16.Which type of sediments would be most common where a river meets an ocean?
A. biogenous
B. cosmogenous
C. hydrogenous
D. lithogenous

Answers

Answer 1
C sounds most likely because HYDROgenous and Hydro means water
Answer 2
Answer has to be C . HYDROgenous

Related Questions

What causes the "plastic" nature of
the asthenosphere?
A. it is mostly water
B. it only found under the ocean
C. constant earthquake activity
D. heat from below

Answers

The heat from below causes the "plastic" nature of the asthenosphere. The correct option is D.

What is asthenosphere?

The asthenosphere is the upper mantle's mechanically sluggish and ductile region.

It is located beneath the lithosphere, somewhere around 80 and 200 kilometers underneath the surface, and can extend up to 700 kilometers. However, the asthenosphere's lower boundary is not well defined.

Semi-plastic rock makes up the Asthenosphere. Because of Lithosphere has a lower density, it resides on top of the Asthenosphere, much like an iceberg or a block of wood does on water.

The lower mantle beneath the Asthenosphere is stiffer and less plastic. The outer core is located beneath the Mantle.

The "plastic" essence of the asthenosphere is caused by heat from below.

Thus, the correct option is D.

For more details regarding asthenosphere, visit:

https://brainly.com/question/7152935

#SPJ2

present and debate current social and ethical implications of biotechnology and genetic engineering

Answers

Answer:

These concerns range from ethical issues to lack of knowledge on the effects genetic engineering may have. One major concern is that once an altered gene is placed in an organism, the process cannot be reversed. Public reaction to the use of rDNA in genetic engineering has been mixed.

I don't know if that's right

Which of the following is true of ecological succession? A-pioneer organisms move into new communities first. B-primary productivity decreases as succession proceeds. C-secondary succession takes place within new communities with no previous soil. D-all of the above.

Answers

Answer:  Pioneer organisms move into new communities first.

Explanation:

In humans, Brown eyes (B) is dominant to blue eyes (b). A hom ozygous brown-eyed man marries a blue-eyed woman. What are the genotypic and phenotypic ratios of their children’s eye color?

Genotype: __________________________________
Phenotype: __________________________________

Answers

Answer:

The ratio is 50%

Explanation:

Genotype:

Bb

Phenotype: Brown eyes

Please correct me if I am wrong :)

Answer:

3 of the boxes have Capital b and only 1 box have lower case b

Explanation:

Which process is not caused by the movement of Earth's plates?
A ocean island formation
B chemical weathering
C mountain building
D volcanic eruption​

Answers

B: chemical weathering

1. When a consumer eats a producer, 10 percent of the producer's energy is passed on to the consumer trophic level. What happens to the other 90 percent?

A. It is added back to the soil by decomposers.


B. It is used by the producer to pass on to the next trophic level.

C. It is used for cell processes or released as heat.

D. It is consumed and used by the consumer.

2. Why is there less biomass at the top of the energy pyramid?
A. Secondary and tertiary consumers have to consume a lot more food to support themselves, so there are fewer of them.

B. Secondary and tertiary consumers live longer, so there are fewer of them because they reproduce more slowly.

C. Secondary and tertiary consumers are larger, so there are fewer of them.

D. Secondary and tertiary consumers have bigger ranges, so there are fewer of them because they each need a lot of space.

3. Using the ten percent rule, determine how many kilocalories of energy the tertiary consumer tuna will receive.

Algae: 135,000 Kcal
Shrimp: _
Lantern Fish: _
Tuna: _

A. 135 Kcal

B. 1,350 Kcal

C. 135,000 Kcal

D. 13,500 Kcal

4. Read the following statements about various species of plants and animals. Which one would be classified as an invasive species?

A. Kudzu, a plant from Japan, was introduced as a foliage crop and to reduce soil erosion. It grows up to a foot per day, smothering low-growing plants and killing trees.

