Answer:
I believe surface
Explanation:
which type of cell does the strainer best model?
Answer:
D
Sieve tube element, because it has openings that allow materials to pass through its end walls.
Answer:
D. Sieve tube element, because it has openings that allow minerals to pass through its end walls
Explanation:
I'm taking the test right now, I hope this helps
How does the double helix structure of DNA support its role in encoding the genome?
1)The sugar-phosphate backbone provides a template for DNA replication
2)tRNA pairing with the template strand creates proteins encoded by the genome
3)Complementary base-pairing creates a very stable structure
4)Complimentary base pairing allows for easy editing of both strands of DNA
Answer: Complementary base- pairing creates a very stable structure
Explanation:
The double helix structure of deoxyribonucleic acid (DNA) support its role in encoding a genome because the: 3. Complementary base-pairing creates a very stable structure.
A double helix can be defined as the spiral configuration of the deoxyribonucleic acid (DNA) molecule.
In Biology, a double helix is typically used to describe the molecular structure of a double-stranded deoxyribonucleic acid (DNA) molecule, which comprises two (2) linear strands that are complimentary and run opposite to each other and twist together (anti-parallel).
Hence, the complementary base-pairing in a double-stranded deoxyribonucleic acid (DNA) or double helix structure of deoxyribonucleic acid (DNA) helps to create a very stable structure, which in turn makes it possible to encode a genome.
Read more: https://brainly.com/question/19755749
15. Mutations that affect the body cells of an organism are called a. Enzyme mutations b. Gamete mutations c. Somatic mutations O d. Neutral mutations
Answer:
C. Somatic
Explanation:
hope it helps ya :D
When is carbon dioxide used during photosynthesis?
A. Light- independent reaction
B. Light-dependent reaction
C. Carbon dioxide is made, not used
Answer:
Pretty sure its b.
Explanation:
3.4.3 Lab: Why are cells so small?
Answer: The important point is that the surface area to the volume ratio gets smaller as the cell gets larger. Thus, if the cell grows beyond a certain limit, not enough material will be able to cross the membrane fast enough to accommodate the increased cellular volume. ... That is why cells are so small.
Explanation: because they can absorb nutrients much more efficiently. Because they are smaller they can efficiently absorb enough food. ... When a cell doubles in size the volume increases much more then the surface area, which is why large cells cannot receive enough food efficiently for their volume. Cells are small because they are more efficient as smaller entities. Information within small cells is transmitted more quickly and efficiently than within larger cells. ... Thus a higher cell surface area-to-volume ratio, i.e., smaller cell size, is desired for most efficient cellular activity.
The cells are so small because their small size allows them to take in food and get rid of the waste.
The cells are the basic structural and functional unit of all organisms on earth except the Viruses. The size of the cell is so little it allows the organism to maximize the ration of surface area to volume. Smaller cells are expected to have greater ratio which promotes more molecules as well as ions to move across the plasma membrane.The small size of the cell facilitate to get the nutrients inside the cell and waste outside the cell quickly. Hence, small size of cell facilitates to get food inside and get rid of waste.Learn more about cell:
https://brainly.com/question/3142913
What boundary is present at the Philippine plate and the Eurasian plate?
A convergent boundary resulting in earthquakes and volcanic activity
B transform boundary resulting in fault lines and shallow earthquakes
C divergent boundary resulting in mid-ocean ridge and creation of new sea floor
D convergent boundary resulting in mid-ocean ridge and widening of ocean basic
Answer:
D
Explanation:
Which antibody class was produced first in this sequence of events
Answer:
IgM
Explanation:
........ ............ .
Which statement is best represented by the diagram?
All carbon is in the form of carbon dioxide,
Carbon can exist in many forms, but the total amount of carbon stays the same.
The amount of carbon in the cycle can increase or decrease based on the number of factories present.
Only living things release carbon dioxide into the atmosphere.
Answer:
All carbon is in the form of carbon dioxide
How many layers are in a typical landfill liner between the clay in the ground
and the solid waste?
Select one:
a. 2
b. 3
c. 4
d. 10
Clever ones this is one for you
If you throw a pebble into a pond, ripples spread out from where it went in. These ripples are waves travelling through the water. The waves move with a transverse motion. The undulations (up and down movement) are at 90° to the direction of travel.
Answer:
so please Indicate your question
(I will give a Brainliest) Can liquid water and steam exist at 100°C?
Answer: yes it can!
Explanation: hope you get a good grade!
MARKING PEOPLE AS BRAINLIDT IF CORRCET
True or False: Bone cells contain different DNA than blood cells.
Answer:
True the bone cells do have different DNA than blood
Explanation:
1. How can we identify a market for vegetables? Write.
2
How do you get vegetables to the market? Write the procedures in brief.
1.
Marketing is one of the most important factors in determining the success of any fruit and vegetable farming enterprise. Marketing includes all the operations and decisions made by producers. These decisions range from deter-mining the most marketable crops for production to deciding how to best deliver quality produce to the consumers at a profit. However, contrary to popular belief, marketing does not begin after a crop is produced. Instead, marketing alternatives need to be considered even before production takes place.
2.
Recent environmental and food safety concerns in the United States produce sector have brought about increasing interest in organic fruit and vegetable production as an alternative to traditional fruit and vegetable enterprises. As a result, the production and marketing of organic crops has expanded steadily during the 1980s. However, as more organic producers enter the industry and it becomes more and more competitive, existing producers are forced to become better growers and more effective marketers.
Please help I will give a brainliest
Answer:
answer
Explanation:
im not that good w these sorry
once, more than once, or not once, more than once, or not at all.
