In the Krebs Cycle of cellular respiration, pyruvate is used to make
A.oxygen
b. carbon dioxide
C water
D. More glucose

Answers

Answer 1

Answer:

b. carbon dioxide

Explanation:

This metabolic pathway is called the Krebs cycle after the scientist who first discovered it in 1937. The Krebs cycle is further broken down by pyruvic acid, obtained in the glycolysis process. The process proceeds in two stages. The first is the degree of decomposition of the bicarbonate residue.

The Krebs cycle is the main metabolic pathway for the breakdown of organic matter and the production of energy in the form of reduced coenzymes, which will then be incorporated into ATP.


Related Questions

PLEASE HELP
the question is in the pic

Answers

the answer is genetic variation because crossing over leads to changing the traits inherited by the daughter cells

Hemoglobin is:
1) hormone;
2) Enzyme
3) protein;
4) Amino acid


HELPPP PLEASE!!!!

Answers

Answer:

The oxygen- carrying pigment and predominant protein in the RBC.

The process of photosynthesis converts carbon atoms from carbon dioxide into

Answers

Sugar
It for plant to eat

Chemicals and proteins in the cell read the DNA ___________ for building that make cells, tissue and organs.
(A.Instructions
(B.Genes
(C.Recipe
(D. Life manual

Answers

You answer will be B!! Good luckkk!

Genes of DNA can be read by chemicals and proteins for building that can make cells, tissue, and organs. Therefore, option "B" is correct.

What are genes?

Genes are composed of  DNA which is the genetic material. Gene is the functional unit of heredity. Chromosomes are comprised of multiple genes. Genes code for a particular trait. More than one gene can code for a particular trait.

The function of DNA and RNA is controlled by genes. There are more than 3000 genes present. Mutation can occur in genes. Deletion and insertion are some types of mutation genes. Transposomes are called jumping genes. Sickle cell anemia and cystic fibrosis are some examples of gene mutations.

Genes code for the traits such as the color of eyes, height quality of hair, and more.

Learn more about genes, here:

https://brainly.com/question/31121266

#SPJ2

Transcribe the following DNA strand into mRNA and translate that strand into a polypeptide
chain, identifying the codons, anticodons, and amino acid sequence.
DNA: CGATACAATGGACCCGGTATGCGATATCC

Answers

I don’t feel like answering all that but....
C=G G=C T=A A=U
C=G A=T dont know the rest have a gcodocododd dday

It is not the number of different nucleotides, but the ________________ that is important in the ability of DNA to code for all the variability of organisms.

I'll mark brainlest

Answers

Answer:

discupa eu não sei

uma bela noite abençoe

Helppp please
Which federal agency, formed in 1977, now combines regulation and other aspects of the energy industry that were
previously scattered under several other agencies?

O Occupational Safety and Health Administration

O Mine Safety and Health Administration

OU.S. Energy Information Office

o Department of Energy

Answers

D. Department of Energy (DOE)

Explanation: The DOE has been officially in charge of all aspects of energy since 1977; their activities prior to this were assigned to various different government agencies.

Answer:  The correct answer is Department of Energy (DOE)

Explanation:  This answer has been confirmed correct.

What is the definition of cell

Answers

Answer:

Small and sparsely furnished room, especially in a prison or convent.

"the detainees are together in cells with capacity for four or five people"

Cell of a honeycomb.

Explanation:

I hope to help you

The definition of a cell: The basic membrane-bound unit that contains the fundamental molecules of life and of which all living things are composed.

explain how darwin's journey to the galapagos islands contributed to his creation of the theory of evolutions.

Answers

Explanation:

During his visit to the islands, Darwin noted that the unique creatures were similar from island to island, but perfectly adapted to their environments which led him to ponder the origin of the islands' inhabitants.

Among those that struck Darwin so greatly were the finches that are now named in his honor. Darwin would later base some of his thought from the supposing that these finches were all descendents of the same lineage.

In the United States, most racial discrimination comes in the form of ________ discrimination.

A. Direct
B. overt
C. indirect
D. extra​

Answers

Answer:

C, indirect because most people do not admit that they are racist and claim that they didn't do things because they're racist.

Explanation:

In the United States, most racial discrimination comes in the form of indirect discrimination. Therefore, option C is the correct option.

What is indirect discrimination?

Indirect discrimination involves the policies or practices that appear neutral on the surface, but deep down have adverse effects on the people belonging to a particular race.

Indirect discrimination can be seen in various areas, such as employment. During a job vacancy, the job applicant requires to speak a high level of proficient English which appears to be a reasonable requirement for the job, but it can lead to a significant impact on non-native English speakers.

