Name and describe at least two applications for population estimates.
found more than 400 different mutations in the PAH enzyme that are associated with PKU disease. how many alleles can be found in one individual?
you can only have 2 alleles per gene
When a trait has three or more distinct alleles, we refer to it as having multiple alleles inheritance. The human ABO blood type alleles/trait is an example of a trait with multiple alleles.
primates have long growth and development periods because:
Primates have long growth and development periods because: they have larger brains and higher intelligence as compared to other organisms.
Primates is the order of the class Mammalia. They are different and more advanced from all the other animals. They have more intelligence, five-digit feet and hand, more vision power than smelling power and slower growth. Their life span is also very large.
Brain is the most complex and largest organ of the body. It is the master regulator of all the actions of the body. The brain is divided into left and right hemispheres. There are three sections of the brain: forebrain, midbrain and hindbrain.
To know more about brain, here
brainly.com/question/5361122
#SPJ1
A gecko, which has a spinal column and climb walls, can be classified as what type of animal? An ArachnidAn AmphibianAn invertebrateA vertebrate
Given the characteristics provided: a spinal column and climbing walls; we can classify the gecko as a vertebrate because it has a spinal column (option D).
To make a more specific classification, we would need to know more characteristics of the gecko.
Which relationship is an example of predation?
An example of predation is D) Chickens peck at the ground and eat many types of insects.
Predation is a type of biological interaction in which a predator feeds on its prey. In the above example, chickens are the predators that make insects their prey.
In order for an ecosystem to be healthy, predators are essential. There is more food available for the survival and success of healthy prey species after predators take away vulnerable prey, such as the young, old, sick, injured, or very young. Predators also aid in reducing the size of prey populations, which slows the spread of illness.
What are the types of biological interaction?
Mutualism, commensalism, competition, and predation are the four basic forms of two-way biological interactions between species found in ecological webs (which include herbivory and parasitism).
Therefore, D) Chickens pecking at the ground and eating many types of insects is an example of predation.
To know more about biological interaction, click on https://brainly.com/question/28459604
#SPJ9
Given the structure of protein, why is the energy that is released as heat during chemical reactions not useable for work in biological systems?
Energy exists in different forms, some of which are electrical, heating, chemical, luminous, among others.
Chemical energy in biological systems is based on the formation-breaking of bonds: to form a bond, energy must be expended, while when a bond is broken, energy is released.
Often, these processes require the participation of enzymes within the organisms; enzymes are proteins that decrease the activation energy of a reaction. For example, if a lot of energy is needed to break a bond, the enzyme will help to lower the energy required.
In biological systems such as humans, the energy molecule is ATP, which releases energy when a bond is broken and a phosphate group is released, leaving ADP as a product. And although it is an efficient process, the laws of thermodynamics explain that no process is 100% efficient, and therefore, some amount of energy is always released in the form of heat. Unlike chemical energy, heat energy is not stored in bonds and cannot be catalyzed by enzymes or utilized by biological systems.
which statement best describes an example of how climate change leads to decreased biodiversity?
A. Increased rains in dry regions cause more plants to grow,
increasing the ecosystem's resiliency.
B. High temperatures become more common farther from the
equator, leading to increased stability of the ecosystem.
C. Warmer arctic regions allow for increased animal populations,
changing the ecosystem's resiliency.
0
D. Sea levels rise due to increased temperatures, flooding coastal
areas and leading to an unstable ecosystem.
The statement which best describes an example of how climate change leads to decreased biodiversity is that sea levels rise due to increased temperatures, flooding coastal areas and leading to an unstable ecosystem and is denoted as option D.
What is Ecosystem?This is a term which consists if all organisms and their interaction with their physical environment and is affected or influenced by different types of factors such as human and environmental factors.
An example is climate change which causes sea levels to rise thereby flooding areas. It leads to loss of habitat and an unstable ecosystem which decreases the biodiversity.
