundation of the food web.

Answer:

hope the above picture helps

plz follow me too

n

I am new here .....

brainly stop removing my question its weird i just need help

Answers

lol…..that’s only thing I wanted to say. And I wanted the 5 points, don’t get me wrong u need to up the points. ( ignore whatever I said I just needed more words) luv you

What is Ecological Sustainability? What happens if we use all of our planet's resources without replacing them?

Answers

Answer:

Ecologically sustainable development is the environmental component of sustainable development. It can be achieved partially through the use of the precautionary principle. The precautionary principle (or precautionary approach) is a broad epistemological, philosophical and legal approach to innovations with potential for causing harm when extensive scientific knowledge on the matter is lacking. It emphasizes caution, pausing and review before leaping into new innovations that may prove disastrous

Explanation:

Why is the ability to adjust conclusions when necessary important Io critical thinking?

Answers

Answer:

When new information leads to new and different conclusions, it is important to be able to adapt to the most up-to-date conclusions.

hope this helps bye-bye

Drag the tiles to the correct boxes to complete the pairs.
Match each organ to its function.
bone
heart
stomach
lung
pumps blood through the body
arrowRight
provides structure for the body
arrowRight
breaks down food into small particles
arrowRight
oxygenates blood
arrowRight

Answers

Bone —> provides structure for the body.

Heart —> pumps blood through the body.

Stomach —> breaks down food into small particles.

Lung —> oxygenates blood.

Transcribe the following Strand of DNA:
GTCCTTTACCATCGATTGGAAAACGTTAAAATCCAGTTCCAT

Answers

Answer:

CCGATAGGT

Explanation:

got this for my hw.

Answer:

So the central dogma of molecular biology describes the journey from DNA to protein product:

DNA --transcription--> mRNA --translation--> Protein

Assuming the DNA sequence provided is the template strand (rather than the complimentary coding strand), we start by transcribing the sequence into mRNA starting on the 3' end of the DNA towards the 5' end (which would build the mRNA 5' to 3'). This process involves the enzyme "RNA polymerase," which can only add nucleotides to the 3' end of the mRNA, just like how DNA polymerase can only synthesize DNA in the 5' to 3' direction. The RNA polymerase will bind to the template DNA strand and synthesize the complimentary mRNA, substituting uracil for thymine (since RNA does not contain thymine like DNA).

In terms of transcribing the sequence given to you, we'll have to work backwards + flip it around to get the 5' to 3' mRNA since the DNA is given 5' to 3' rather than 3' to 5'. Due to the length and the fact that we'll have to use triplets in translation anyways, it can help to break the sequence into triplet codons now.

5’-AAG | TTA | ATG | AGA | AAT | CGA | CAT | GGG | GCG | CCG | AAA | GTA | TAA | CCG | TCT | TAG | AAT | AGC-3’

We can then cross out each codon as we transcribe it and flip the sequence to be 5'-3' mRNA:

mRNA: 5'- GCU | AUU | CUA | AGA | CGG | UUA | UAC | UUU | CGG | CGC | CCC | AUG | UCG | AUU | UCU | CAU | UAA | CUU -3'

Normally, mRNA sequences start with "AUG" which is the start codon (and codes for Methionine), but I'll assume this is just for practice translating + transcribing in general. There's also a stop codon before the end but I'll assume the same again.

Translation involves three main steps - initiation, elongation, and termination. Initiation involves the translation ribosome assembling around the mRNA starting at the 5' end start codon, and tRNA carrying an amino acid binding to the complimentary section of the mRNA. As each tRNA attaches and the ribosome moves along the mRNA, the amino acids on each tRNA are bonded into a longer and longer peptide chain and the now amino acid-less tRNA are ejected (elongation). Termination occurs when a stop codon is reached, the ribosome will end elongation and help fold the protein into its final structure.

