Answer:the correct answer is eating or breathing
Explanation: because most animals eat to get the substances they need and breathing is also a big one if they don't breath they will die like the every being on this planet needs oxygen to live if we do not have those we will drop over dead.
What is the difference between prokaryotic and eukaryotic cells?
The main difference that separates prokariotic organisms from eukaryotic organisms is the organisation of the genetic material. Prokaryotes have a single chromosome that isn't separated by a membrane and it's called nucleoid. Eukaryotes have multiple chromosomes that are inclosed in a nuclear envelope(nucleus).
The only organelles present in prokaryotic cells are the ribosomes(70S) which differ from the eukaryotic ribosomes(80S). Eukaryotic cells have membrane bound organelles like the mitochondrion or Golgi aparatus.
Which of the following statements regarding prokaryotic and eukaryotic cells is true
Answer:
I would need the statements to answer that. however prokaryotic cells are plant cells and eukaryotic cells are animal cells
Answer:
They are typically smaller than eukaryotic cells. The DNA of a prokaryotic cell is contained in the nucleoid. There are several ways in which prokaryotic cells are different from eukaryotic cells. Firstly, they are generally smaller in size, their organelles are not membrane bound, and they have no nucleus. They, however, share commonalities with eukaryotic cells including the presence of a bilipid plasma membrane, presence of ribosomes and DNA.
Hope this helps, have a great day/night, and stay safe!
Read each of the answers below carefully: Which statement best describes the cell cycle? a. Cells grow and develop during interphase. Cells reproduce during the mitotic phase. b. Cells grow and develop during the mitotic phase. Cells reproduce during interphase. c. The nucleus of the cell divides during interphase. The cytoplasm of a cell divides during the mitotic phase. d. The nucleus of the cell divides during the mitotic phase. The cytoplasm of a cell divides during interphase.
Answer:
a. Cells grow and develop during interphase. Cells reproduce during the mitotic phase.
Explanation:
Cell cycle refers to the series of processes that leads to the growth/development and division of a cell. The cell cycle uses MITOSIS for cell growth. Mitosis comprises of two distinct stages namely: INTERPHASE AND MITOTIC PHASE. The interphase is referred to as the resting phase of the cell in which the cell grows and develops.
On the other hand, MITOTIC PHASE is the stage where the actual division of the nucleus (karyokinesis) and cytoplasm (cytokinesis) generally called CELL DIVISION occurs. Therefore, the cell reproduces i.e. one cell forming two, in the mitotic phase.
The statement best describes the cell cycle - a. Cells grow and develop during interphase. Cells reproduce during the mitotic phase.
Cell cyclethe series of processes that result in the growth and development and division of a cell.The cell cycle uses MITOSIS for cell growth. there are two distinct stages namely:INTERPHASE is referred to as the resting phase of the cell in which the cell grows and develops.MITOTIC PHASEis the stage where the actual division of the nucleus (karyokinesis)and division of cytoplasm (cytokinesis)Thus, The statement best describes the cell cycle - a. Cells grow and develop during interphase. Cells reproduce during the mitotic phase.
Learn more:
https://brainly.com/question/796780
Which of the following processes begins when a star enters the main sequence?
a
Nuclear fission
b
Nuclear fusion
c
Condensation of a nebula
d
Appearance of a supernova
Answer:
i believe it is B: Nuclear Fusion
Explanation:
Answer:
C. Nuclear Fusion
Explanation:
I am 1000000000% sure this is correctamundo, stay cool, and have a great day!
Peoples choices can sometimes have negative effects on their own health as well as the health of your well-being of others describe to these choices explain how they can impact the individual and others
Answer
a good environment could mean better people better love and kindness bad environment could mean problems in your future and/or daily life this can affect everybody and anybody
Explanation:
What would happen to a species if it was quickly moved from a familiar environment to an extremely different environment.
Bacteria cannot survive in deep ocean areas where no light is present. true or false
Answer:
false on edge
Explanation:
All substances are built from
compound
oxygen
metals
atoms
Answer: All substances are built from
compound
oxygen
Explanation:
All substances are built from atoms as atoms are the basic building blocks of matter and are the smallest units of a chemical element. The correct option is D.