Read more about Ecosystem here https://brainly.com/question/842527
#SPJ1
what is the process that allows CO2 and glucose to enters the plants cells chloroplast
Answer: photosynthesis
Explanation:
photosynthesis
Plants use energy from sunlight to turn water and carbon dioxide into an energy-rich sugar called glucose. This process is called photosynthesis, which means “making things with light”. Photosynthesis takes place inside capsules in the leaf cells, called CHLOROPLASTS.
Question 11
You read a news report about a recent large volcanic eruption. It was reported
that the eruption was highly explosive with viscous lava. What type of volcano was
likely responsible for the eruption?
(Hint: the most explosive, dangerous kind)
A cinder cone
B composite
Cshield
The type of volcano was likely responsible for the eruption volcano to its formation would be the composite volcano wherein it usually yields large and violent eruptions.
What is volcano?A volcano has been defined as the hill or mountain or it has an opening in a planet or moon's crust from which molten rock, warm gases, and materials erupt. It has a landform where molten rocks erupt through the surface of the planet and volcano moutains open downwards to molten rocks.
According to Geologists there's are four types of volcanoes and these are lava domes, shield volcanoes, composite volcanoes, and cinder cones.
Therefore, The type of volcano was likely responsible for the eruption volcano to its formation would be the composite volcano wherein it usually yields large and violent eruptions.
Learn more about volcano on:
https://brainly.com/question/13428729
#SPJ1
According to the theory of endosymbiosis, a mitochondria or chloroplast may have been a prey species and was engulfed by a cell or it could have been a parasite that entered the cell. WHY do scientists think that the cell did not destroy or remove these structures?
A: because they competed with the cell
B: because the structures benefited the cell
Answer:
Because the structures benefited the cell
Explanation:
Scientists believe that host cells and bacteria formed a mutually beneficial endosymbiotic relationship when the host cells ingested aerobic bacteria and cyanobacteria but did not destroy them.
Distinguish between monohybrid, dihybrid and test crosses.
In the monohybrid cross, the possible offspring of a cross between two organisms is evaluated, but only one characteristic is taken into account. While in the dihybrid cross two characteristics are evaluated.
However, unlike the monohybrid cross, in the dihybrid cross, combinations of alleles must be made in order to obtain all possible gametes and thus perform the punnet square properly. An example of a dihybrid cross and allele combination is shown in the following image:
Finally, a test cross refers to these two examples. A test cross taking into account only one trait is called a monohybrid cross. A test cross using 2 traits is a dihybrid cross.
9. During which phase does the DNA make
a copy of itself?
a. prophase
b. metaphase
c. interphase
d. anaphase
Answer: A
Explanation:
!!!!
describe how red blood cells are adapted for their function (2 marks)
The adaptations of red blood cells are no nucleus to accommodate more hemoglobin, biconcave shape to be able to pass through extremely small blood vessels, thin cell membrane to let oxygen diffuse faster, and presence of hemoglobin itself, that combines with oxygen to give off its red color.
During what phase of the cell cycle do chromosomes replicate?
The phase of the cell cycle in which chromosomes replicate is the S phase.
What is Cell cycle?This is referred to as the series of events that take place in a cell during the process of reproduction an d in this scenario , the parent cells divide which gives rise to two daughter cells. Chromosome on the other hand is a thread like structure which is made up of DNA.
The S phase occurs between G₁ phase and G₂ phase and is an important process in mitosis as the DNA in the nucleus are synthesized and the traits present are usually passed to the offspring.
Read more about Cell division here https://brainly.com/question/796780
#SPJ1
Looking at your data, which color light was needed the most by chlorophyll during photosynthesis? (Hint: which color light was absorbed the most in your experiment?) Question 9 options:redbluegreen
Chlorophyl absorbs the light at both endpoints of the visual expectrum, which means that ir absorbs the light of the blue and red wavelenghts.
The red wavelength is absorved on a higher rate than the blue wavelength.
