Can someone help this is due tomorrow!!

Can Someone Help This Is Due Tomorrow!!

Answers

Answer 1

Answer:

angle 1 = 100 degrees

angle 2 = 53 degrees

Step-by-step explanation:

diagonals of a rhombus bisect angles so angles 2 and 3 are both 53

angle 1 can be found by adding 37 and 53 and deducting that sum from 180


Related Questions

State the degree and end behavior of the following polynomial f(x)=4x^3+3x^5-x^2 - 2

Answers

Answer:

Degree

Five Degree

End Behavior

When x approaches negative infinity, f(x) approaches the negative infinity as well.

When x approaches positive infinity, f(x) approaches positive infinity.

Step-by-step explanation:

[tex]y = 4 {x}^{3} + 3 {x}^{5} - {x}^{2} - 2[/tex]

A five-degree polynomial function. Rearrange the terms.

[tex]y = 3 {x}^{5} + 4 {x}^{3} - {x}^{2} - 2[/tex]

Because it is an odd-degree function, the graph increases from negative infinity and ends by increasing at positive infinity.

Graph / End Behavior

When x approaches negative infinity, f(x) approaches the negative infinity as well.

When x approaches positive infinity, f(x) approaches positive infinity.

What is the sum of (4s+3)+(2s+1)

Answers

Answer:

Step-by-step explanation:

4s+3+2s+1=6s+4

Pls Help need it asap
which triangle is similar to an equilateral triangle with side lengths of 5.2 cm

a. a right triangle with a perimeter of 15.6 cm
b. a equilateral triangle with a perimeter of 10 feet
c. any triangle with a perimeter of 15.6 cm
d. an isosceles triangle where two of the side are 5.2 cm

Answers

Answer:

B.

Step-by-step explanation:

Two figures are said to be similar if they are the same shape. In more mathematical terms, two figures are similar if their corresponding angles are congruent , and the ratios of the lengths of their corresponding sides are equal.

I don’t know but it seems like a good choice would be 5

If a triangle has 2 sides of 8 and 11 what could the third side be

Answers

Answer:

Any value between 3 and 19 may be the measure of third side.

Step-by-step explanation:

If three sides of a triangle are a, b, and c, possible measures of the sides of a triangle will be.

1). a + b > c

2). b + c > a

3). a + c > b

If a = 8, b = 11,

1). 8 + 11 > c

   c < 19

2). 11 + c > 8

    c > 8 - 11

    c > (-3)

3). 8 + c > 11

    c > 11 - 8

    c > 3

Therefore, by combining the given inequalities,

3 < c < 19

Any value between 3 and 19 may be the measure of third side.

Create an expression with at least 10 terms that would simplify to 5x^ 3 +9x^ 2 -x-6 Try to create something different than what others have created.‍♀️

Answers

Answer:

-x^3 + 2x^3+ 4x^3 + 3x^2 + 7x^2-x^2-9x + 8x-5-1

Step-by-step explanation:

Here, we want to have an expression of at least ten terms which when simplified would give polynomial

We have the expression as

x^3 - 2x^3+ 4x^3 + 3x^2 + 7x^2-x^2+ 2x^2-9x + 8x-5-1

write each fraction or mixed number as a repeating decimal. look up at the pictures!!​

Answers

-0.1231231231 would be the answer

Answer:

-0.123

Step-by-step explanation:

...............

What is 2.75 times 8

Answers

Answer:

the answer is 22

you can put it on a calculator

A number n is no more than 8.

Answers

Answer:

n<8

Step-by-step explanation:

Answer: N < 8

Step-by-step explanation:

Please help me if you can​

Answers

Answer:

1)-9x^5 + 7x^2 + 3    2)  -2x2 • (x - 7)      3)  -23v^2 + 7v + 4    4) is just 7x

Four friends played darts last weekend. The table below shows the number of times that each friend hit the bulls-eye and the total number of darts that each friend threw.

Friend's Name Bulls-eyes Darts Thrown
Austin 9 45
Aaron 8 20
Carey 8 10
Becky 21 35

Who had the greatest ratio of bulls-eyes to darts thrown?
A.
Becky
B.
Aaron
C.
Carey
D.
Austin

Answers

Answer:

Becky

Step-by-step explanation:

Look at it.... i mean 21:35 is the greatest in fraction, decimal and percentage.

Answer:

it's answer is C 0.8

hope it helps you

How many 2/5 s are there in 4?

Answers

Answer:

there are ten (10) 2/5 in 4 .

What is the slope and y-intercept of the following equation: f(x) = 2x - 5

Answers

Answer:

slope- 2

y int- -5

Step-by-step explanation:

D. the area of the interior square in step 2 is equal to c² + ab.

I'll give u brainly if u right​

Answers

Answer:

I think it is C

Step-by-step explanation:

The first two options are correct. The third one is false.

Lane bought 12 pencils for
$0.39 each. What was the total cost of the
pencils before sales tax was added?

Answers

Answer:

$4.68

Step-by-step explanation:

if you do 0.39 x 12 you get 4.68

Answer:

$4.68

Step-by-step explanation:

12x0.39=$4.68

The graph of -1.5x - 3y = -6 is shown on the coordinate grid.

