During World War II, the government _____(took over/ signed contracts with/ closed down many) private American industries to help the war effort.

US automobile manufacturers ______(stopped building cars/ built more cars/ shut down their factories) during the war at the government's request.

Wartime production was boosted by _____(government owned companies/ private businesses/ the government and private businesses working together).

During the war, people's working hours _____ (increased/ decreased/ stayed the same).

During World War II, The Government _____(took Over/ Signed Contracts With/ Closed Down Many) Private

Answers

Answer 1

Answer:

During World War II, the government  

✔ signed contracts with

private American industries to help the war effort.

US automobile manufacturers  

✔ stopped building cars

during the war at the government’s request.

Wartime production was boosted by  

✔ government and private business working together  

During the war, people’s working hours  

✔ increased

.

Answer 2

During World War II, the government  signed contracts with private American industries to help the war effort.

US automobile manufacturers stopped building cars during the war at the government’s request.

Wartime production was boosted by government and private business working together.  

During the war, people’s working hours increased.

What was the World War II?

World War II, also known as the Second World War, was a global conflict that lasted from 1939 to 1945. The vast majority of the world's countries, including all of the world's great powers, formed two opposing military alliances: the Allies and the Axis powers.

During WWII, the government entered into contracts with private American industries to aid the war effort. At the request of the government, US automakers ceased production of automobiles during the war. Government and private industry collaboration boosted wartime production. People's working hours increased during the war.

To learn more about the World War II, click here:

https://brainly.com/question/7745710

#SPJ2


Related Questions

The advent of the steam-transportation, machine-industralization and the telegraph( and eventually the phone) were all part of the era in American knows as The...

Answers

Based on the information given, it should be noted that this period was known as the Industrial Revolution.

The Industrial Revolution was simply the transition to the manufacturing sector from the agrarian economy in the country. This period was dominated by industries.

The Industrial Revolution brought about the advent of the steam-transportation, machine-industralization and the telegraph and eventually the phone.

Learn more about Industrial Revolution on:

https://brainly.com/question/1967353

Name and describe one way the Crusades affected the Muslim population.
50 POINTS + BRAINILEST! <3

Answers

Answer:

The Crusaders took over many of the cities on the Mediterranean coast and built a large number of fortified castles across the Holy Land to protect their newly established territories (28.99.1), while also establishing churches loyal to Rome. For the Crusaders, the Dome of the Rock was the Temple of Solomon; the Aqsa mosque was converted to use as a palace and stables.

Hope that helps you. x

Who served as the governor of North Carolina during the Civil War?
Braxton Bragg
Daniel H. Hill
Robert F. Hoke
Zebulon Vance

Answers

Zebulon Vance would be the correct answer for this question! He was the 37th and 43rd governor of North Carolina and held power during the civil war as a governor.

how did the agricultural revolution impact state power?

Answers

Answer:

The Agricultural Revolution of the 18th century paved the way for the Industrial Revolution in Britain. New farming techniques and improved livestock breeding led to amplified food production. This allowed a spike in population and increased health. The new farming techniques also led to an enclosure movement.

PLEASE HELP ASAP 100 POINTS

Answers

Answer: i think A i hope this helps

Explanation:  The purpose of Sherman's March to the Sea was to frighten Georgia's civilian population into abandoning the Confederate cause.

The capital of Texas is located close to three geographic regions. Which of these regions is NOT close to the capital city?

A) Great Plains
B) Central Plains
C) Coastal Plains
D) Mountains & Basins

Answers

Answer:

d

Explanation:

Yellow is the furthest from Austin

President Woodrow Wilson sent troops to Mexico in 1913 to teach Mexico how to elect "good men".

True or false

Answers

Answer:

I'm pretty sure it's true

Mexico's greatest hope for the future lies in

Answers

Answer:

Mexico's greatest hope for the future lies in United States .

Explanation:

It is the country's economic and cultural hub, as well as home to the offices of the federal government. The city has many well-known and respected museums, such as the Museo Casa Frida Kahlo and the Museo Nacional de Historia.

Hope this helps !!

which statement best describes how people travil within cities in the early 1800s?​

Answers

Answer:

I am assuming that people traveled by walking, on horse, in a carriage, by boat, and steam engine.