Given: dna codon chart, DNA sequence.DNA sequence given is: 3’ TAC CCC GAT AAA ATA CAT TTA GGA TCG CGA TGG TAT 5’How do you transcribe the DNA sequence into mRNA?And can you underline or highlight on the sequence the codons for Proline and Tyrosineand label which is which? Thanks
Step 1:
The process of DNA transcription occurs from the 5' to 3' being the DNA sequence in the correct order for transcription as follow:
5' TAT GGT AGC GCT AGG ATT TAC ATA AAA TAG CCC CAT 3'
Step 2:
Resulting in the mRNA:
5' AUA CCA UCG CGA UCC UAA AUG UAU UUU AUC GGG GUA 3'
- Being the nucleotide thymine replaced by uracil in the formation of the RNA strand.
Step 3:
The codons sequence that form proline and tyrosine are:
Proline: CCA;
Tyrosine: UAU.
watts.
6. Solve a One-Step
Equation A hair dryer is
rated at 1,200 watts. If you
use the dryer for 0.25 hours,
how much electric energy do
you use?
The electrical energy consumed is 0.3 kWh. Electrical energy is energy related to forces on electrically charged particles and electrically charged particle movement.
What is electrical energy?Electrical energy is the ability of an atom's charged particles to perform an action or move an object. Electrical energy is produced by the movement of electrons from one atom to another. When you plug in a toaster or a cellphone charger into a wall outlet, electrical energy is used to power those devices. Electricity can be either kinetic or potential.Batteries, lightning, and electrical charges moving through a wire plugged into a wall socket to power electrical appliances such as televisions and computers are all examples of electrical energy. It now even powers many of our automobiles. It can be found in the clouds above you during a storm even if you travel to the most remote parts of the planet.Therefore,
The amount of electrical energy consumed can be calculated as follows:
E = Pt
where;
P is the power (kW)
t is time (h)
E = 1.2 kW x 0.25 h
E = 0.3 kWh
As a result, the total amount of electrical energy consumed is 0.3 kWh.
To learn more about electrical energy, refer to:
https://brainly.com/question/874116
#SPJ13
The cerebral cortex is divided into two halves called cerebral hemispheres. each cerebral hemisphere has three lobes, the parietal lobe, the frontal lobe, and the occipital lobe.
a. True
b. False
The cerebral hemisphere has four lobes, so the above statement is false.
What is Cerebral cortex?The Cerebral cortex also known as gray matter which comprises the brain’s outermost layer of nerve cell tissue and has a wrinkled appearance from its many folds and grooves. These folds have many groups called sulci and raised areas are called gyri.
These folds add to the surface area of cerebral cortex which allows large amount of information to be processed by Nerve cells. Cerebral cortex makes about half of the total brain mass. It consists of 6 layers which contains approximately 14 to 16 billion Nerve cells, thickness of about 0. 2 mm to 4 mm.
It is divided into four lobes. They are Frontal, Parietal, Temporal and Occipital which is responsible for processing different types of information.
It consist of nerve cell bodies which include end portion of Nerve cells called dendrites that's why it is also called gray matter. These dendrites receive chemical message from another cell cerebral cortex. It is gray in colour because lack of fatty covering of nerve which is called my myelin.
Thus, the cerebral hemisphere has four lobes, so the above statement is false.
Learn more about Cerebral hemisphere, here:
https://brainly.com/question/13543441
#SPJ12
Enzymes_______activation energy and______up chemical reactions.
A. lower, speed
B. speed, lower
C. lower, slow
Answer:
A: lower, speed
Explanation:
Enzymes definitely speed up chemical reactions because they are proteins that act as biological catalysts. Catalysts speed up reactions without being used up themselves. They are reusable.
Lowering the activation energy makes the reaction faster because less energy is required to do the same task.
B and C do not make sense because speed activation energy doesn't make sense and slow up doesn't make sense either.
Which of the following molecules provides the greatest energy storage capacity in animal cells?
A. starch
B. proteins
C. triglycerides
Triglycerides are the molecules that provide the greatest energy storage capacity in animal cells.