To translate the mRNA sequence here we'll need an amino acid/mRNA codon chart. I don't believe I can attach an image here, but looking up those exact words should yield the right results in images.

5'- GCU | AUU | CUA | AGA | CGG | UUA | UAC | UUU | CGG | CGC | CCC | AUG | UCG | AUU | UCU | CAU | UAA | CUU -3'

Ala - Ile - Leu - Arg - Arg - Leu - Tyr - Phe - Arg - Arg - Pro - Met - Ser - Ile - Ser - His - STOP - Leu

Amino acids are often abbreviated into three letters (Ala = alanine, Met = methionine, etc), and sometimes are abbreviated as single letters, though I've only seen that for sequencing databases.

In terms of locations for each of these processes, transcription occurs in the nucleus for eukaryotes and translation in the ribosomes/cytoplasm.

Explanation:

n

I need help please ??!!!!!

Answers

Answer:

1: false

2: true

3: true

Explanation:

sorry if they wrong its on me if u use them tho

Which of these describes the complexity of abiotic and biotic factors within an ecosystem that supports a specific species?
A.fauna
B.biome
C.climate
D.habitat

Answers

In an ecosystem, the term that describes the complexity of the abiotic and biotic factors which supports a specific species is: D. habitat.

What is an Habitat?

An habitat can be described as the sum total of resources, abiotic and biotic factors that are found in a particular environmental area which support the survival and growth of a specific species that is better adapted to it.

Examples of HabitatsWoodland Forest SeashoreGrassland

Therefore, in an ecosystem, the term that describes the complexity of the abiotic and biotic factors which supports a specific species is: D. habitat.

Learn more about habitat on:

https://brainly.com/question/931161

1. A molecule that contains only carbon and hydrogen is called a
-
carbohydrate
carbonyl
hydrocarbon
hydroxyl

Answers

Answer:

hydrocarbon

Explanation:

It's called a hydrocarbon

a change in the base pairs is called a what?​

Answers

Answer:

Hey mate.....

Explanation:

This is ur answer.....

Substitution is a type of mutation where one base pair is replaced by a different base pair. The term also refers to the replacement of one amino acid in a protein with a different amino acid.

Hope it helps!

Brainliest pls!

Follow me! :)

Answer:

Substitution is a type of mutation where one base pair is replaced by a different base pair. The term also refers to the replacement of one amino acid in a protein with a different amino acid.

Explanation:

6. All of the following are renewable resources except for:
A. fossil fuels
B. soil
C. water
D. forests

Answers

a - fossil fuels

step by step explanation:

fossil fuels are non-renewable and will run out

A. Fossil fuels

It’s the only one that isn’t renewable

The Maine Department of Transportation (DOT) has a fleet of roughly 400 plow trucks that are used to control snow and ice on approximately 8300 lane miles of Maine’s state roads. They usually plan on an average of about 30 treatable events in a winter. This includes the use of rock salt, salt brine and winter sand, a mix of sand and salt. Salt brine is used on roads and bridges prior to a storm to delay ice and snow from sticking to the roadway and is also used in plowing to fight the buildup of ice and snow throughout the storm. Rock salt helps keep roads safe when winter storms hit, reducing winter road accidents, but it can also have negative effects on plant life and aquatic ecosystems. What are the environmental effects of salting that must be mitigated? Select ALL that apply.A) Salt kills roadside plants. B) Salt builds up in roadside soil , changing its pH, preventing the growth of plants. C) Salt corrodes metals like automobile brake linings, frames, and bumpers, and can cause cosmetic corrosion. D) Elk, moose and sheep eat road salt causing "salt toxicosis" where they lose their fear of vehicles and humans, causing many fatal encounters. E) Salt doesn't evaporate, or otherwise get removed once applied, so it remains a persistent risk to aquatic ecosystems due to runoff or ground

Answers

Answer:

it is 736

Explanation:

me big brain

Salt builds up in roadside soil , changing its pH, preventing the growth of plant and Salt doesn't evaporate, or otherwise get removed once applied, so it remains a persistent risk to aquatic ecosystems due to runoff or ground are the environmental effects of salting that must be mitigated. That is option B and E.