Atoms form the basis of all compounds. The fundamental building blocks of matter, atoms are the smallest units of a chemical element that nonetheless retain that element's chemical characteristics.
Atoms from various elements combine chemically to produce compounds, however compounds themselves are not the basic building blocks.
Although oxygen is an element that is present in several substances, it is untrue to say that oxygen is the primary component of all substances.
Although metals are a specific kind of element, not all substances are made of metals. Thus, the most correct response is that all substances are composed of atoms.
Thus, the correct option is D.
For more details regarding atoms visit:
https://brainly.com/question/13654549
#SPJ6
Your question seems incomplete, the probable complete question is:
All substances are built from
A. compound
B. oxygen
C. metals
D. atoms
WILL GIVE 20 POINTS AND BRAINLIEST PLS HURRY
In order for a scientific explanation to be valid, it MUST be based on evidence from _[blank]_.
a. hypotheses of scientific experiments
b. a credible scientific journal
c. the latest scientific research
d. observations of the scientific investigation
Answer:
a. hypotheses of scientific experiments
Explanation:
Describe some of the properties of water and explain how the structure of water is responsible for these properties.
Answer:
The main properties of water are its polarity, cohesion, adhesion, surface tension, high specific heat, and evaporative cooling. A water molecule is slightly charged on both ends. This is because oxygen is more electronegative than hydrogen. ... The stream of water bends due to the polarity of water molecules.
Explanation:
List four characteristics of plants.
Answer:
1. Plants produce their own food.
2. Plant cells have a cell wall.
3. Plants reproduce with spores and sex cells.
4. Plants have a vascular system.
Explanation:
Here is four characteristics plants have.
Plants produce food through photosynthesis so I included that here.
Hope this is correct, have a great day.
Use chromosomes 11 and 17 to answer the following questions. Chromosome Map Chromosome 17 is made of over million base pairs. Approximately how many genes are found on chromosome 17? List the genetic disorders found on chromosome 17. What do you know about any of those disorders?
Answer:
Hello!
Chromosome 17 is made of over 80 million base pairs.
Approximately how many genes are found on chromosome 17? 1600
Explanation:
Chromosome 17 is made up of more than 80 million base pairs. Approximately, 1600 genes are found on chromosome 17. The genetic disorders found on chromosome 17 are as follows:
Breast cancer.Neurofibromatosis.DNA damage response in individuals.Scoliosis.Congenital heart anomalies. What are Chromosomes?Chromosomes may be defined as thin, thread-like structures that may appear in the nucleus of the cell during the process of cell division. These structures may contain DNA, RNA, histones, and non-histone proteins. Chromosomes may be discovered by E. Strasburger in 1875.
Human chromosome 17 is implicated in a wide range of human genetic diseases. It is home to genes involved in many genetic disorders that may affect the physiology of an individual. They are very severe to organisms.
Mosaic trisomy 17 is a rare chromosomal anomaly syndrome, with a highly variable clinical presentation, mostly characterized by growth delay, intellectual disability, body asymmetry with leg length differentiation, scoliosis, and congenital heart anomalies.
To learn more about Genes and chromosomes, refer to the link:
https://brainly.com/question/29393001
#SPJ2
What do the enzymes in excision repair systems do?
A destroy cancer cells
B cut off telomere sections
C replace dna damaged by chemicals
D replace rna primers with dna
when benedicts solution is added to a sucrose solution and put into a boiling water-bath , no change in color is observed
state why no color change is observed
Answer:
b
Explanation:
Transcribe the following DNA strand into mRNA and translate that strand into a polypeptide
chain, identifying the codons, anticodons, and amino acid sequence.
DNA: CGATACAATGGACCCGGTATGCGATATCC
Which of the following problems are a result of acid deposition?
Nitrogen depletion in soils
Decreased pH levels in lakes and rivers
Corrosion of monuments and metal structures
I and III
II and III
I only
II only
Answer:
II and III
Explanation:
Acid will decrease pH levels in water and corrode monuments like marble statues and rust metals, but has no correlation to nitrogen depletion.