Which ordered pair is in the solution set of -1.5x - 3y ≤ -6?

A. (2,0)
B. (-1, 2)
C. (-2,3)
D. (3,-2)​

Answers

Answer:

C.). (–2,3)

Step-by-step explanation:

This solution is on the graphed line, so it is a solution.

If we substitute values from the other coordinates given, all below the line, the results are false

please help ill give brainliest

Answers

Answer: A.) The domain has fewer values than the range, so there must be a domain value which maps to more that one range value. The relation is not a function.

Which of the following make a right triangle? I really need help thank you

Answers

Answer:

i think its e.. not 100 procent sure but i think it is

Step-by-step explanation:

Answer:

E would be the best answer but not 100%

Step-by-step explanation:

Please help me 123 or 4........

Answers

I want to say A or b

Answer:

It's 2

Step-by-step explanation:

Hope this helps

plz help me with math :)

Answers

Answer:

it would be 3 in the first box and 24 in the other

Step-by-step explanation:

because the ratio is 3 years to 24 montsh most of the time the larger number is on the left and the smaller number is on the right and 3 years is more than 24 months 24 months is only two years

A sandbox is located at (-8, -3). How many UNITS apart on the coordinate plane are the locations of the swing set and the sandbox?

Answers

where is the swing set

PLEASE HELP!! (Look at the picture)

Answers

The answer is
D.13
13+0=13

Tom earns £10 an hour and his wife earns £2 an hour more than Tom. Write a formula for their total earnings T for h hours.

Answers

Answer:

The formula for total earning is T = £22h

Step-by-step explanation:

Given that:

Per hour earning of Tom = £10

Per hour earning of Tom's wife = £10 + £2 = £12

Let,

T represent their total earnings

h be the number of hours

Total earnings = (Tom's per hour earning + His wife's per hour earning) * Number of hours

T = (£10+£12)h

T = £22h

Hence,

The formula for total earning is T = £22h

Can someone please help! Its just Area so it should be pretty simple but I am stuck please help!

Answers

Answer:

3 and 7

Step-by-step explanation:

Please can you help me do this it’s due January 7th today it’s 7th grade math

Answers

Answer:

I think it might be e=5h someone please correct me if I'm wrong

Step-by-step explanation:

Answer:

e = 5h

Step-by-step explanation:

To find the unit rate (money earned per hour), we divide 10 by 2, which gets us 5. That means $5 is earned per house. If h is the number of houses shoveled, and he earns $5 per house, we can write that as 5h. If e is the money earned, we can write this whole thing as e = 5h.

what is the power to 2​

Answers

A power of two is a number of the form 2n where n is an integer, that is, the result of exponentiation with number two as the base and integer n as the exponent.

A power of two is a number of the form 2n where n is an integer, that is, the result of exponentiation with number two as the base and integer n as the exponent.

there are 12 boys and 8 girls in the french club.
1) what is the ratio of boys to girls?
A. 2:5
B. 3:5
C: 2:3
D: 3:2
2) what percent of the members of the french group are girls?
A) 8%
B) 40%
C) 60%
D) 75%

Answers

Answer:

1)

D. 3:2

2)

B. 40%

as, no. of girls=8

total no. of students =12+8=20

now,

percentage of girls=no.of girls/total no. of students ×100%

=8/20×100%

=40%

If EG = 3y - 10 and ET = 2y, find the value of y In parallelogram FGHI.
1
Find Value of y.

Answers

Answer:  y = 10

=====================================

Work Shown:

EI = EG

3y-10 = 2y

3y-10-2y = 0

y-10 = 0

y = 0+10

y = 10

Note how if y = 10, then

EI = 3y-10 = 3*10-10 = 20EG = 2y = 2*10 = 20

Both EI and EG are 20 units long when y = 10. This confirms the answer.

A student performed the following steps to find the solution to the equation
X2 - 2x - 8 = 0. Where did the student go wrong?
Step 1. Factor the polynomial into (x - 4) and (x - 2)
Step 2. X-4 = 0 and x - 2 = 0
Step 3. x = 4 and x = 2
A. in Step 2
B. in Step 1
C. The student did not make any mistakes, the solution is correct
D. in Step 3

Answers

Answer:(b) step 1

Step-by-step explanation:

The wrong step in the student's workings is step 1

How to determine the wrong step?

The equation is given as:

x^2 - 2x - 8 = 0

Expand the equation

x^2 + 2x - 4x - 8 = 0

Factorize the equation

x(x + 2)- 4(x + 2)

Factor out x + 2

(x - 4)(x + 2) = 0

The above means that the factored equation of x^2 - 2x - 8 = 0 is (x - 4)(x + 2) = 0

This means that the step 1 of the student's step is wrong and incorrect

Read more about equations at:

https://brainly.com/question/2972832

#SPJ9

Which value for s will make this equation true?

s(11 - s) = 24​

Answers

There are two solutions; s=3 and s=8

3(11-3)=24
33-9=24
24=24

8(11-8)=24
88-64=24
24=24
I think answer should be 24 please give me brainlest let me know if correct or not okay thanks bye I appreciate it

HELP PLZZZZZ AS SOON AS POSSIBLE GEOMETRY WITH EXPLANATION

Answers

Answer:

34.06°

Step-by-step explanation:

25 is the length of the hypotenuse side and 14 is the length of the opposite side.