This group of questions refers to molecules of the following substances.
(A) Cytochrome
(B) FADH
(C) NAD
(D) NADP
(E) Oxygen (02)
Answer:
a
Explanation:
Two molecules of ATP are generated for every one molecule of glucose in ... a cell needs more NADPH than it does ribose 5-phosphate. ... Practice: Which one of the following is NOT a potential fate of pyruvate ? a.
Modern whales evolved from mammals that lived on land. Fossil evidence reveals that one characteristic that has changed over time is the position of whales nostris. The images below show the skills of a modern whale
and its ancestor, Pakicatus
Nostrils at front
of skull
Nostrils at top
of skull
Pakicetus
Eschrichtius
cientists think that the position of the nostrils gives modern whales an evolutionary advantage. Which of the following most likely describes how this adaptation is advantageous?
O The nostril position allows whales to obtain air more easily at the surface of the water.
The nostril position allows whales to obtain food more easily at the surface of the water.
O The space lett empty by the migrating nostrils has allowed modern whales to develop gills.
The space left empty by the migrating nostrils has allowed modern whales to develop teeth.
Answer: Its A my friend, how it helps!.
Explanation: I just completed the Test.
The nostril position allows whales to obtain air more easily at the surface of the water is most likely describes the advantage of adaptation.
What do you mean by adaptation?In biology, adaptation has three related meanings. It is the dynamic evolutionary process of natural selection that fits organisms to their environment, enhancing their evolutionary fitness. Secondly, it is a state reached by the population during that process.
The ability of living organisms to adjust themselves to their surroundings is called adaptation. Adaptations are the changes in structure or behaviour of an organism that will allow the organism to survive in that habitat.
Adaptations are unique characteristics that allow animals to survive in their environment. There are three types of adaptations: structural, physiological, and behavioral.
Learn more about adaptation:
https://brainly.com/question/12534888
#SPJ2
ALOT OF POINTS PLEASE HELP :)
How did humankind discover the presence of DNA?
Answer:
The real breakthrough in understanding DNA, however, came with the discovery of its structure in 1953. The discovery of the structure of DNA is often credited to James Watson and Francis Crick.
Explanation:
The pigment plants have that they use for photosynthesis is called ————
I don’t want a explanation I just want the answer
Answer:
chlorophyll is the answer
18. How has the use of herbicides affected agricultural productivity?
O A. Fewer crops are organic because of the use of Bt toxin.
B. Fewer pesticides are needed because of parasitoids.
O C. Fewer people are needed to weed because of herbicides.
D. Fewer crops are produced because of herbicides.
Answer:
B. Fewer pesticides are needed because of parasitoids.
Explanation:
Herbicides are chemicals utilized to manage or command unwanted vegetation. Herbicide employment happens most commonly in row-crop cultivation, where they are employed before or throughout seeding to maximize yield productivity by decreasing other vegetation. Yields have improved considerably, and, in association with tillage, herbicide use decreases erosion, fuel usage, greenhouse gas discharges, and nutrient run-off, and preserves water.
Please I need Help!!
● Prophase I
● Metaphase I
● Anaphase I
● Telophase I
● Prophase II
● Metaphase II
● Anaphase II
● Telophase II
Answer:
Its in this order: 3 - 4 - 1 - 6 - 5 - 7 - 2 - 8
Explanation:
I learned this a while ago so I would know
in what form is carbon found in the atmosphere?
Answer:
carbon dioxide(CO2)
Methane gas(CH4)
Explanation:
Answer:
CO2
Explanation:
Help I need helpppppppoo
a sedimentary rock formed from clay deposits
Answer:
is it shale
sorry if that's not right it's kinda confusing how you put the question
Explanation:
Place the following molecules in order of size (smallest to largest): glucose, water, starch. What evidence helped you determine the answer?
Worst tsunami in modern times
plz HELP
Answer:
Maule, Chile 2010: Chile and other countries.
Explanation:
I am really smart but not inna nerdy way and i already learned about this so here ya go :)
which statement describes what happens to rocky shorelines that absorb energy from ocean waves?
Answer:
Solid rock break apart
Explanation:
TACTTAGAGGCACCACATGGGCCTTGCACT to mRNA
Answer:
I don't know the answer
Explanation:
is is this even a question cos I don't think so.
PLEASE HELP I WILL MARK BRAINLIEST. Listed in the Item bank are key terms and expressions, each of which is associated with one of the columns. Some terms may display additional information when you click on them. Drag and drop each item into correct column. Order does not matter. PLEASE HELP
Producer: Grass, trees, algae
Consumer: Birds, cows, humans
Decomposer: Earthworms, fungi, mushrooms
Answer:
Producer: Grass, trees, algae
Consumer: Birds, cows, humans
Decomposer: Earthworms, fungi, mushrooms
Explanation:
Hope This Helps!
Please Mark Me Brainly!
What might be the consequences of your choice?
• Political:
• Economic:
• Social:
Answer:
Political: Lobbyists.
Economic:Farmers and industrial companies will significantly reduce their output and reduce local jobs. The companies that sell pesticides and fertilizers to local companies will also suffer losses. Farmers will suffer the most if they are unable to find safer fertilizers and pesticides to use.
Social:After a period of time, water pollutants will reduce to safe levels. This could be a long wait. Poverty may increase in the region due to lost jobs and income.
Explanation:
which of the following are part of the central nervous system?
Answer:
The central nervous system is made up of the brain and spinal cord
Explanation:
ion if that's the answer you were looking for but here go.