The effects of road salting on the environment

Road salting is a technique that is used to melt snow and ice during winter season. This keeps the streets and side sidewalks clear and prevents slick driving conditions.

The types of salt used for road salting include:

rock salt,

salt brine,

winter sand,

a mix of sand and salt.

The impact of road salting on the environment include the following:

Decrease in reproduction and growth of plants: This is because increase salinity are toxic to plants and as the concentration of these ions increases, the plant is poisoned and dies.

Negative effect on aquatic ecosystems: This affects mostly the freshwater ecosystems as high levels of salt are very toxic to the aquatic organisms.

Learn more about aquatic ecosystems here:

https://brainly.com/question/1023703

Imagine that you have separated the cells of different sponges and mixed them up in a lab. Describe the experiment and your predicted results.

Answers

Answer:

2

Explanation:

Because if you add 1  to 8 you get 9 then subtract 9 by 7 then and your answer is 2

Answer:

Songes are mixed up in a cell bowl

Explanation:

Giving Away 50 points + brainy to first



Ava has been reading about the interactions among the components of the Earth. This group of components work together to make a/an ____

Answers

Ava has been reading about the interactions among the components of the Earth. This group of components work together to make a system.

The group of components of the Earth work together to make an environment we live in.

What are the different components of the Earth?

The interactions between Earth's five systems—the geosphere, biosphere, cryosphere, hydrosphere, and atmosphere—create the environment we are accustomed to.

The Earth's interior and surface, which are both formed of rocks, make up the first system, the geosphere. The second system is made up of the little area of the planet that may sustain life; this area is known as the biosphere. The third system contains the hydrosphere, or regions of Earth that are completely covered with water. The fourth system is the atmosphere, a gaseous envelope that maintains the planet's temperature while also supplying carbon dioxide for photosynthesis and oxygen for breathing. The cryosphere, which is composed of enormous amounts of ice in the poles and elsewhere, is the fifth system. The maintenance of the Earth as we know it depends on the interaction of all five of these vast and intricate systems.

Learn more about Earth's component, here:

https://brainly.com/question/11250595

#SPJ5

How and why does the surface of the earth change
of the earth has changed?

Answers

Answer:

How and why does the surface of the earth change

of the earth has changed?

It can be hard to describe change on the surface without bringing up the interior. Earth is a system of constantly changing interactions between interior, surface conditions, and external events.

Volcanoes bring up new material and even create land. The Hawaiian islands, for instance are a chain of volcanoes on the surface, but the underlying structure is a single magma plume. In a way, the entire chain of islands is a single volcano that breaks through different places as the crust moves over it.

On that note: plates. Earth is made of tectonic plates that constantly move. Some grind against one another, others collide, and some pull apart. Depending on direction and interaction, you get anything from mountains, to spreading valleys, oceans, and anything else you care to name. Mountains can almost be viewed as something akin to the ridges of build up ice on a window scraper.

Erosion by water, wind, sand, chemicals, and living things changes the surface too. Materials on the surface face an incredible number of forces breaking them down and dragging them away, even as those same forces in different places and situations deposit those materials in other places, building things back up.

“Stardust” is also a thing. Rocks, dust, debris, and all sorts of random, natural cra.,p is constantly hitting our atmosphere. Regardless of whether or not it stays mostly intact, some material breaks off, and most of it does tend to make it to the surface, adding tiny amounts of matter all the time. …of course something BIG enough hitting the surface can throw rocks and chunks of surface clear into space, so that’s a thing too.

Remember when I mentioned living things? Living things D.,IE! Gac.k! And when they do, they break down into organic gunk. Soil - the stuff we grow crops in - is basically minerals and dead things that are decaying into nutritious, yummy, dir.,t.