Therefore, you will need to use sine to work out the missing angle.

sinx = opp / hyp

sinx = 14 / 25

x = sin ^ -1 (14 / 25)

= 34.06°

Other Questions
A similarity between Woodrow Wilson and Theodore Roosevelt was that bothO believed monopolies were bad for the country.O kept the United States out of foreign wars.O were candidates for two different parties.O were strong champions for the environment Select the sentence that contains a noun clause. BRAINLIST Leah spent three times the amount Damean spent on CDs. Damean spent $33.87. How much did Leah spend on CDs? Many Nubian artifacts were found in tombs of Egyptian pharaohs.Please select the best answer from the choices providedOF 6 is 16% of what number? Choose one of the three themes (social oppression, greed, or good vs. Evil) and explain something you know about it in the real world OR explain where else you have seen the theme (a book, movie, show, etc.) Please help quick Write the inverse of each function. a. f(x)=x103b. g(x)=3/4x+6Please help me I beg you!!!! 25 points!!!! I need to pass!!! A 12,000-gallon pool is being filled at a rate of 40 gallons per minute. At this rate, how many minutes will it take to fill the pool 3/4 full? Abdul bought a loaf of bread for $1.59 and a package of cheese for $2.69. How much did Abdul spend? Explain the role that Benjamin Franklin played during the American Revolution.. After the government ordered the removal of all American Indians from Illinois, a. Black Hawk attacked a militia led by Isaiah Stillman. b. the Sauk fought until they ran out of supplies. c. Black Hawks followers killed three delegates of a peace convention sent under a white flag to Saukenuk. d. Sauk forces attacked U.S. troops as they attempted to retreat across a river. When Muhammad was a boy, he received religious teaching from whom?Group of answer choicesJewsPolytheistsProtestant ChristiansNestorian Christians condemned to be heretics Read this excerpt from the Supreme Court's Hazelwood v. Kuhlmeier dissenting opinion: The state educator's undeniable, and undeniably vital, mandate to [teach] moral and political values is not a general warrant to act as "thought police" stifling discussion of all but state-approved topics. . . . Official censorship of student speech on the ground that it addresses "potentially sensitive topics" is . . . impermissible.4 The reasoning in this opinion is most similar to the reasoning in which other Supreme Court ruling? A. New Jersey v. T.L.O. B. Miranda v. Arizona C. Gideon v. Wainwright D. Tinker v. Des Moines pls help asap!! no trolls 1. Many plants can reproduce asexually. How is this an advantage for the plant? Why can it sometimes be a disadvantagefor the plant? Use details to support your answer. PLS ANSWER ASAP. ILL GIVE BRAINLIEST! Match the system for each of the following bodily organs.1.Nose a. Skeletal System2.Skull b. Circulatory System3.Kidneys c. Urinary System4.Veins d. Respiratory System 2 Which piece of evidence explains WHY the five themes of geography were created (A) In 1984. educators sought to better organize the teaching of geography in kindergarten through 12th grade classrooms. (B) The themes were created by the National Council for Geographic Education and the Association of American Geographers. (C) While these five themes have been since replaced by the National Geography Standards, they still provide an effective organization for the teaching of geography (D) Humans shape the landscape through their interaction with the land; this has both positive and negative effects on the environment Fill in the blank with the appropriate preposition.Paris est _____________ New York.a.) prs deb.) loin dec.) surd.) dans plz help timed MATHHHH 12 pointes Use the restriction enzyme EcoRi to cut DNAVictim DNA :GGAAG ATTCTACATTACTGACGGACGTGACGTGACCTTCTTAA GATGTAATGACTGCCTGCACTGACTNumber of restriction fragments ( pieces of DNA after digestion) :Size of restriction fragments ( count the number of bases on the top strand of each fragment , listed from largest to smallest ) :Suspect 1 DNA :GGAATTAAGCTTATTG AATTCTTATAG AATTCGGGGCCCAAGCTTATG AATTCAATT CCTTAATTCGAATAACTTAA GAATATCTTAA GCCCCGGGTTCGAATACTTAA GTTAANumber of restriction fragments ( pieces of DNA after digestion) :Size of restriction fragments ( count the number of bases on the top strand of each fragment , listed from largest to smallest ) :Suspect 2 DNA :CCATATAG AATTCAAGCTTAAG AATTCGGGGGAACGTTG AATTCAATTAATTGGGGGTATATCTTAA GTTCGAATTCTTAA GCCCCCTTGCAACTTAA GTTAATTAACCCNumber of restriction fragments ( pieces of DNA after digestion) :Size of restriction fragments ( count the number of bases on the top strand of each fragment , listed from largest to smallest ) :PLEASE HELPPP!!!!I WOULD APPRECIATE A LOT :)