Explanation:

By horse, carriage, walking, or sometimes cows

Muhammad was a member of the ________ clan in Mecca

Answers

Answer:

Muhammed was a member of the Hashim clan in Mecca

How were the three colonial regions similar and different?

Answers

Answer:

The southern region had more farms and less big cities and the northern region had more big cities and less farms. The middle region was a mix. All were owned by Britain.

Explanation:

The Ganges River, known as "Mother Ganges" is very polluted, why if it is sacred to the Indian people, it is not better protected?
O It is important to the Buddhist religion to scatter ashes of their loved ones in the River
The Ganges is considered so pure, that pollution does not affect the river.
It has dangerous rapids that make cleaning the river very difficult
O It is not a polluted river, the Indian people clean the river monthly

Answers

Answer:

Hindus believe the Ganges is the world's most sacred river and those who bathe in its waters achieve purity. Similarly, those whose bodies are deposited in the Ganges-whether as ashes or corpses-are believed to break the cycle of reincarnation. They become one with God.

Explanation:

Globalization has contributed to the rapid spread of diseases around the
world because it:
A. reduces cooperation among health care professionals in different
countries.
B. isolates vulnerable populations from global health services.
C. limits access to health care by greatly reducing urban population
density.
D. allows people who may carry diseases to easily travel to different
countries.
SUBMIT

Answers

It should be noted that Globalization has contributed to the rapid spread of diseases around theworld because it: D. allows people who may carry diseases to easily travel to different countries.

What is Globalization?

Globalization can be regarded as the movement of people as well as information around the globe.

However,it has contributed to the rapid spread of diseases around the world because people can now move freely from one country to another.

Learn more about globalization at:

https://brainly.com/question/2824360

what is Henry referring to when he writes [we] were taught to believe. That every power not granted was retained?​

Answers

Answer:

The Tenth Amendment was included in the Bill of Rights to further define the balance of power between the federal government and the states

Explanation:

What is TRUE about the scientific method? A. This method focuses on exploring stimuli and responses. B. Psychologists use this method to help reach conclusions. C. This technique is no longer used by research scientists. D. Researchers use this approach to avoid bias in experiments.

Answers

It should be noted that using scientific method, Researchers use this approach to avoid bias in experiments.

According to this question, we are required to discuss about scientific method,  and how it is been used by researcher.

As a result of this we can see that Researchers use this approach to avoid bias in experiments, because a scientific method helps to reach conclusion.

Therefore, D is correct because Researchers use this approach to avoid bias in experiments..

Learn more about scientific method at;

https://brainly.com/question/14125053

Answer:

Psychologists use this method to help reach conclusions.

Explanation:

Review the map.A map titled North American with labels A through D. A is a large body of water off the east coast. B is smaller bodies of water between the United States and Canada. C is a large body of water in eastern Canada that is surrounded by land on 3 sides. D is a long river in the center of the United States.Which letter on the map marks the Great Lakes?ABCD

Answers

Answer:

the answer is b i got it right on my test on edge 2021

Explanation:

A map titled North American with labels A through D is a smaller body of water between the United States and Canada. Thus, option 'B' is the correct option.

What is a map?

A map is a sign that emphasizes the connections between various components of an area, such as locations, themes, or items. Some maps are dynamic or interactive, while others are static and attached to paper or another long-lasting material.

Maps may represent any location, actual or imagined, without respect to context or size, as shown in brain mapping, DNA mapping, or computer network topology mapping, despite the fact that they are most frequently employed to describe geography.

The space that is being mapped might be two-dimensional, like the earth's surface, three-dimensional, like the earth's interior, or even more abstract spaces of any dimension, like those that emerge when modelling phenomena with many independent variables.

Learn more about maps here:

https://brainly.com/question/1565784

#SPJ3

Which processes form glaciers

Answers

Answer:

erosion , weathering , transportation and deposition.

Answer:

accumulation and compaction

Explanation:

what is the impact of the world war 2​

Answers

World War II was the deadliest military conflict in history in terms of total dead, with some 75 million people casualties including military and civilians, or around 3% of the world's population at the time. Many civilians died because of deliberate genocide, massacres, mass-bombings, disease, and starvation.

It should be noted that the impact of World War II was destruction to the world's population.

World War II can be regarded as a global war which was recorded as the deadliest military conflict in history.

During this war there was;

deliberate genocide massacres mass-bombings diseasestarvation.

Therefore, World War II was destruction to the world's population.

