ASAP!!! Select all that apply.


A balance must exist between substances entering and exiting cells. Most animals take in substances by _____.


breathing

sweating

eating

urinating

Answers

Answer 1

Answer:the correct answer is eating or breathing

Explanation: because most animals eat to get the substances they need and breathing is also a big one if they don't breath they will die like the every being on this planet needs oxygen to live if we do not have those we will drop over dead.


Related Questions

Which of the following statements is true?

Opportunistic bacteria only cause infection under certain conditions.
Most bacterial infections are caused by bacteria already in the body.
Leukocytes are the first line of defense against pathogenic microorganisms.
The flu and the common cold are treated with rest, fluids, and antibiotics.

Answers

Answer:

1 one is true

2 is true

3 is falase

Answer:

a

Explanation:

In a chemical analysis of a sample of animal tissue, which element would most likely be found in the smallest quantity?

Answers

Answer:

Iodine

Explanation:

Iodine is needed by animals because the body's metabolic rate is controlled by the action of an iodine hormone, called thyroxine, which is secreted by the thyroid gland in the neck.

If the animal fails to supply enough iodine through food to be able to make a normal amount of this compound, then the thyroid gland enlarges or expands trying to create enough, resulting in a common type of goiter.

What do the enzymes in excision repair systems do?

A destroy cancer cells
B cut off telomere sections
C replace dna damaged by chemicals
D replace rna primers with dna

Answers

B would be the answer I think

Compare asexual and sexual reproduction. Place each statement into the correct box.

Answers

Answer:

Explanation:

asexual doesn't require a mate or another thing to reproduce. sexual requires another thing to reproduce like a male and female

Answer:

During asexual reproduction, the organism that is reproducing spits in two.

A sea anemone reproduces asexually.

During sexual reproduction, there are two organisms(male and female) that are part of the reproductive process.

Humans reproduce sexually.

Explanation:

Make a list of different weather patterns

Answers

Weather comes in all different forms, and it changes by the day. It could be sunny one day and raining the next. It could even be sunny, rainy, cloudy, and stormy in one day.

Common Types of Weather Elements

The weather has a lot of different factors. When someone asks how the weather is today, you need to think about temperature, humidity, precipitation, wind, cloudiness, and atmospheric pressure. All these different parts work together to create the weather you see when you walk out the door.

WILL GIVE 20 POINTS AND BRAINLIEST PLS HURRY

In order for a scientific explanation to be valid, it MUST be based on evidence from _[blank]_.
a. hypotheses of scientific experiments
b. a credible scientific journal
c. the latest scientific research
d. observations of the scientific investigation

Answers

Answer:

a. hypotheses of scientific experiments

Explanation:

Phenotypes are the
observable characteristics of an individual (ex:
curly hair)

or

genetic representation of a an individual (ex: Hh)

Answers

Answer:

phenotype are the observable characteristics of an individual (ex:curly hair)

Vaporization is the reserve of what?

Answers

Answer:

Vaporization is the reserve water

Explanation:

Which of the following statements regarding prokaryotic and eukaryotic cells is true

Answers

Answer:

I would need the statements to answer that. however prokaryotic cells are plant cells and eukaryotic cells are animal cells

Answer:

They are typically smaller than eukaryotic cells. The DNA of a prokaryotic cell is contained in the nucleoid. There are several ways in which prokaryotic cells are different from eukaryotic cells. Firstly, they are generally smaller in size, their organelles are not membrane bound, and they have no nucleus. They, however, share commonalities with eukaryotic cells including the presence of a bilipid plasma membrane, presence of ribosomes and DNA.

Hope this helps, have a great day/night, and stay safe!

Which of the following does not contribute to erosion?
O Lava
Olce
O Wind
O Water

Answers

Lava..

got it right on edge 2020

Describe some of the properties of water and explain how the structure of water is responsible for these properties.

Answers

Answer:

The main properties of water are its polarity, cohesion, adhesion, surface tension, high specific heat, and evaporative cooling. A water molecule is slightly charged on both ends. This is because oxygen is more electronegative than hydrogen. ... The stream of water bends due to the polarity of water molecules.

Explanation:

What Bacteria is put in yougurt ?

Answers

two species of bacteria called Lactobacillus bulgaricus and Streptococcus thermophilus.

Answer:

food bateria

Explanation:

Why are packed juices contaminated with yeast

Answers

Answer:

It is because yeast is responsible to fix the carbon dioxide.

Because of o2
Is responsible

when benedicts solution is added to a sucrose solution and put into a boiling water-bath , no change in color is observed

state why no color change is observed

Answers

Answer:

b

Explanation:

Which of the following problems are a result of acid deposition?


Nitrogen depletion in soils
Decreased pH levels in lakes and rivers
Corrosion of monuments and metal structures
I and III
II and III
I only
II only

Answers

Answer:

II and III

Explanation:

Acid will decrease pH levels in water and corrode monuments like marble statues and rust metals, but has no correlation to nitrogen depletion.

Hope this helped!

Peoples choices can sometimes have negative effects on their own health as well as the health of your well-being of others describe to these choices explain how they can impact the individual and others

Answers

Answer

a good environment could mean better people better love and kindness bad environment could mean problems in your future and/or daily life this can affect everybody and anybody

Explanation:

Which of the following processes begins when a star enters the main sequence?
a


Nuclear fission
b


Nuclear fusion
c


Condensation of a nebula
d


Appearance of a supernova

Answers

Answer:

i believe it is B: Nuclear Fusion

Explanation:

Answer:

C. Nuclear Fusion

Explanation:

I am 1000000000% sure this is correctamundo, stay cool, and have a great day!

Transcribe the following DNA strand into mRNA and translate that strand into a polypeptide
chain, identifying the codons, anticodons, and amino acid sequence.
DNA: CGATACAATGGACCCGGTATGCGATATCC

Answers

I don’t feel like answering all that but....
C=G G=C T=A A=U
C=G A=T dont know the rest have a gcodocododd dday

Explain how diffusion and osmosis are related to the symptoms of cystic fibrosis

Answers

Answer:

Answer D

Explanation:

just took the test.

Bacteria cannot survive in deep ocean areas where no light is present. true or false

Answers

Answer:

false on edge

Explanation:

Read each of the answers below carefully: Which statement best describes the cell cycle? a. Cells grow and develop during interphase. Cells reproduce during the mitotic phase. b. Cells grow and develop during the mitotic phase. Cells reproduce during interphase. c. The nucleus of the cell divides during interphase. The cytoplasm of a cell divides during the mitotic phase. d. The nucleus of the cell divides during the mitotic phase. The cytoplasm of a cell divides during interphase.

Answers

Answer:

a. Cells grow and develop during interphase. Cells reproduce during the mitotic phase.

Explanation:

Cell cycle refers to the series of processes that leads to the growth/development and division of a cell. The cell cycle uses MITOSIS for cell growth. Mitosis comprises of two distinct stages namely: INTERPHASE AND MITOTIC PHASE. The interphase is referred to as the resting phase of the cell in which the cell grows and develops.

On the other hand, MITOTIC PHASE is the stage where the actual division of the nucleus (karyokinesis) and cytoplasm (cytokinesis) generally called CELL DIVISION occurs. Therefore, the cell reproduces i.e. one cell forming two, in the mitotic phase.

The statement best describes the cell cycle - a. Cells grow and develop during interphase. Cells reproduce during the mitotic phase.

Cell cyclethe series of processes that result in the growth and development and division of a cell.The cell cycle uses MITOSIS for cell growth. there are two distinct stages namely:INTERPHASE is referred to as the resting phase of the cell in which the cell grows and develops.MITOTIC PHASEis the stage where the actual division of the nucleus (karyokinesis)and division of cytoplasm (cytokinesis)

Thus, The statement best describes the cell cycle - a. Cells grow and develop during interphase. Cells reproduce during the mitotic phase.

Learn more:

https://brainly.com/question/796780

What is the difference between prokaryotic and eukaryotic cells?

Answers

The main difference that separates prokariotic organisms from eukaryotic organisms is the organisation of the genetic material. Prokaryotes have a single chromosome that isn't separated by a membrane and it's called nucleoid. Eukaryotes have multiple chromosomes that are inclosed in a nuclear envelope(nucleus).

The only organelles present in prokaryotic cells are the ribosomes(70S) which differ from the eukaryotic ribosomes(80S). Eukaryotic cells have membrane bound organelles like the mitochondrion or Golgi aparatus.

What would happen to a species if it was quickly moved from a familiar environment to an extremely different environment.

Answers

Depending on how good that species is at adapting to new environments that species of animals could adapt overtime, or die

Use chromosomes 11 and 17 to answer the following questions. Chromosome Map Chromosome 17 is made of over million base pairs. Approximately how many genes are found on chromosome 17? List the genetic disorders found on chromosome 17. What do you know about any of those disorders?

Answers

Answer:

Hello!

Chromosome 17 is made of over 80 million base pairs.

Approximately how many genes are found on chromosome 17? 1600

Explanation:

Chromosome 17 is made up of more than 80 million base pairs. Approximately, 1600 genes are found on chromosome 17. The genetic disorders found on chromosome 17 are as follows:

Breast cancer.Neurofibromatosis.DNA damage response in individuals.Scoliosis.Congenital heart anomalies.

What are Chromosomes?

Chromosomes may be defined as thin, thread-like structures that may appear in the nucleus of the cell during the process of cell division. These structures may contain DNA, RNA, histones, and non-histone proteins. Chromosomes may be discovered by E. Strasburger in 1875.

Human chromosome 17 is implicated in a wide range of human genetic diseases. It is home to genes involved in many genetic disorders that may affect the physiology of an individual. They are very severe to organisms.

Mosaic trisomy 17 is a rare chromosomal anomaly syndrome, with a highly variable clinical presentation, mostly characterized by growth delay, intellectual disability, body asymmetry with leg length differentiation, scoliosis, and congenital heart anomalies.

To learn more about Genes and chromosomes, refer to the link:

https://brainly.com/question/29393001

#SPJ2

List four characteristics of plants.

Answers

Answer:

1. Plants produce their own food.

2. Plant cells have a cell wall.

3. Plants reproduce with spores and sex cells.

4. Plants have a vascular system.

Explanation:

Here is four characteristics plants have.

Plants produce food through photosynthesis so I included that here.

Hope this is correct, have a great day.

The air in the thermosphere is composed of atoms of _____ that are very far apart from each other.

Answers

Answer:

Explanation:

In the upper thermosphere, atomic oxygen (O), atomic nitrogen (N), and helium (He) are the main components of air.

Energetic ultraviolet and X-ray photons from the Sun also break apart molecules in the thermosphere. In the upper thermosphere, atomic oxygen (O), atomic nitrogen (N), and helium (He) are the main components of air there ya go son

A 100 kg box is initially at rest on a level surface. One 10 N force acts on the box , directed toward the right. A second 10 N force acts simultaneously on the box , directed toward the left , as shown.

Answers

The box would stay at rest where it lies since the same amount of force is pulling it in opposite directions :)

Since 10 N forces are acting from both sides, these are balanced forces and the box will not move because balanced forces are acting on it. So the correct option is D.

What are balanced forces?

Forces that are equal in magnitude and opposing in direction are said to be balanced forces. Equilibrium is seen as a condition of balanced forces. There is no shift in direction when the forces are in balance.

Balanced combined forces have always been equal to zero. These are vectors for merging. Balance forces cannot alter an object's momentum or direction.

An item is kept traveling at a constant speed by a balanced force. In it, Newton's First Law of Motion is explained. A good illustration of a balanced force is a book on the table. The normal force (support force) of the table balances out the weight of the book. The two forces are exactly equal and opposed to one another.

While forces that are balanced can keep an item at rest or move at a steady speed, unequal forces can cause things to accelerate.

Therefore the correct option is D.

Read more about balanced forces, here

https://brainly.com/question/19127263

#SPJ5

All substances are built from
compound
oxygen
metals
atoms

Answers

Answer: All substances are built from

compound

oxygen

Explanation:

All substances are built from atoms as atoms are the basic building blocks of matter and are the smallest units of a chemical element. The correct option is D.

Atoms form the basis of all compounds. The fundamental building blocks of matter, atoms are the smallest units of a chemical element that nonetheless retain that element's chemical characteristics.

Atoms from various elements combine chemically to produce compounds, however compounds themselves are not the basic building blocks.

Although oxygen is an element that is present in several substances, it is untrue to say that oxygen is the primary component of all substances.

Although metals are a specific kind of element, not all substances are made of metals. Thus, the most correct response is that all substances are composed of atoms.

Thus, the correct option is D.

For more details regarding atoms visit:

https://brainly.com/question/13654549

#SPJ6

Your question seems incomplete, the probable complete question is:

All substances are built from

A. compound

B. oxygen

C. metals

D. atoms

Which of the following can cause the extinction of a species?
climate change
catastrophic events
interactions with other species
human activities

Answers

Answer: human activities

Explanation:

What are three organelles that are involved in the production of proteins?

Answers

Answer:

golgi bodies, ribosomes and endoplasmic reticulum.

Explanation:

Hope this helps!

Other Questions
What were the consequences of agriculture for humans in Mesopotamia and Egypt? Can someone help me what is the answer Which Shape is NOT quadrilateral Which power is not given to Congress? the question is in the photo If you had to fix 2 things about the Articles of Confederation,what would they be and why? Jenna's name was announced and she climbed the stairs to the stage. As she looked out at her friends and family, her eyes glistened with tears. "My fellow classmates," she began, as the flash of cameras lit up her face. Based on the details in the passage, which inference is most likely true? A. Jenna is famousB. Jenna's family is proud of her. C. Jenna is nervous.D. Jenna's friends are on stage. Which product of respiration is used for tissue repair and cellular function?carbon dioxidewaterenergyoxygen What cellular function is negatively impacted by an increase in cell size? plz answer it as fast as you can add then simplify if possible 1/2 + 2/5 11. Peripheral membranes are located An item is regularly priced at $81. It is on sale for 45% off the regular price. Find the sale price. The smallest bone in the pelvic girdle is theO pubis.o ilium.O ischium.O calcaneus. How do we see the Enduring Issue of Conflict affect the Greek city-states through the Greco-Persian and/or Peloponnesian Wars? How did large European mammals change the nature of work in America A good example of a natural phenomena causing geographical isolation is the-Mississippi River-Sahara Desert-Grand Canyon-Great Pyramid Can someone plss answer this it's SpanishPlssssssss someone helllp Jennifer is applying a constant force to swing a can on the end of a string, as shown here. If the can is moving around the circle at a constant speed, which statement correctly describes the motion of the can? A. The can accelerates at every point along the orbit and has changing velocity. B. The can has constant acceleration and changing speed. C. The can has constantly changing acceleration. D. The can moves at a constant velocity. What was one key WEAKNESS of the Articles of Confederation?