What is triglycerides?Triglycerides are the type of fat also called lipids that are found in your blood. When you eat, your body converts calories that it does not need to use into triglyceride molecules. The triglycerides are stored in the fat cells. After the hormones release triglycerides for energy between eating. Sugary food, sweat drinks, saturated fats, refined grains, alcohol, and foods having high-calorie all lead to high levels of triglycerides. The healthcare provider classifies high triglyceride levels i.e. Mild levels as 150-199 mg/dL, Moderate level has 200-499 mg/dL, and Severe levels has Greater than 500 mg/dL. Very high triglycerides may cause blocking of the blood supply to the heart or brain. Symptoms of lower blood supply to your heart could be chest pain.
So we can conclude that option C is the correct answer.
Learn more about energy here: https://brainly.com/question/13881533
#SPJ1
Which action would most likely lead scientists to change or improve an existing scientific theory about evolution?
Answer: Gathering new evidence using new technologies or procedures most likely will lead scientists to change or improve an existing scientific theory (Option D).
Explanation:
I’m am unsure of the steps to solve this and what to get for the answer
Protein synthesis is the process by which information is taken from DNA, passed to RNA by a process called transcription and finally to protein by another process called translation.
Mutation 1
5' AGTTTGCACTTGTAGAGGATGAAGCCGCACGTACATCA 3'
Mutation 1 (transcription): With RNA we use uracil instead of thyimine. We also use the reverse complementary sequence. Since transcription occurs from 3' to 5'.
3' UCAAACGUGAACAUCUCCUACUUCGGCGUGCAUGUAGU 5'
Same sequence but from 5' - 3':
5' UGA-UGU-ACG-UGC-GGC-UUC-AUC-CUC-UAC-AAG-UGC-AAA-CU 3'
Mutation 1 (translation) Finally, the translation occurs from 5' to 3' and we can known the protein sequence using the next table:
Stop-Cys-Thr-Cys-Gly-Phe-Ile-Leu-Tyr-Lys-CysLys
It should be noted that each chain will give rise to different amino acid sequences.
Help asap…
1. In which organs is food moved through by peristalsis? (Choose all that apply)
A.stomach
B.small intestine
C.esophagus
D.liver
2. What is the substance produced by the liver that is necessary to break down fat drops into smaller fat drops?
A.bile
B.enzyme
C.acid
D.mucus
Answer:
1. A,B,C
2. A
Explanation:
1. Peristalsis is the automatic wave-like movement of the muscles that line your gastrointestinal tract. Peristalsis moves food through your digestive system, beginning in your throat when you swallow and continuing through your esophagus, stomach and intestines while you digest.
2. Bile is a fluid that is made and released by the liver and stored in the gallbladder. Bile helps with digestion. It breaks down fats into fatty acids, which can be taken into the body by the digestive tract.
please help. Due in the morning.
Answer: See below
Explanation:
The Male P1 Mouse: BB
The Female P1 Mouse: bb
The first photo shows the genotype of the F1 generation, they are now heterozygous because they contain different alleles (Bb).
The black B is the dominant trait so they will all be black because they all have that B allele.
The second photo shows the F2 generation and shows that one of the four offspring would have bb which would be white while all others will be black.
Lamin A is a signaling protein embedded in the cell membrane. The locus of the lamin A gene is 1q22. On which human chromosome, arm, and position can the recipe for this protein be found?
Generally , these proteins are located in the nuclear lamina.
What is Lamin A ?
Instructions for creating a number of slightly different proteins known as lamins are provided by the LMNA gene. Most of the cells in the body make lamin A and lamin C, the two main proteins produced by this gene. These proteins are constructed from a pattern of virtually identical protein building units (amino acids). Lamin A is longer than lamin C due to the minute variation in the sequence.
These proteins are specifically found in the nuclear lamina, a layer of intermediate filaments and other proteins that is connected to the nuclear envelope's inner membrane. The nuclear envelope controls how molecules enter and exit the nucleus.