Learn more about World War II here

https://brainly.com/question/15547500

When did the Pilgrims arrive in New England? In 1602 In 1607 In 1620 In 1627​

Answers

Answer:

Hi the answer should be 1620

Explanation:

Hope this helps!

the answer is 1620 hope it helps

How did the invention of the printing press change books during the renaissance

Answers

Answer:

well the invention of the printing press change books during the renaissance was because , A huge increase in the volume of books produced compared to handmade works.

What were some foods that couldn’t grow in Greece so they had to be brought from abroad?

Answers

wheat, barley, pork, cheese, glass, and ivory.

PLS HELP! How did innovations that developed over time - such as writing, trade routes, schools, and the printing press - affect societies?



A They increased the spreading of ideas.


B They reduced the construction of buildings.


C They limited contact between peoples.


D They lowered literacy rates.

Answers

A. They increased the spreading of ideas.

Answer:

yes i can confirm its is A

PLEASE HELP PLEASE HELP PLEASE HELP PLEASE HELP PLEASE HELP PLEASE HELP
Refer to the Newsela article “Should We Abolish the Electoral College?”

The author of the PRO argument states that the National Popular Vote Interstate Compact will correct the imbalance of voting power.

Which statement best explains how the author of the CON argument interprets the idea of National Popular Vote Interstate Compact?

A It overturns what is written in the Constitution about adding amendments.

B It will make the popular vote less powerful than the Electoral College vote.

C It could force states to support candidates that their own citizens did not choose.

D It goes against the basic idea of a representative government.

Answers

c....................................

Answer:

Its C

Explanation:

I took the test :]

Once the president has formally nominated an individual for a federal judgeship, the nominee

Answers

Based on the information given, it should be noted that the nominee must be considered by the Senate judiciary Committee.

It should be noted that the president can formally nominate an individual for a federal judgeship.

When such a scenario happens, the nominee will have to be considered by the judiciary committee of the senate and then confirmed by a majority vote in the full state.

Learn more about nominee on:

https://brainly.com/question/25273589

In which type of US election is it possible for the winning candidate to get fewer popular votes than the opposing candidate?
ОА,
most state government elections
OB.
House elections
O C. Senate elections
OD
most local government elections
OE. presidential elections

Answers

Answer:

The answer is presidential elections

Which element of the U.S government most reflects the constitutional principle of federalism

Answers

Answer:

The principle of Federalism is most reflected in the US Government & the Constitution's limits on the Federal Government's powers and the reservation of powers for the States. This is set forth clearly in the 10th amendment.

Federalism is evident throughout Government. An example of the US Department of Education. Education is a power reserved to the States and so the US Department of Education funds projects and ensures equity but the power to set curriculums is done by the States.

I WILL GIVE BRANILEST

Answers

Answer:

It spells out Americans' rights in relation to their government. ... It guarantees civil rights and liberties to the individual—like freedom of speech, press, and religion. It sets rules for due process of law and reserves all powers not delegated to the Federal Government to the people or the States. Jefferson wanted Bill of Rights for new Constitution. He therefore wanted the new Constitution to be accompanied by a written “bill of rights” to guarantee personal liberties, such as freedom of religion, freedom of the press, freedom from standing armies, trial by jury, and habeas corpus.

Explanation:

Which of the following is an example of absolute location?

Answers

Answer:

A place's absolute location is its exact place on Earth, often given in terms of latitude and longitude. For example, the Empire State Building is located at 40.7 degrees north (latitude), 74 degrees west (longitude). It sits at the intersection of 33rd Street and Fifth Avenue in New York City, New York.

Explanation:

Select all of the major issues below, facing the delegates at the constitutional convention.

- the power of local governments

- State Representation

- Immigration issues

- slavery

- state governmental power versus national governmental power

- Taxation

Answers

Answer:

state representation and state government vs. national government

Explanation:

the biggest conflict of the constitutional convention was getting the states to agree to form a stronger national government. under the articles of confederation states had almost all the power which caused the nation to function poorly in regards to trade, currency, military, and much more. while the states saw the need for a stronger national government they debated how much stronger the national government should be and how the states would be represented in national legislature

What became of most of the central powers’ colonies after world war I?

Answers

Answer:

They became independant nations.