Indirect discrimination can be seen in the education field where schools give admissions to only those students who will qualify for a specific education test which may seem unfair to students belonging to a specific race, and having different educational backgrounds.

Therefore, indirect discrimination is the most common form of discrimination observed in the United States.

Learn more about indirect discrimination here:

https://brainly.com/question/14710203

#SPJ7

Which is an example of active transport?
a
Cells move sugar into their cells with energy
Water moves from where there is more water to where there is less
b
с
Salt moves from a 15% solution to a 2% solution
d
Dye moves from where it is dropped throughout an entire glass of water

Answers

Answer:

с ) Salt moves from a 15% solution to a 2% solution

Explanation:

In active transport, the particles move across a cell membrane from a lower concentration to a higher concentration. Active transport is the energy-requiring process of pumping molecules and ions across membranes "uphill" - against a concentration gradient.Aug 14, 2020

To achieve which of the following goals would rotational grazing be most appropriate? (3 points)
-To maximize livestock populations while minimizing costs
-To preserve vegetation and soil fertility of land
-To involve townspeople in the operations of a nearby farm
-To transform an abandoned city lot into a neighborhood garden

Answers

Answer:

To preserve vegetation and soil fertility of land

Explanation:

.

A person with a low number of white blood cells could have difficulty in fighting infections and A decrease in the number of lymphoid stem cells could result in a decrease in red blood cell.

What is nucleotide?

It is the sub units and buIlding blocks of DNA. It is made up of a five-sided sugar, phosphate group and then a nitrogen base.

These groups make the backbone of the DNA helix. If you look at a DNA helix, they make the side of the ladder or the side portion. They connect to a nitrogen base which make the steps of the ladder.  The type of sugar that is used in a DNA helix is called deoxyribose.

Nitrogen bases are the molecules that make up the steps of the ladders. There are four different nitrogen bases, namely; Guanine, Thymine,Adenine and Cytosine.

Pyrimidines are compounds that make a single 6-sided ring. Examples of pyrimidines are Cytosine and Thymine. Purines on the other hand make 5-sided and 6-sided rings.

Therefore, A person with a low number of white blood cells could have difficulty in fighting infections and A decrease in the number of lymphoid stem cells could result in a decrease in red blood cell.

Learn more about white blood cells on:

https://brainly.com/question/19202269

#SPJ5

Multiple Choice Question:

Metabolizing proteins refers to breaking them down and changing them so that your body can use them. if you eat an egg, the proteins in the egg must be ______________ for use

A. metabolized
B. plagerized
C. synthesized

Answers

Answer:

A, metabolized

Explanation:

^^ Hopefully this helps!

Someone please help!!! Anyone!?!? I'll give A Brainliest

Answers

Answer:

These are Punnet squares. The answer for 1 is 50% The answer for 2 is 100%

The answer for 3 is 100%

Explanation:

I hope this helps!! Have a great day!!!

Cellular respiration is a process in which animal cells use ____ taken in from the atmosphere.

1) carbon dioxide

2) hydrogen

3) oxygen

Answers

Answer:

How does cellular respiration work in animals?

When an animal breathes, it takes in oxygen gas and releases carbon dioxide gas into the atmosphere. This carbon dioxide is a waste product produced by the animal's cells during cellular respiration. Cellular respiration occurs in the individual cells. Digested foods have chemical energy stored in them.

Explanation:

1) carbon dioxide I think hope it helps

the other liquid waste product in cellular respiration is

Answers

Answer: During the process of cellular respiration, carbon dioxide is given off as a waste product. This carbon dioxide can be used by photosynthesizing cells to form new carbohydrates. Also in the process of cellular respiration, oxygen gas is required to serve as an acceptor of electrons.

Explanation: Hope dis helps :)))))  

Answer:

the waste products are carbon dioxide and water

A human liver cell has a different size and shape from a human muscle cell. What is the best explanation for these differences?
A. The cells perform different functions.
OB. One of the cells is used to reproduce more cells while the other is not.
OC. One type of cell develops into the other type of cell.
OD. One of the cells must have come from another species.

Answers

Answer:

A

Explanation:

A human liver cell would have a different size and shape from a human muscle cell because they perform different functions in the body.

The shape a cell would assume and its size depends on the function the cell performs. The functions of the liver in the body of humans differ greatly from the functions of muscles. While the former helps in detoxification, deamination, digestion, etc., the latter helps in support, movement, etc.

The correct option is A.

A human liver cell has a different size and shape from a human muscle cell because the cells perform different functions.

CELL:

Cell is the basic and fundamental unit of life. It is the simplest level of organization of an organism.

Cells contain organelles that help them perform specific functions. Organs are made up of numerous cells.