B. Dandelions are plants from Eurasia. They are often considered weeds by homeowners and killed off by using herbicide. They can be consumed in salads or as tea and are the first food resource for bees in the spring.

C. Honey bees are from Europe and can sting people. They are often farmed in America for their ability to pollinate and provide honey.

D. Loosestrife beetles, native to Eurasia, have been released in various American states to combat the invasive plant, purple loosestrife.

5. Using the following formula to find the efficiency of energy transfer between the harbor seal (2,500 Kcal) and a polar bear (375 Kcal)
(Energy level transferred to next level) / (Total energy input) × 100

A. 15%

B. 20%

C. 10%

D. 12%

Thank you so much if you answer this:) I'm working on it and will probably figure them out but a little help would be appreciated. <3​

Answers

Answer: I just to happen to be working on this quiz right now. I got 5/5 on it, so I hope this helps :D

~Ten Percent Rule Quick Check~

1. B) It is used for cell processes...

2. D) Secondary and tertiary consumers have to consume a lot more..

3. D) 135 Kcal

4. C) Kudzu, a plant from Japan...

5. A) 15%

^This is confirmed valid as of January 17th, 2022^

Consumers are the organisms that depend on others for food and energy for the metabolic process while the producers produce their food at the trophic levels.

The correct options are 1. C, 2. A, 3. A, 4. A and 5. A.

The trophic levels can be explained as:

1. In the trophic levels the energy gets decreased as it passes from one level to another because it is used in the cellular process it is released in the form of heat.

2. Secondary and tertiary consumers have to feed a lot and hence, they are fewer in number compared to the producers. They maintain the population and balance out the producer and consumer ratio.

3. According to the 10 % rule of energy transfer, the Tuna will receive 135 Kcal of energy because the energy decrease by 10% as one moves from the lower trophic to the upper levels.

4. The species that are non-native to a place or region are called invasive species hence, the Kudzu plant is the invasive species as it is introduced from Japan.

5. Given,

Energy of Seal = 2,500 Kcal

The energy of polar bear = 375 Kcal

The 10% of 2500 will be 250 and the 5 % 125 thus, 15% is the efficiency.

Therefore, the correct options are 1. C, 2. A, 3. A, 4. A and 5. A.

Learn more about energy transfer and trophic level here:

https://brainly.com/question/20586850

Will give brainliest

Jennifer is trying to determine the blood type of her parents for biology class. She knows that her blood type is B.

After asking her mother, she finds out that her mother's blood type is A. However, her father cannot remember his blood type.

Which of the following blood types could her father have?

I. A
II. B
III. AB
IV. O
A.
I or III only
B.
I, II, or IV only
C.
I, II, III, or IV
D.
II or III only

Answers

Answer:

C. I, II, III, or IV

Explanation:

I got it right on study island

Jennifer is trying to determine the blood type of her parents for biology class. She knows that her blood type is B. In such case her father may have blood type A,B, AB, and O. Thus, option C is correct.

What is blood group?

The three alleles that are A, B, and O are mainly responsible for controlling the major blood groups such as A, B, and AB, respectively. Due to this fact that humans are considered as diploid, each genotype could only include the maximum of two of them. Just to put it another way, just only two of these alleles could coexist in the single cell of the human at  given time.

IA, IB, and I are considered as the three distinct alleles that could determine the person's blood type. I has been considered as the most common. These three alleles could be referred to as the A (for IA), B (for IB), and O for the sake of simplicity (for i). Because we receive one blood type allele from our biological mother and one from our biological father, each of us has two ABO blood type alleles.

Therefore, option C is correct.

Learn more about blood on:

https://brainly.com/question/14781793

#SPJ3

In an experiment, there are two groups. Which group is not changed in any way?

Answers

Answer:

the control

Explanation:

I NEED HELP ITS DUE RIGHT NOW PLEASE ( biology question !!! )

Answers

Answer:

A is the correct answer.