Other Questions
(PLEASE HELP - This is a essay thing that needs done!! I am so behind in assignments I BEG YOU FOR HELP!!) Sometimes, people do not realize justhow amazing they really are; this is evidentin Alberto Moravias Poor Fish. Usingtextual evidence, explain the narratorsstruggle in Poor Fish. Then, discusswhether one persons support and belief ofanother can positively affect that person.*This must be written in third person, andeach body paragraph should include at leastone direct quote from the text. Which of the following are valid names for the given triangle? Check all thatapply. Transcribe the following Strand of DNA:GTCCTTTACCATCGATTGGAAAACGTTAAAATCCAGTTCCAT PLS ANSWER QUICK I HSVE EXAMS COMING UP VERY SOON 42) Which equation best represents the line of best fit for thisscatter plot?A. y = 4x - 4B.y= 4x-2C. y = x-4D. y=x-2-5-4-3- e. Observe: notice or perceivef. Infer:g. Repetition:h. Replication:i. Data What does the narrators description of the wallpaper reveal about the context of the story? The narrator feels imprisoned by her life. The narrator wants everyone to study the wallpaper. The narrator thinks that the wallpaper hides a secret room. The narrator prefers to do her writing work at night. Which phrase best describes the harlem renaissance?. Which graph could potentially have a correlation coeffiecient (r value) of 0.95? According to his running log, Baldwin averaged 4 miles per week last month and 25% more this month. How much did he average this month? can hellp me with this plzzzzzzz no links plz how are continental climates different from temperate climates Which word from Juliet's conversation with her mother is understood oneway by Lady Capulet and another way by the audience?A. CousinB. HeartC. TemperD. Love When corn is to be planted by the Indians, it is the work of the women folk to see to the sorting and cleaning of the best seed. It is also the women's work to see to the planting. (This was in olden times.)After the best seed has been selected, the planter measures the corn, lays down a layer of hay, then a layer of corn. Over this corn they sprinkle warm water and cover it with another layer of hay, then bind hay about the bundle and hang it up in a spot where the warm rays of the sun can strike it. While the corn is hanging in the sun, the ground is being prepared to receive it. Having finished the task of preparing the ground, the woman takes down her seed corn, which has by this time sprouted. Then she proceeds to plant the corn. Before she plants the first hill, she extends her heavenwards and asks the Great Spirit to bless her work, that she may have a good yield. After her prayer she takes four kernels and plants one at the north, one at the south, one at the east and one at the west sides of the first hill. This is asking the Great Spirit to give summer rain and sunshine to bring forth a good crop. For different growths of the corn, the women have an interpretation as to the character of the one who planted it.1st. Where the corn grows in straight rows and the cob is full of kernels to the end, this signifies that the planter of this corn is of an exemplary character, and is very truthful and thoughtful.2nd. If the rows on the ears of corn are irregular and broken, the planter is considered careless and unthoughtful. Also disorderly and slovenly about her house and person.3rd. When an ear of corn bears a few scattering kernels with spaces producing no corn, it is said that is a good sign that the planter will live to a ripe old age. So old will they be that like the corn, their teeth will be few and far between.4th. When a stalk bears a great many nubbins, or small ears growing around the large one, it is a sign that the planter is from a large and respectable family.After the corn is gathered, it is boiled into sweet corn and made into hominy; parched and mixed with buffalo tallow and rolled into round balls, and used at feasts, or carried by the warriors on the warpath as food. When there has been a good crop of corn, an ear is always tied at the top of the medicine pole, of the sun dance, in thanks to the Great Spirit for his goodness to them in sending a bountiful crop.Required:In one to two sentences, explain what the reaction of the Sioux to a good crop shows about the Sioux people. 1) 0.52 + 1.6 + 8.26 =2) 1.4 + 5.98 + 9 + 0.39 =3) 4.45 + 7 + 0.049 =4) 12.54 1. 054 =5) 0. 685 0. 5903 =6) (34. 89) (0.875) =7) (840) (0.625) =8) 28.5 0.87 =9) 104 6.4 = how does one make a plush design for a character with floating limbs metabolism is the chemical process your body uses to breakdown and transform food Help help help help help A number is chosen uniformly at random from among the positive integers less than $10^8$. Given that the sum of the digits of the number is 9, what is the probability that the number is prime Plays tell stories and have characters with conflict. They are written:to be performed on stageto be read silentlyto be ignoredall of the above the study of heritability of behavioral traits is called