20. What is true about the esophagus? Check all that apply.* ]
Answer: It is ten inches long, its does connect the nose too the lungs, I dont think about the last one
Explanation:
Biology - Genetics
Click on a word in the puzzle to see the clue
Welcome!
Click a word in the puzzle to get started.
Check puzzle
Answer:
what type of question it is
Which gas is used by humans in the process of cellular respiration?
Answer: Oxygen
Explanation:
During the process of cellular respiration, carbon dioxide is given off as a waste product. This carbon dioxide can be used by photosynthesizing cells to form new carbohydrates. Also in the process of cellular respiration, oxygen gas is required to serve as an acceptor of electrons.
Hope This Helps!
#[tex]AnimePower[/tex]
Answer:
oxygen
Explanation:
we breathe it in during cellular respiration
For recessive trait to be expressed you need to receive the allele from both parents. True or false
Answer:
When a trait is recessive, an individual must have two copies of a recessive allele to express the trait.
_______________________ is an animal's ability to blend into its surroundings.
a
artificial selection
b
evolution
c
natural selection
d
camouflage
[tex] \huge \color{magenta}{ \boxed{ \large \sf \color{blue}{d. \: Camouflage}}}[/tex]
Camouflage is the use of any combination of materials, coloration, or illumination for concealment, either by making animals or objects hard to see, or by disguising them as something else. Examples include the leopard's spotted coat, the battledress of a modern soldier, and the leaf-mimic katydid's wings.Absorbe nutrientes por medio de micro vellosidades que recubren y aumentan la superficie de absorción
Sobre la pregunta:
Cucigrama. Pregunta 1 vertical. Absorbe nutrientes por medio de micro vellosidades que recubren y aumentan la superficie de absorción
Answer:
Intestino delgado
Explanation:
El intestino delgado es el organi mas largo del tubo digestivo, pudiendo medir 7 metros de longitud y 3 cm de diametro. Se caracteriza por estar sumamente plegado sobre si mismo. La primera porcion, llamada duodeno, recibe secresiones de glándulas biliar y pancreática, y las mezcla con enzimas digestivas. Esta mezcla se encarga de degradar la comida y transformarla en sustancias solubles, como amino ácidos.
Es en el intestino delgado donde ocurre la absorción de nutrientes. Las paredes intestinales estas cubiertas por microvellosidades que aumentan la superficie de absorción.
Las microvellosidades son células que componene el epitelio columnar, y que extienden proyecciones hacia el lumen del organo.
What is the difference between a prokaryotic cell and a eukaryotic cell?
Answer:
Size is 0.1- 5.0 um Size is 5-100 um
Nucleus is absent Nucleus is present
Membrane-bound nucleus absent. Membrane-bound Nucleus is present.
Explanation:
here are some
Answer:
One difference is that prokaryotic has a membrane and a nucleus but on the other hand a eukaryotic cell's don't have one
Explanation:
Glad I could help! <3
which is the method of estimating fish in a pond
Explanation:
There is a popular sampling method called capture – recapture or 'Lincoln Index' or 'Pieterson's Method' which is used to estimate the size of an animal or human population.
Underground water is an example of
A) a hidden water source
B) a untapped water
source
C) an unusable water source
D) a high salinity water source
Answer:
i think its a hidden water source
please help me with this
Answer:
prob b
Explanation:
Copper is a mineral commonly used in electronics. Copper ore deposits were created by volcanic activity. Heat and pressure creates copper ore and deposited it in sedimentary rock layers. Copper is considered a resource.
I need the answer no links and no putting random stuff I need the answer fast
Answer:Copper is a mineral commonly used in electronics. Copper ore deposits were created by volcanic activity. Heat and pressure creates copper ore and deposited it in sedimentary rock layers. Copper is considered a resource.
Explanion:
its already the answer
Which of the following best describes what carrying capacity is?
A
The quantity of marine life a limited water resource can sustain.
B
The maximum number of a population that an ecosystem can sustain.
C
The total amount of greenhouse gases a specific ecosystem can sustain.
D
The minimum number of predators a specific geographic area needs to sustain itself.
B. The maximum number of a population that an ecosystem can sustain.
In order for water to collect in earths atmosphere and form clouds it must first undergo what process?
A) condensation
B) convection
C) evaporation
D precipitation
Answer:
The answer is D: Precipitation
PLS HELP! When I let go of a rock it falls down. What happens explain
Answer:
Gravity
Explanation:
Mark as Brainliest
Explain how advancements in engineering and technology over the years have allowed scientist to learn about mars and earths moon.
Telescopes on Earth and in orbit around Earth provide scientists with information about our solar system. That information is used to plan where spacecraft fly and where they “point their cameras.” NASA and other agencies send robotic spacecraft to fly by, orbit, or land on other planets and moons.
blue, light blue, yellow, or red
HURRY
Answer:blue
Explanation:
DNA
Name:
1. What does DNA stand for?
2. Where is DNA found in eukaryotes? In prokaryotes?
3. What is the difference between chromatin and a chromosome? When can each be
seen?
4. How many letters are in the code of DNA?
5. Match the nucleotides
their partner:
Adenine
Cytosine
6. Fill in the complementary strand of the DNA.
CGTAGATG
ATGGCATCTACAAT GGCTICACO
TAAGCTG
7. Tell 3 functions that proteins serve in your body:
8. How are amino acids and proteins related?
9. In your own words, what does DNA do?
CLaney Lee 2019
Answer:
Please find the answers to the following questions below:
Explanation:
1. DNA stands for deoxyribonucleic acid
2. In eukaryotes, DNA is found in the nucleus of the cell while it is found in the cytoplasm of prokaryotic cells.
3. Chromatin is an uncondensed complex of DNA and histone proteins while chromosomes are a condensed form of chromatins. Chromatin can be seen during interphase stage of cell division while chromosomes become visible during prophase stage.