Petrified Trees are an example of what kind of fossil?
A. Carbonized
B. Preserved
C. Per-mineralized
D. Rock

Answers

Answer:

C- Per-mineralized

Explanation:

Hope this helped good luck studying, have a good day/night! <3

Please Help!
The middle of an mRNA molecule contains the nucleotide sequence shown here. Much more of the mRNA is translated. Assume that the sequence is translated from left to right.

AUUUAACUGUUCUGUCUAGAG


1.

Construct an Explanation Based only on the information provided, why could the mRNA section be translated into three different sets of amino acids, instead of just one set?

2.

Use Models Use the genetic code to translate the sequence into each of the three possible sets of amino acids.

3.

Draw Conclusions Which of the three sets of amino acids is the most likely to be included in the polypeptide? Explain your reasoning.

Answers

Answer:

TAA ATT GAC AAG ACA GAT CTC

1. The more bases there are per codon the more information you can code for. There are only 22 different amino acids, in consequence we need minimum 3 bases per codon.

2. codon

three nucleotides—called a triplet or codon—codes for one particular amino acid in the protein. The nucleotide sequence in the DNA is first transcribed into a molecule of messenger RNA (ribonucleic acid).

3. Known as alpha helices and beta sheets, these stable folding patterns make up the secondary structure of a protein. Most proteins contain multiple helices and sheets, in addition to other less common patterns (Figure 2). The ensemble of formations and folds in a single linear chain of amino acids — sometimes called a polypeptide — constitutes the tertiary structure of a protein. Finally, the quaternary structure of a protein refers to those macromolecules with multiple polypeptide chains or subunits.

OKAY I THINK EVERYTHING IS RIGHT BUT SORRY IF WRONG ;)

The mRNA sequence could be translated into three different sets of amino acids because of the degeneracy of the genetic code.
Using the genetic code to translate the mRNA sequence, we get the following three possible sets of amino acids:Set 1: isoleucine-phenylalanine-leucine-serine-valine-arginineSet 2: isoleucine-asparagine-valine-leucine-serine-arginineSet 3: isoleucine-asparagine-leucine-serine-valine-arginine

3. It is not possible to determine which of the three sets of amino acids is the most likely to be included in the polypeptide based solely on the information provided.

What is a nucleotide sequence?

A nucleotide sequence is the order of nucleotides (the building blocks of nucleic acids) in a DNA or RNA molecule.

Nucleotides are composed of a sugar, a phosphate group, and a nitrogenous base, which can be adenine (A), cytosine (C), guanine (G), thymine (T) (in DNA) or uracil (U) (in RNA). The specific order of these nucleotides in a DNA or RNA molecule determines the genetic information that the molecule carries.

Learn more about nucleotide sequence, here:

https://brainly.com/question/30299889

#SPJ6

Adaptation is a change in a species over many generations. What is the cause of this change?

A.
The environment changes over time.

B.
Species pick traits they like.

C.
Over time, species become more like their ancestors.

Answers

Answer: is C

Explanation:

Answer:  The correct answer is A. The environment changes over time.

Explanation:  Adaptations allow species to be able to survive in changing locations, like Darwin observing changes in bird beaks based on their available food sources.

What is the complementary sequence of TACGTATGAAAC?

Answers

Answer:

ATGCATACTTTG

Explanation:

The letters are alternate of each other.

T-A

A-T

G-C

C-G

ATGCATACTTTG is the compementary sequence

can someone pleasee answer thiiisss pleasee

Answers

Answer:

Hi how are you doing today Jasmine

what are cork tissues? how are they formed?

Answers

Answer:

Cork is a protective tissue that separates the living cells of the plant from the outside environment. The formation of cork in the periderm is the result of the activity of a secondary meristem, the cork cambium, or phellogen.

Explanation:

Which of the following statements best describes the state of DNA inside of a prokaryotic cell?

a
46 X-shaped chromosomes inside the cytoplasm
b
46 X-shaped chromosomes inside the nucleus
c
a single circular chromosome in the cytoplasm
d
a single circular chromosome in the nucleus

Answers

Answer:

C.

Explanation:

It's a single strand of circular DNA found in the central area of the cell, which is not surrounded by a nuclear membrane.

Which of the following is an example of a negative tropism?

A. stems and leaves growing upward
B. leaves curling when touched
C. roots growing downward
D. leaves turning toward the light

Please help ASAP

Answers

Answer: B because leaves curling when touched is a negative tropism

Explanation:

Which statement describes an interaction between the biosphere and the atmosphere that is related to
photosynthesis?
O During photosynthesis, plant roots take in water from soil.
O During photosynthesis, plants take in carbon dioxide from the air.
O Through photosynthesis, energy stored in plants is released into the air.
O Through photosynthesis, energy stored in plants is transferred to humans who eat them.

Answers

Answer:During photosynthesis, plant roots take in water from soil.

Explanation:

Answer:

During photosynthesis, plants take in carbon dioxide from the air.

Explanation:

The second answer is correct because it includes an interaction between the atmosphere and the biosphere.

What is the relationship between a protein, the cell, and DNA?
A. DNA is produced by a protein which is produced in the cell
B. Protein is composed of DNA which is produced in the cell
C. A cell is composed of DNA and protein
D. DNA controls the production of protein in the cell

Answers

Answer:

B. Protein is composed of DNA which is produced in the cell

Explanation:

Answer:

B. Protein is composed of DNA which is produced in the cell

Explanation:

The option (B) is the relationship between a protein, the cell, and DNA.

THe video uses an example of cheerleaders at a sporting event,
building a pyramid as a definition of isostatic adjustment
A: True
B: False

Answers

I would agree with False because you can’t define adjustment like that

what is alleles and how are they related to genes ?​

Answers

Answer:

An allele is a variant form of a gene . Some genes have a variety of different forms , which are located at the same position , or genetic locus , on a chromosome . Humans are called diploid organisms because they have two alleles at each genetic locus , with one allele inherited from each parent.

Explanation:

Believe it

What makes each of the mechanical layers different?

A. Whether the layer is rock or metal

B. Whether the layer is solid, liquid, or in between

C. Whether the layer is dense or thick

Answers

.......The answer is B

Generation Number of purple flowers Number of white flowers 1 705 224 2 792 189 3 834 102 4 889 84 5 938 21 6 952 0 Ralph wanted to breed a pea plant that produced only purple flowers. He continued to breed purple-flower producing pea plants together over six generations. The results of Ralph's artificial selection are shown above. What did artificial selection do to the population of pea plants? A. caused a new species of pea plant to form B. increased its genetic diversity C. decreased its genetic diversity D. caused a pea plant to exhibit a new characteristic

Answers

Answer:

C

Explanation:

The correct answer would be that artificial selection decreased the genetic diversity of the pea plant.

Genetic diversity is a measure of the number of traits or characters.

Initially, the breeding produced a considerable population of both white and purple flower offspring. But as time goes on, the population of purple flower offspring increased while that of the white flower decreased till it eventually reached zero.

Thus, artificial breeding reduced the number of traits in the population of the offspring from two to one - a case of reduction in genetic diversity.

The correct option is C.

Answer:

c

Explanation:

Use the following questions to write your conclusion to your lab report.

What did you learn from doing this lab? (Did the volcano have an effect on the ability of a predator to catch their prey? What might this mean for future generations? Include numbers from your data tables to show these changes.)



How could you make the lab better?

Answers

Answer:

WHat??

Explanation:

Which trait is controlled by three or more genes?

A:seed color in pea plants
B:feather color in roosters
C:fur color in palomino horses
D:hair color in humans

Answers

Answer: D:Hair color in humans

Explanation:

I think D but I could be wrong

Replicate the following DNA sequence: CCC

Answers

Answer:

GGG

Explanation:

use AT GC

opposite of C is G and since there's 3 c's you replicate and get 3 g's

True Or False urgebt

Answers

Answer:

The answer is true

Explanation:

true

A doctor is diagnosing a patient with gigantism. Which of the following sources would be the least helpful in making
that diagnosis?
O growth chart
medical book
patient's family history
O patient's diet

Answers

Answer:

The answer is D, patient's diet.

Explanation:

As per the observation, it is clear that the correct answer is a medical book as it will have the medical history of the patient.

Gigantism is an extreme situation this is almost usually due to an adenoma, a tumor of the pituitary gland. Gigantism happens in sufferers who had immoderate boom hormones in childhood. The pituitary tumor cells secrete an excessive amount of boom hormone (GH), which main to many adjustments withinside the body.

How is gigantism diagnosed?

If gigantism is suspected, the prognosis is commonly shown via way of means of taking blood assessments to degree the stages of boom hormone and insulin-like boom component 1 (IGF1) circulating withinside the blood. IGF1 is launched into the blood often via way of means of the liver in reaction to boom hormone.

Thus it is clear that medical books will have a medical history of patetint wityh gigantism.

To learn more about gigantism refer to the link :

https://brainly.com/question/7035609

Can anyone give me two mineral feed ingredients for poultry birds ?! 20 points for it

Answers

Answer: aragonite oyster shell crab meal

Explanation: aragonite is for calcium and oyster shell also has calcium. Crab meal provides small amounts of protein and minerals

Scientists are studying the bacteria living in termites because they want to
genetically engineer......

Bacteria that can resist pests on crops.

Bacteria that can create ethanol from left over plant material.

Bacteria that create a vaccine.

Bacteria that create antibiotics.

Answers

Answer:

B. this is why Those bacteria may contain genes that will help convert plant material to ethanol. so B. and if it's wrong then sorry but if it's right u welcome ;)

Bacteria that can resist pests on crops.

The following information should be considered:

In the case when the scientist should studying the bacteria that lived the termites so it should resisted the pest on the crops. These kind of bacterias should comprise of genes that would helps transform plant material to ethanol.

Learn more: https://brainly.com/question/5303391?referrer=searchResults

Other Questions
I really need answer or Imma flunk uh oh the esophagus connects the Help plsThe first few partial sums of a series consisting of onlypositive terms are shown. I need help please 4d + 8 (LC)What percentage of court cases in the United States are heard by federal courts? 5 percent 15 percent 25 percent 50 percent Salvador sold hats during the weekend sporting event. On Saturday, Salvador sold ( * of the total number of hats. On Sunday, he sold & ( of the total number of hats. What fraction of the total number of hats was left over? You need a dog to work with the police.What traits would you want the dog to have? Why? How do some people feel the U.S. can promote democracy in Cuba? What are the 5 questions to ask when revising your outline? This chart describes how a bill becomes a law in Arizona.Which statement best explains the chart?A bill may begin in either the House or the Senate.A bill amended in the Senate goes to the governor.A vetoed bill must first go to the Senate, then to the House.A bill must begin in the House of Representatives Question 5Evaluate:Five cubed.Write the numerical answer only. Hamby Inc. has sales of $2,076,000 for the first quarter of 2020. In making the sales, the company incurred the following costs and expenses. Variable Fixed Cost of goods sold $779,000 $614,000 Selling expenses 96,700 63,500 Administrative expenses 81,600 70,800Required:Prepare a CVP income statement for the quarter ended March 31, 2017. hey, i wanna ask you an interesting question if you know the answer give it in comments okay !!the question is :what is the HCF / GCD of 0 (zero) and 5let me know the answer .. why is forcing the cell to increase the rate of the cell cycle lead to error in DNA replication Solve the problem-4p - 4p What percentage of carbohydrates should a persons diet have?30%50%70%90% lets try this again can someone help What is the simplest form of 4/3 (will give brainliest to the person who answered my question correctly!)Question:Are Atoms measured on the atomic scale. HELP MUSIC ASAPI will give a brainliest to the correct answer