Learn more about nuclear lamina from given link
https://brainly.com/question/14986847
#SPJ13
How does active transport differ from all other forms of transportation?A. It shifts from high to lowB. It maintains homeostasisC. It creates an equilibrium shiftD. It requires energy
The correct answer is the letter D. It requires energy
*Active transport requires energy (ATP) in order to move molecules across the membrane. It needs energy since it moves molecules against a concentration gradient.
Is there any cons to the environment of living rurally ?
Living in rural environments can be difficult due to the distance from the major centers and amenities of urbanization, since the way in which the human pecies has adapted to live in a community is direct linked to technologies that are sometimes nor available in a rural region. The lack of diversity of functions can also become a hindrance, since the rural region have agricultural activities or related to agriculture as the marjor, or in some cases the only, possibility of branch of work.
To the environmental the increase in people living in a rural region is the increased comsumption and exploitation of local natural resources, as well as the urban expansion for housing construction and other infrastructures. The population growth in the region can inevitably leads to climate changes and modifications in the fauna and flora.
What’s the correct answer answer asap for brainlist
Is it C?
The way in which a neuron goes from a negative charge to positive charge is that: C. an action potential opens the gate sodium channels stay behind, and floods the cell with positive ions.
What is a neuron?In Science, a neuron can be defined as a nerve cell that is saddled with the responsibility of transmitting electrical signal (impulses) down an axon across a cellular membrane of the body of a living organism, especially through an action potential.
Generally speaking, the neuron comprises different parts and are of different types which include the following:
Cell bodyMyelinSensory neuronDendritesMotor neuronReceptor neuronAxonAction potentialWhat is an action potential?An action potential simply refers to a sudden, fast change in electrical (voltage) potential with respect to the transmission of an impulse to a receptor, across a cellular membrane such as the following:
A nerve cellA muscle cellIn conclusion, a neuron changes from a negative charge to positive charge because a resting potential neuron has a negative charge while sodium ions have a positive charge.
Read more on neurons here: brainly.com/question/13076783
#SPJ1
A small group of foxes moved to a new environment, starting a new population.They began with a population of 10 foxes, and over the course of 2 years expandinto a population of 40. The population increased rapidly, but now food starts tobecome harder to find, and much of the living space is occupied. The populationstill grows, but at a decreased rate. Which part of the growth phase is thispopulation currently in?A. ExponentialB. LagC. TransitionalD. Plateau
When we are looking at a population we can see that passes through different stages, generally, there is a beginning or lag phase, then comes an accelerated gro also known as exponential or log phase, until the population stabilizes and reaches the ecosystem charge capacity, this is also known as stationary or plateau phase, therefore we can say that the correct answer is option D.
When we are looking at a population we can see that passes through different stages, generally, there is a beginning or lag phase, then comes an accelerated gro also known as exponential or log phase, until the population stabilizes and reaches the ecosystem charge capacity, this is also known as stationary or plateau phase, therefore we can say that the correct answer is option D.
What’s the correct answer answer asap for brainlist
Actin and myosin come in and out of the cell to make it thicker or thinner which changes its length.
The correct option is B.
What is myosin in muscle contraction?Myosin contracts the myofibrils by sliding along myosin within the sarcomere, a process that demands ATP. Numerous molecules, including as calcium, troponin, and tropomyosin, that control muscle contractions and motor behaviors have also been found by researchers.
What are the uses of myosin?All hundred billion cells that make up the human body depend on myosins for growth and tissue creation, respiration, reproduction, communication, reshaping, and motion. Furthermore, myosins allow the quick invasion of bacteria, viruses, and parasites into eukaryotes host cells.
To know more about Myosin visit:
https://brainly.com/question/14988876
#SPJ13
The complete question is-
What is involve in a muscle contraction ?
A-The gap junction between the cells pull them close together which shortens the muscle.
B-Actin and myosin come in and out of the cell to make it thicker or thinner which changes its length.
C-Myofibrils in the muscle shorten ands lengthen to make the muscle D-contract and extend.
D-The extra nuclei trigger nerve to stiffen the muscles and make them shorter.