Answer:
Urine Is 95% Water
Explanation:
The Glomerulus Filters Water and Other Substances from the Bloodstream
The Filtration Membrane Keeps Blood Cells and Large Proteins in the Bloodstream
Reabsorption Moves Nutrients and Water Back into the Bloodstream
. Waste Ions and Hydrogen Ions Secreted from the Blood Complete the Formation of Urine
Why most foods needs to be digested? Give at least 3 reasons
Answer:
Why most foods needs to be digested? Give at least 3 reasons.
Explanation:
Foods must be digested cause of the following reasons:
1. To get energy the food must be digested.
2. To provide nourishing vitamins and minerals to our body.
3. You will be affected by some diseases if you didn't digest your food.
What are three differences between rocks and soil
Answer:
Rocks are made of one or more minerals. based on the way the rock was formed: sedimentary metamorphic and igneous Soil is formed of fine rock particles mixed with air, water and particles from dead plant and animal matter.
if a sample known to be about 11,460 years old and has 400 carbon 14 Adams how many atoms are in the sample when organisms just died
Answer:
There are 1600 atoms when organism just died.
Explanation:
The statement is incorrect. The correct statement is:
If a sample known to be about 11,460 years old and has 400 carbon 14 atoms. How many atoms are in the sample when organisms just died?
The amount of atoms associated with radioactive isotopes decreases exponentially in time by means of the following formula:
[tex]n(t) = n_{o}\cdot e^{-\frac{t}{\tau} }[/tex] (1)
Where:
[tex]n_{o}[/tex] - Initial amount of atoms.
[tex]n(t)[/tex] - Current amount of atoms.
[tex]t[/tex] - Time, measured in years.
[tex]\tau[/tex] - Time constant, measured in years.
In addition, the time constant can be calculated in terms of the half-life of the radioactive isotope ([tex]t_{1/2}[/tex]), measured in years:
[tex]\tau = \frac{t_{1/2}}{\ln 2}[/tex] (2)
If we know that [tex]t_{1/2} = 5,730\,yr[/tex], [tex]t = 11,460\,yr[/tex] and [tex]n(11,460\,yr) = 400[/tex], then the initial amount of atoms is:
[tex]n_{o} = \frac{n(t)}{e^{-\frac{t}{\tau} }}[/tex]
[tex]\tau = \frac{5,730\,yr}{\ln 2}[/tex]
[tex]\tau \approx 8,266.643\,yr[/tex]
[tex]n_{o} = \frac{400}{e^{-\frac{11,460\,yr}{8,266.643\,yr} }}[/tex]
[tex]n_{o} \approx 1600[/tex]
There are 1600 atoms when organism just died.
Which best describes the importance of meiosis to living organisms? *
O genetic variation and growth
O growth and development
O development and sexual reproduction
O sexual reproduction and genetic variation
True of False: Marsh was able to prove that animals changed over time.
Answer:
True
Explanation:
Hope this helps :D Have a great day..can i hav brainliest?
please help
Explain how an organ and organelles are related
Answer:
Just as organs are separate body parts that perform certain functions in the human body, organelles are microscopic sub-units that perform specific functions within individual cells. Organelles are specialized structures that perform various jobs inside cells.
Organelles are microscopic subunits that carry out certain tasks within individual cells, whereas organs are distinct body sections that carry out specialized tasks for the human body.
What is the relation between organ and organelles?Literally, the phrase refers to “tiny organs.” Organelles provide specialized functions to keep a cell alive, much like organs like the heart, liver, stomach, and kidneys serve specific functions to keep an individual alive.
Atoms, molecules, organelles, cells, tissues, organs, organ systems, and the human organism are the major levels of organization in the body, going from the simplest to the most complex.
Like an organ in the body, an organelle is a subcellular structure that performs one or more particular functions for the cell.
Therefore, organ and organelles differ in their functioning.
Learn more about organ and organelles here:
https://brainly.com/question/22911736
#SPJ2
why does the temp of the air increase with the height of the stratosphere?