Weather changes things too. Rain erodes, but rain that soaks a rock, and then is frozen by low temperatures, breaks the rock. Too much rain can create flooding, which results in a lot of sediment moving downstream. Heat can dry things out, crack the ground, and even slowly cook one kind of soil into another. Lightning can make glass out of sand, snow can collapse weak ground, not enough rain can dry out ground that could si.nk down without the extra pressure, and too much rain can literally move mountainsides if enough water adds its weight to the rocks and dir.t.

It’s always changing, and there is always more complexity to go into when studying it. There’s seldom a single cause, or reason, or effect for anything.

Explanation:

Have a great day!

The surface of the earth is constantly changing.

Explanation:

Wind, water,and ice break down large rocks and move sediments on the surface. Some events, though, change earth's surface much more quickly. These include volcanic eruptions, earthquakes, and landslides.

In which state elements occurs?​

Answers

An element is said to exist in free state if it does not combine with any other element. Rather, free state elements are stable even without combining.

Other Questions
25 Points please help!!! I need help with the answer to this question.9 - 3 divided by 1/3 + 1 = ?Will give the ranking thing to best explanation.(sry I dont know the name of what the ranking is called) Which of the following situations can be modeled by the expression 5 - (-3)?Kylie is three years younger than Tyler, and Claire is five years older than Kylie. How many years separate Tyler and Claire?Kylie is three years younger than Tyler, and Claire is five years older than Tyler. How many years separate Kylie and Claire?None of the above.Kylie is three years younger than Tyler, and Claire is five years younger than Tyler. How many years separate Kylie and Claire? A double-threaded Acme stub screw of 2-in. major diameter is used in a jack having a plain thrust collar of 2.5-in. mean diameter. Coefficients of running friction are estimated as 0.10 for the collar and 0.11 for the screw. a. Determine the pitch, lead, thread depth, mean pitch diameter, and lead angle of the screwb. Estimate the starting torque for raising and for lowering a 5000-lb load.c. What is the efficiency of the jack when raising the load?d. Would the screw overhaul if a ball thrust bearing of negligible friction were used in place of the plain thrust washer? Solve, 7x-5y=20-8x-3y=12 Help me plz I would really appreciate it! Your class is learning to tie knots. Each student needs a piece of rope that is 3/6 yard long how many yards of rope are needed for the 16 students in your class. what allows a viral disease to be incurable? Given below, if Xy and are congruent, what is the measure of A. 140B. 280C. 100D. 80(its A. 140) What is the dependent variable in this graph What does it mean to snap back? Extraterritoriality definition Which of the following is a benefit of imperialism for the imperialist country (such as Britain)? 557.59 in terms of pi Graph the system of linear equations in desmos. identify the solution to the system of linear equations.y=1/2x+52x+3y=-6 Please, someone, help me with this asap! Answer the following questions in complete sentences:1. What are patronymic names? What are matronymic names?2. Give three examples of prefixes or suffixes used to indicate patronymic names and an example of each (ex. -son, Erickson). Do not use the example.3. Explain how nicknames became surnames.4. Give five examples of surnames that were nicknames.5. Were all occupational names given literally the occupation of the person given the name?6. What is one reason a person might have received an ornamental or acquired name? (Answer in complete sentences).7. Give five examples of place or location names. A two-digit integer is randomly selected. What is the probability that its digits aredifferent? Express your answer as a common fraction. Gerry purchases 12 hamburgers at a fast food restaurant for $2.25 each. For half the amount of money, he could purchase 5 buffalo chicken sandwiches. What is the half amount? outline how the appropriate features that may be used to ensure that the document is free of spelling and grammatically errors. pls add the polynomials and find degree 1. p(x) = 6x 7x + 2 q(x) = 6x 7x +15 2.h(x) = 7x 6x + 1 f(x) = 7x + 17x 9