4. Three (3) letters are in the code of DNA. These three letters make up a codon.
5. Adenine - Thymine
Cytosine - Guanine
6. GCATCTACTACCGTAGATGTTACCGAGATTCGAC
7. Proteins are a part of the structural composition of the body
Proteins serve as catalyst for biochemical reactions
Proteins are source of nutrients
8. Amino acids are the monomeric units of proteins. This means that a protein molecule is composed of many amino acid units.
9. DNA is a molecule that stores genetic information in the cell of an organism.
Which of the following is NOT a type of wetland?
a: marsh
b: bog
c: swamp
d: pelagic
Explanation:
i have no clue, but good luck, hopefully you pass the test
Counting a few organisms with in a population and multiplying that number
to estimate the total size of a population is an example of *
Organisms of either extreme characteristic dying out while organisms with the medium characteristic have a higher fitness is identified as?
Answer: Stabilization selection
Explanation:
Natural selection involves the differential survival and growth of organisms which have suitable traits to survive in unfavorable or adverse environment. Such traits are passed on to the next generation. Stabilization selection is a type of natural selection in which the nature selects the non-extreme phenotypic traits. Middle traits are selected and such organisms grow and reproduce. Example can be given that of human babies in which babies with low weight lose more heat and babies with high weight are difficult to be delivered from the pelvis. Therefore, babies with middle weight are expected to survive more than that of low or middle weight.
Name three reasons why the atmosphere is important to life on earth and explain your reasoning.
The atmosphere ensures that all living things can carry out daily processes that are vital to survival, such as breathing. Photosynthesis, for example, could not be possible without an atmosphere, because all of the gasses in our atmosphere stay there due to Earth's gravity.
The atmosphere is vital because it plays a role in the water cycle as well, allowing rain to keep falling and giving life-giving water to organisms that need it.
Life would not be possible without an atmosphere on this planet, along with other vital things, like gravity, sunlight, and water.
What is likely to happen when there is more genetic diversity?
A The slower an individual adapts to its changing environment
B The more likely that some individuals will adapt to the changing environment
C The more offspring an individual will produce
D The more struggles an individual will have surviving
Answer:
b
Explanation:
if there is more genetic diversity then the organism will adapt much better to the environment around it
Answer:
B
Explanation:
ggggggggggggggggggggggg
A person is trying to solve the equation for the energy of a light wave: E=hcλ . She knows the values of h and c. What does the quantity λ represent?
A.
frequency
B.
wave speed
C.
period
D.
wavelength
Answerd
;-)◑__◐
Explanation:
What changes when a cell divides into two daugther cells to make it easier for the cells to exchange materials across the surface of the cell? A. Cell division does not make it easier to transfer materials across the cell surface. B. The new cells move materials faster. C. Each new cell has an increased surface area to volume ratio
The new cell has an increased surface area to volume ratio is a process that makes easier the exchange of materials across the surface of the cell (Option C).
What is cell division?Cell division is the process by which cells generate new daughter cells, which may be due to mitosis or meiosis in higher organisms.
Cell division is able to increase the surface/volume ratio and therefore it facilitates the movement of materials in the resulting cells.
In conclusion, news cell has an increased surface area to volume ratioand it makes easier the exchange of materials (Option C).
Learn more about the cell division here:
https://brainly.com/question/8283140
#SPJ1
Giving brainlist to whoever answers
Answer:
At the bottom of the food chain, the herbage, are the producers. All the other organisms above the producer are consumers. In economics, the food chain is the series of processes by which we grow, sell, and eventually consume food. This article focuses on the term when it refers to organisms that depend on each other as a source of food.
Explanation:
Answer:
heterotroph
Explanation:
what does arrows mean in science
Which of the following is one way that humans can protect biodiversity?
The cell cycle is the life of the cell from the time it is first formed from a dividing parent cell until its own division into two cells
Explanation:
cell cycle is made up of three main parts: interphase, mitosis, and cytokinesis. Most biologists agree that interphase makes up the period of time that a cell would be preparing for cell division. Cells spend the majority of their lives in this stage. During interphase a cell is going to be growing, replicating its genetic material and essentials to carry out cell division, and proofreading the genetic material to ensure replication has occurred correctly. This doesn’t sound like much, but it’s actually the longest part of the cell cycle. Once this is complete, the cell will then go through cell division and, theoretically, split into two new cells (cytokinesis).
How cytokinesis works will depend upon the type of cell that is dividing. Here is an image that summarizes the differences in cytokinesis in plant cells and animal cells, which is the classic example used in many introductory biology courses:
WILL GIVE BRAINLIEST TO WHOEVER ANSWERS FIRST!!!!!
For the compound C₆H₁₂O₆, what type of bond would join the elements and why?
1. covalent because an electron is transferred from a C atom and O atom to a H atom.
2. covalent because electrons are shared between the C, H, and O atoms
3. ionic because an electron is transferred from a C atom and O atom to a H atom.
4. ionic because electrons are shared between the C, H, and O atoms
Answer:
4. Ionic bond because electrons are shared between the C,H and O atoms.
Explanation:
The atomic no. of carbon=6
Electronic configuration=2,4
The atomic no of H=1
E.C=1
The atomic no of O=8
E.C= 2,6
Therefore to attain octate state, they will share electrons
Answer:
4. Ionic bond because electrons are shared between the C,H and O atoms.
Explanation:
Took the test.
what is the name of the fluid found in the gall bladder
Answer:
"Bile" is what that fluid is called