Answer:
The hot air rises and the cool air falls
Explanation:
Which of these is the form in which
igneous rock begins?
A. sediment
B. magma
C. carbon
D. soil
Answer:
B)Magma
Explanation:
If you were on the ISS (International Space Station), how would you know that a solar eclipse took place on Earth?
Answer:you could ask your family or look it up you ar probably right next to a sadelite
so connection should be pretty good
Under certain external conditions, a person will perspire a great deal. For which internal condition does this response primarily provide homeostasis?
Answer:
Abnormally high temperature
Explanation:
Sweating or perspiration is a homeostatic response to abnormally high body temperature. Evaporation of the sweat causes cooling of the body and this causes the temperature of the body to return back to normal.
When the setpoint temperature of the body is breached by being too high, the negative feedback mechanism kicks-in, and the sweat glands of the skin becomes activated. The body sweats, and the evaporation of the sweat from the surface of the skin causes cooling and a return back to the setpoint.
4 points
The inferred temperature and pressure of Earth's
interior at a depth of 3,000 kilometers are
approximately
(1) 1000°C and 0.5 million atmospheres
(2) 1000°C and 1.0 million atmospheres
(3) 5000°C and 1.5 million atmospheres
(4) 5000°C and 3.0 million atmospheres
Answer:
(4) 5000°C and 3.0 million atmospheres
Explanation:
The inferred temperature is 5000°C and pressure of Earth's interior is 3.0 million atmospheres at a depth of 3,000 kilometers. At the depth of 3000 kilometers, core of the earth is present which is very hot and it is mostly consist of iron. The inner core has a radius of about 1,220 kilometers while the outer core is about 1,400 miles thick which comprise of iron, Nickle, gold, platinum, and uranium elements.
structures in the cell
A cell consists of three parts: the cell membrane, the nucleus, and, between the two, the cytoplasm. Within the cytoplasm lie intricate arrangements of fine fibers and hundreds or even thousands of miniscule but distinct structures called organelles.
Michael loves playing his clarinet and believes it attracts more rabbits than any other instrument he
has played. In order to test his hypothesis, Michael played a song on his clarinet for a total of 5
minutes and counted the number of rabbits he saw in his front yard. He played the song a total of 3
times on his clarinet and repeated the experiment using a flute and a guitar. He also recorded the
number of rabbits he observed when he was not playing an instrument. The results are shown in the
chart.
Number of Rabbits
TRIAL
NO MUSIC
CLARINET
FLUTE
GUITAR
15
1
2
3
5
3
2
10
12
5
8
9
12
18
7
1) What is the independent variable?
2) What is the dependent variable?
3) What is the experimental group?
4) What is the control group?
5) What is one constant from the experiment above??
Answer:
Independent variable: type of instrument
Dependent variable: Number of rabbits attracted
Experimental group: The group when he played an instrument
Control group: The group when not playing an instrument
Constant: Same song
Explanation:
1. Independent variable is the variable that the experimenter changes or manipulates in an experiment. In this experiment, the variable that is changed is the TYPE OF INSTRUMENT used (clarinet, flute, guitar), hence, it is the independent variable.
2. Dependent variable is the variable that is measured in an experiment. It is the variable that responds to the changes made to the independent variable. In this experiment, the dependent variable is the "NUMBER OF RABBITS ATTRACTED" by the instrument played.
3. Experimental group is the group of an experiment that receives experiment treatment, which is the independent variable. In this case, the experimental group is the GROUP IN WHICH INSTRUMENT WAS PLAYED.
4. Control group is the group that does not receive the experimental treatment. In this case, the control group is the group in which INSTRUMENT WAS NOT PLAYED.
5. Constants are those variables that remains unchanged for all groups throughout the experiment. In this case, one constant is the SAME SONG played.
tall pea plants are dominate over pea plants if two hybrids (Tt) are crossed
Answer:
Naruto usamaki is the greatest hokagey in the leaf village
70 POINTS Use the library and other reference materials to research the discovery of radioactivity and its current applications. Then, write a 500 word report on what you have learned. Be sure to include the contributions of French chemists Marie Curie and Pierre Curie and the medical uses of radiation.