Hope this helped!
A 100 kg box is initially at rest on a level surface. One 10 N force acts on the box , directed toward the right. A second 10 N force acts simultaneously on the box , directed toward the left , as shown.
Since 10 N forces are acting from both sides, these are balanced forces and the box will not move because balanced forces are acting on it. So the correct option is D.
What are balanced forces?Forces that are equal in magnitude and opposing in direction are said to be balanced forces. Equilibrium is seen as a condition of balanced forces. There is no shift in direction when the forces are in balance.
Balanced combined forces have always been equal to zero. These are vectors for merging. Balance forces cannot alter an object's momentum or direction.
An item is kept traveling at a constant speed by a balanced force. In it, Newton's First Law of Motion is explained. A good illustration of a balanced force is a book on the table. The normal force (support force) of the table balances out the weight of the book. The two forces are exactly equal and opposed to one another.
While forces that are balanced can keep an item at rest or move at a steady speed, unequal forces can cause things to accelerate.
Therefore the correct option is D.
Read more about balanced forces, here
https://brainly.com/question/19127263
#SPJ5
Explain how diffusion and osmosis are related to the symptoms of cystic fibrosis
Answer:
Answer D
Explanation:
just took the test.
Which of the following can cause the extinction of a species?
climate change
catastrophic events
interactions with other species
human activities
Answer: human activities
Explanation:
What Bacteria is put in yougurt ?
Answer:
food bateria
Explanation:
Vaporization is the reserve of what?
Answer:
Vaporization is the reserve water
Explanation:
Which of the following statements is true?
Opportunistic bacteria only cause infection under certain conditions.
Most bacterial infections are caused by bacteria already in the body.
Leukocytes are the first line of defense against pathogenic microorganisms.
The flu and the common cold are treated with rest, fluids, and antibiotics.
Answer:
1 one is true
2 is true
3 is falase
Answer:
a
Explanation:
Phenotypes are the
observable characteristics of an individual (ex:
curly hair)
or
genetic representation of a an individual (ex: Hh)
Answer:
phenotype are the observable characteristics of an individual (ex:curly hair)
Make a list of different weather patterns
Weather comes in all different forms, and it changes by the day. It could be sunny one day and raining the next. It could even be sunny, rainy, cloudy, and stormy in one day.
Common Types of Weather Elements
The weather has a lot of different factors. When someone asks how the weather is today, you need to think about temperature, humidity, precipitation, wind, cloudiness, and atmospheric pressure. All these different parts work together to create the weather you see when you walk out the door.
The air in the thermosphere is composed of atoms of _____ that are very far apart from each other.
Answer:
Explanation:
In the upper thermosphere, atomic oxygen (O), atomic nitrogen (N), and helium (He) are the main components of air.
Compare asexual and sexual reproduction. Place each statement into the correct box.
Answer:
Explanation:
asexual doesn't require a mate or another thing to reproduce. sexual requires another thing to reproduce like a male and female
Answer:
During asexual reproduction, the organism that is reproducing spits in two.
A sea anemone reproduces asexually.
During sexual reproduction, there are two organisms(male and female) that are part of the reproductive process.
Humans reproduce sexually.
Explanation:
In a chemical analysis of a sample of animal tissue, which element would most likely be found in the smallest quantity?
Answer:
Iodine
Explanation:
Iodine is needed by animals because the body's metabolic rate is controlled by the action of an iodine hormone, called thyroxine, which is secreted by the thyroid gland in the neck.
If the animal fails to supply enough iodine through food to be able to make a normal amount of this compound, then the thyroid gland enlarges or expands trying to create enough, resulting in a common type of goiter.
Which of the following does not contribute to erosion?
O Lava
Olce
O Wind
O Water
What are three organelles that are involved in the production of proteins?
Answer:
golgi bodies, ribosomes and endoplasmic reticulum.
Explanation:
Hope this helps!
Why are packed juices contaminated with yeast
Answer:
It is because yeast is responsible to fix the carbon dioxide.