Similar cells perform similar functions while dissimilar cells perform dissimilar functions.

Therefore, a human liver cell has a different size and shape from a human muscle cell because the cells perform different functions.

Learn more at: https://brainly.com/question/22663686?referrer=searchResults

If two different species belong to the same family, then they also belong to the same _______. *
Kingdom
Class
Order
All of the above are correct

Answers

Answer:

All of the above

Explanation:

The order is Domain, Kingdom, Phylum, Class, Order, Family, Genus, Species.

If it is a smaller one it is always in the ones above it.

1.
2.
3.
4.
What is the Answer?

Answers

Answer:

the answer is 3

Explanation:

Summarize the possible applications of gene knockout GMOs.

Answers

Answer:

This method involves creating a DNA construct containing the desired mutation. For knockout purposes, this typically involves a drug resistance marker in place of the desired knockout gene. ... This method then relies on the cell's own repair mechanisms to recombine the DNA construct into the existing DNA.

Explanation:

This method involves creating a DNA construct containing the desired mutation. For knockout purposes, this typically involves a drug resistance marker in place of the desired knockout gene. ... This method then relies on the cell's own repair mechanisms to recombine the DNA construct into the existing DNA.

A _____
wave can travel in the absence of matter.
a. light
b.sound
c.seismic
d.water

Answers

The answer is b

Because it’s an electromagnetic wave in means it can transport energy through a region of space void of matter. To make it clear you can’t hear sound in space you can only see is light electromagnetic only transfer light.
I hope this helps
Common sense is b fs

what is the complementary dna strand of C-C-T-A-G-C-T

Answers

Answer:

G-G-A-T-C-G-A

Explanation:

The A-T pairs are connected by two hydrogen bonds, while the G-C pairs are connected by three hydrogen bonds.

to which class of macromelules do anitbodies belong to

Pls answer now I am giving 40 points

Answers

Answer

:proteins

The four classes of macromolecules are carbohydrates, proteins, nucleic acids, and lipids. These biomolecules can also be referred to as polymers. In turn, we will discuss how these four classes of macromolecules are synthesized in the cell from their constituent building blocks or monomers.

Explanation:

Antibody Classes. Antibodies can be divided into five classes—IgM, IgG, IgA, IgD, IgE—based on their physiochemical, structural, and immunological properties. IgGs, which make up about 80 percent of all antibodies, have heavy chains that consist of one variable domain and three identical constant domains.

Answer:

Antibodies are proteins. An antibody (Ab), also known as an immunoglobulin (Ig), is a large Y-shape protein produced by plasma cells that is used by the immune system to identify and neutralize foreign objects such as bacteria and viruses

Explanation:

Its easy! If right will give brainlist! Don't overthink..:) Just answer

The virtual image changes with the position of the mirror to the eye when the mirror is..............?
Fill in the blanks

Answers

Answer:

When the mirror is inside the focal point..?

Which refers to the sum of all the forces that act upon an object?

A. net force

B. absolute force

C. balanced force

D. positive force

Answers

Answer:

Net force

Explanation:

Net force is the vector sum of forces acting on a particle or body. The net force is a single force that replaces the effect of the original forces on the particle's motion. It gives the particle the same acceleration as all those actual forces together as described by the Newton's second law of motion.

Answer:

net force

Explanation:

17. Match the major types of cancer with the types of cells they occur in
Adenocarcinomas
a. The lowest layer of the epidermis (skin)
Basal cell carcinoma
b. upper layers of skin, the lining of stomach, lungs,
kidneys
Squamous cell carcinoma
c. melanin-producing cells of the skin
Sarcoma
d. immune cells in the blood (T cells, B cells, and
bone marrow)
Leukemia and lymphoma
e. bones, fat, blood vessels, tendons, ligaments
Multiple myeloma
1. cells that produce fluids (breast, colon)
Melanoma
g. plasma cells (a type of immune cells)​

Answers

LolsbdgsbcgcsnnsjzkmcjMCk

Which of the following statements regarding prokaryotic and eukaryotic cells is true

Answers

Answer:

I would need the statements to answer that. however prokaryotic cells are plant cells and eukaryotic cells are animal cells

Answer:

They are typically smaller than eukaryotic cells. The DNA of a prokaryotic cell is contained in the nucleoid. There are several ways in which prokaryotic cells are different from eukaryotic cells. Firstly, they are generally smaller in size, their organelles are not membrane bound, and they have no nucleus. They, however, share commonalities with eukaryotic cells including the presence of a bilipid plasma membrane, presence of ribosomes and DNA.

Hope this helps, have a great day/night, and stay safe!

BRAINLIEST:
in which month is a hurricane most likely to occur: October or December? explain

Answers

Answer:

October

Explanation:

October is one of the hurricane season months

Which of the following solutions would have solute concentration that is lower than the concentration found inside the cell

Answers

Answer:

hypotonic solution

A hypotonic solution has a lower solute concentration than inside the cell (the prefix hypo is Latin for under or below). The difference in concentration between the compartments causes water to enter the cell.

Thank you and please rate me as brainliest as it will help me to level up

Answer:

A. Hypotonic Solution

HELP!!!!15 POINTS!!!!!!

i think it's f but idk..

Answers

Answer:

F is good

Explanation:

F is a very good choice
Other Questions
You throw a ball straight up from a rooftop. The ball misses the rooftop on its way down and eventually strikes the ground. A mathematical model can be used to describe the relationship for the ball's height above the ground, y after x seconds.Find the quadratic function y=ax^2+bx+c whose graph passes through the given points.1 -> 3393 -> 2714 -> 189 Which BEST describes how the passage draws on the Bible?esA)It alludes to the biblical story of Lazarus, who famously was risen from thedead.It reverses biblical ideas, calling the Bible itself into question as a religioustext.B)9It portrays the religious teachings given to the chimney sweepers to beempty and of little real value.D)It has no connection to the Bible, as a work of fiction from 19th centuryEngland was unlikely to draw from the Bible. If we find that the null hypothesis, Upper H Subscript 0 Baseline colon beta Subscript j Baseline equals 0, cannot be rejected when testing the contribution of an individual regressor variable to the model, we usually should:___________ how many times does 67 117 which word best completes this analogy Solve the puzzle. M + M + M = 30. M + N + N =20. N + Q + Q = 9. N + Q M = ?Solve for M.A. 8B. 9C. 10 how was persia before the influence of europeans? y = x2+x-30what are the factors 1. Approximately what dates did Ramses II rule ancient Egypt?2. During which kingdom period was this?3. What experience did he have that made him a great military leader?4. Why was he also considered a peacemaker?5. What do historians consider to be one of his greatest projects? Aggressive communicators tend to be: 8. The table shows the linear relationship between the balance of a student's savingsaccount and the number of weeks he has been saving.Savings AccountWeek1 38 13Balance5388(dollars)12306323974Based on the table, what was the rate of change of the balance of the student'ssavings account in dollars and cents per week? 1, my father has____ may, so he can buy me something? A, a little B,little C,few D,a few Explain the difference between elastic, inelastic andfixed supply. a 40ft flag pole has a rope tied from the top to the ground. the rope makes a 25 degree angle with the ground, how long is the rope Which statement best describes what happens in a market economy?A. All goods are purchased from private businesses.B. High demand for a product increases the supply.C. Individuals choose what they want to buy.D. Low demand for a product increases the price. Can a Brain cellFat cellMuscle cellRed blood cellLiver cellConvert one type of fuel molecule to another Find the discriminant and state the number and type of solutions.-3.02 - 6x + 5 = 8 02.10 Kick It Up a Notch Assignment Original paragraph Jellyfish population been growing over the past years out of control.These jellyfish blooms have also caused serious problems for power stations.According to the human impact of major jellyfish blooms,The moon coastal areas around the world have struggled with similar jellyfish blooms,as these populations explosions are known things are worse in the fishing business,where blooms have wiped out billions of dollars in earnings over the past few decades.Jellyfish can undoubtedly cause ecological and economic problems for humans. Mass outbreaks of jellyfish can overrun fish farms, block cooling pipes of power stations, burst fishing nets and damage tourist businesses. Their stings can also cause a severe allergic reaction known as anaphylaxis and even kill people.The jellyfish found its way into the Black Sea and the jellyfish eats the mnemiopsis jellyfish and that cuts down the population.This allows more fish eggs and the fishermen to have jobs again and the jellyfish are creating a more balanced ecosystem.Although this has saved the Black Sea, Scientists worry about using the jellyfish in other seas.We are thinking about using the jellyfish in other seas, but we are concerned.There is a real fear of negative ecological consequences from introducing new species Revised Paragraph Fishermen in the Black Sea have jobs again thanks to the jellyfish.The jellyfish eats the mnemiopsis jellyfish which has cut down the population, allowing the survival or more fish eggs.Scientists have had the idea of using these jellyfish in other seas affected by the mnemiopsis jellyfish,but theyre unsure how these jellyfish with ecosystem in these other seas.Review paragraph I need a review paragraph please somebody help me with a I will do whatever describe and explain how the rate of photosynthesis is affected by light intensity Complete the pattern. 1, 2, 4, 8, 16, __, __, __