Answer:
can I write an essay
Explanation:
On April 20, 1902, Marie and Curie with success isolate radioactive metallic element salts from the mineral uranium ore in their laboratory in Paris. In 1898, the Curies discovered the existence of the weather radium and metallic element in their analysis of pitchblende. One year once analytic radium, they might share the 1903 Nobel prize in physics with French soul A. Becquerel for his or her groundbreaking investigations of radioactivity.
Marie Curie was born Marie Sklodowska in Warsaw, Poland, in 1867. The girl of a physics teacher, she was a talented student and in 1891 visited study at the university in Paris. With highest honors, she received a degree in physical sciences in 1893 and in arithmetic in 1894. That year she met state capital Curie, a noted French man of science and chemist who had done vital add magnetism. Marie and Pierre married in 1895, marking the start of a scientific partnership that will accomplish world renown.
Describe some of the reasons for exploring the mid-Cayman ridge.
Answer:
Life on Earth goes back almost 4.1 billion years, but photosynthesis as characterized by cyanobacteria only appeared around 3.5 billion years ago (Ga). Since life on Earth predates photosynthesis, the exploration of this deep-water environment that lacks any source of light could provide information on what those life forms looked like.
Explanation:
This was the answer on edge
The major reason for exploring the mid-Cayman ridge is to provide
information on what those life forms looked like.
What is Photosynthesis?This is the process in which plants manufacture their food in the presence
of sunlight and other compounds.
The mid-Cayman ridge which is present in a deep water environment has
lacks any source of light has some life-forms present. The exploration was
to find out the type of life forms present and how they appear.
Read more about Mid-cayman ridge here https://brainly.com/question/2747950
Write any three differences between mass and weight
please its aurgent fast
Answer:
See explanation
Explanation:
There are a number of differences between mass and weight, they include;
Mass is a scalar quantity whereas weight is a vector quantity.
Mass is dependent on the quantity of matter present in a body whereas weight depends on the acceleration due to gravity in a particular location on the earths surface.
The SI unit of mass is kilogram whereas the SI unit of weight is Newton.
Question 14 (2 points)
(06.03 MC)
Which of the following correctly identifies a lymphatic organ and describes how it
can fight cancer? (2 points)
1) Lymph vessel; removes fluid from tissues
2) Lymph trunk; returns lymph to the blood
3) Spleen; replaces damaged red blood cells
4) Thymus; exposes lymphocytes to antigens
All of the statements correctly identify a lymphatic organ. In vertebrates, the lymphatic organs, also known as the lymphoid system, are an organ system that is a part of the immune system and works in conjunction with the circulatory system.
The Lymphatic OrgansLymphatic vessels, which are found all over your body and transport lymph away from tissues, are a network of capillaries (microvessels) and a huge network of tubes.By emptying into the corresponding subclavian veins, the lymph ducts, which are formed by the lymph trunks, restore lymph to circulation.Red blood cells that are outdated or damaged are eliminated by the spleen, which also removes cellular waste from circulation.Training specific white blood cells known as T-lymphocytes or T-cells is the thymus gland's main job.Hence, all of the statements correctly identify a lymphatic organ.
How lymphatic system fights Cancer?Regional lymph nodes, which are predictive of distant organ metastases and poor survival, are accessible to tumor cells via lymphatic arteries.As the lymph fluid moves through the lymph nodes, it is filtered. B cells and T cells, two types of white blood cells, assault any viruses or bacteria they discover in the lymph.To learn more about the Lymphatic System refer to:
https://brainly.com/question/13676212
#SPJ1
Wyatt has heart problems
Answer:
If Wyatt has heart problems, Wyatt can eat healthy foods to try and decrease the problems, Wyatt can also make sure that his weight and blood pressure isn't to high. Wyatt can try to get seen at the hospital to make sure everything is fine.
When a strong acid is added to a strong base a_________________ reaction occurs in the product will have a PH closer to_____
A. Neutralization,7
B. Ionic,0
C. Concentration,14
Answer:
A
Explanation:
Acids and bases when mixed neutralize eachother. and 7 is neutral on the PH scale
Plants release a different gas back into the air. What is the name of that gas?What is the name of the gas that plants absorb from the air and use to grow?
In mature animals when do cells still need to differentiate?
Answer:
As an organism develops, cells differentiate to form different types of cells. Most types of animal cell differentiate at an early stage. Many types of plant cells retain the ability to differentiate throughout life. In mature animals, cell division is mainly restricted to repair and replacement.
Explanation:
''.''
In mature animals cells differentiate during : Repair and replacement of animal cells
Cells differentiate in organisms and plants to create more cell types, as the organism and plants continue to mature. While cell differentiation in animals occur mostly before maturity, plants cells continue to differentiate until they die.
While in mature animals, cells differentiates at maturity only when the cells of the mature animal needs repair or replacement due to damage caused to the a cell or tissue.
Hence we can conclude that in mature animals cells differentiate during repair and replacement of cells.
Learn more : https://brainly.com/question/19015367
decode CCGCTTTCGCTATTATAAAAAGGGCTATAACTA
Answer:
GGCGAAAGCGAUAAUAUUUUUCCCGAUAUUGAU. I think sorry if I'm wrong
What are the three main classifications that describe galaxies? By what one visible
characteristic do scientists categorize galaxies?
Answer:
Spiral Galaxies, Elliptical Galaxies & Irregular Galaxies
Explanation:
How did galaxies originate? Astronomers believe that after the big bang, the explosion which began the universe 10 billion to 20 billion years ago, gravity began to compress masses of free-floating gas. Two main theories, bottom-up and top-down, explain what happened next. According to bottom-up theories, clusters began to form and assembled together into the larger units we know as galaxies. Top-down theories suggest that galaxies formed first, and the stars and other objects within them were subsequently produced. They categorized different galaxies to maintain their tests from the other galaxies.
To sciences do not agree on which type of grocery bag is better for the environment what is the most likely outcome of this disagreement
Answer:
paper bags jute bags , cotton bags might be used for the environment
multiple choice
Daytime temperatures on Mercury are extremely hot because:
1. it is close to the sun
2. it has long days
3. one side is facing the sun
4. it gives off internal heat
5. there are volcanoes
Answer: it has long days
Explanation:
There are many different types of cells with many different types of cellular structures and functions. Which of these structures is found in all types of eukaryotic cells?
A. chloroplast
B. cell wall
C. nucleus
D. centrioles
Answer:
nucleus
Explanation:
chloroplasts and cell walls are only found in plant (and fungi) cells, while centrioles are only in animal cells.
The structure that is found in all types of eukaryotic cells is the nucleus. The correct option is C.
What are eukaryotic cells?Eukaryotic cells are those cells that contain true cell organelle. These cells are present in the higher organism, and they perform complex functions like replication, mitosis, etc.
There are two types of cells. They are prokaryotic and eukaryotic cells. Prokaryotic cells are those that do not contain an organelle and a nucleus. They are present in smaller organisms.
The nucleus is the brain of cells. It controls all functions of cells, and it contains the genetic material of the organisms. In prokaryotic cells, the nucleus is absent and in eukaryotic cells, the nucleus is present. That is the difference between them.
Thus, the correct option is C. nucleus.
To learn more about eukaryotic cells, refer to the link:
https://brainly.com/question/982048
#SPJ6
The recessive gene for blood typing s...
Type O
Type A
Type B
Type AB
Answer:
Image result for what is The recessive gene for blood typing
Because A is dominant, that means your mother could carry a hidden O. If she does then when she gets pregnant, each child has a 50% chance of getting her dominant A and a 50% chance of getting her hidden, recessive O. If the child gets the O from mom and an O from dad, he or she will have an O blood type.
Explanation:
Brainliest if right?
A simple life cycle is one in which the offspring look similar to their parents.
True
Or
False
Answer 15 and 16 correctly and I will mark as brainliest
Answer:
I think its A and G
Answer:
15. B.
16. H
Explanation: