Art is a vivid source of history,Explain this statement​

Answers

Answer 1

Art is a historical resource because it can communicate social events that occurred at any time.

Art is a term to refer to a set of activities that result in expressions such as:

Plastics.Linguistic.Sonorous.BodilyCommunicative.

One of the characteristics of art is that it is strongly influenced by the cultural, social, political, and economic context of the moment in which it is made.

Therefore, art can be considered a historical source because it can transmit ideas or social phenomena that occurred during a specific time. An example of this is the rupestrian art because this was used to understand the life style of primitive communities such as the way the survived by hunting animals.

Learn more in: https://brainly.com/question/18007707

Art Is A Vivid Source Of History,Explain This Statement

Related Questions

How did the Northwest Ordinance of 1787 affect the formation of the United States? 8.10 C
A
It established a system for dividing the Western Territory.
B-It allowed slavery in the Northwest Territory.
C-It established procedures for settlement of the Northwest Territory.
D-It allowed states east of the Appalachian Mountains to become states,

Answers

Answer: The Northwest Ordinance of 1787 affected the united states because it set the standard for how the USA would bring new states into the Union.

Explanation:

"Peace is the base for development." Present your views in a paragraph​

Answers

Answer:

Peace is most likely the base for development because, most societys (or the good ones) are mainly established off of peace. For example, Naruto shippuden, when he becomes hokage he established peace in the village and with other great nations. Therefor making the village a great place.

Hope this helps!

Explanation:

What are the social effects of population growth.​

Answers

Answer:

DURING PUBERTY

Explanation:

Reasons for America to Expand
For each reason below, explain why the United States wanted to expand its territory.
Economic Reasons -
Political Reasons -
Cultural Reasons -
Military Reasons -

PLEASE HELP

Answers

Oh gosh oh I thought had the wrong I didn’t

Give at least one example of how each of the major agents of socialization (family, school, peer groups, and media) shaped the person you are today, particularly in regard to your statuses and roles

Answers

Answer:

Okay I don't personally know you so I will give you rather broad examples.

My family has influenced me by always giving me a place where I feel safe, a support system I know I will always have with me, and important relationships which I plan on keeping forever, this helps me with relationships apart from my family.

My school has taught me everything I know thus far. With knowledge comes success. It gives me a place to be social.

My friends/peer groups have supported me through many hardships in my life. I know I can count on them for their support and acceptance. They make me feel like I have a place to belong, which is what everyone deserves. They have taught me the way I should be treated, and to never settle for less than that from anyone.

Social media, in particular, can positively and negatively influence your life. For me I use it to make friends with people who I would never meet in real life. This gives me a sense of being social and making new friends. Social media has also negatively influenced me in the sense that people can be harsh, and that damages your self confidence sometimes.

I really hope this is what you meant, and that it helps you/anyone else. I wrote this all myself so anyone can use it :)

how does the legislative branch and the executive branch affect me and my everyday life?

Answers

Answer:

It is the job of the Executive Branch to make laws, appoints the heads of the federal agencies, including the Cabinet. The Cabinet and the federal agencies are responsible for everyday enforcement of laws. ... Before a law can be passed, the President has to sign it into affect.

Explanation:

Why did Caesar
institute January
1 as the first day
of the year?

Answers

Julius Caesar thought it would be appropriate for January, Janus's namesake month

How was a pharaoh both a political leader and religious leader?

Answers

Answer:

Pharaoh

Explanation:

Pharaohs were compared to God with supreme power and negotiator between God and people. Pharaohs hold power over laws, temples, and land. He also attended services and construct temples to honour Gods. They believe in the afterlife which made Pharaohs conserved their corpse after death.

In what ways was the influence of ancient Greece evident in Roman society?

Answers

Answer:

Greek architecture was one important influence on the Romans. As you remember, the Greeks built marble temples as homes for their gods. Temples like the Parthenon had stately columns that added to their beauty. The Romans used Greek designs in their own public buildings.

hope this helps!! :)

Explanation:

A(n) __________ is a federal program that states are required to implement, but given no additional funds for.

Answers

Answer:

An unfunded mandate

Explanation:

An unfunded mandate is a statute or regulation that requires a state or local government to perform certain actions, with no money provided for fulfilling the requirements. Public individuals or organizations can also be required to fulfill public mandates.

Answer:

D. unfunded mandate

Explanation:

Edge

Sociologists refer to observable facts or events that involve human society as
a. a sociological perspective.
b. social phenomena.
C. a social interaction.
d. sociological imagination.
Please select the best answer from the choices provided
A
B
D
Mark this and return
Save and Exit

Answers

Answer:

B

Explanation:

Answer:

b. social phenomena.

Explanation:

extra point plz help plz

Answers

Answer:

C

Explnation Its trust im a geologist

Answer:

thanks;)

Explanation:

What animal did the ancient romans like to use in some of their art and architecture

Answers

Answer:

Wolves, bears, wild boar, deer and goats were native to Rome and other animals were introduced following conquests abroad. Elephants, leopards, lions, ostriches and parrots were imported in the 1st Century B.C. followed by the hippopotamus, rhinoceros, camel and giraffe.

Explanation:

During the 1800's what industry hired women as switchboard operators?

Answers

Answer:

The telephone industry

Answer:

It is the telephone industry

Explanation:

Hope this helped have an amazing day!

I was wondering if anyone can give an explanation about what Sikhism is?

Answers

Answer:

Sikhism is a faith whose followers are called "Sikhs". The word Sikh means Student or Discipline. Their holy book is the Sri Guru Granth Sahib Ji.

Asch's conformity experimented showed that _____.


people were easily influenced to give the wrong answer

it was difficult to persuade someone to give a wrong answer

seventy-five percent of people answered correctly

confederate answers had no influence on others

Answers

Answer:

The correct answer is ''people were easily influenced to give the wrong answer.''

Explanation:

Solomon Asch (1951) was an American psychologist. The Asch experiment, was a famous experiment, designed to study conformity (degree to which the members of a social group will change their behavior, opinions and attitudes to fit with the opinions of the group), he wanted to study the influence of social pressure on people, the objective was to evaluate the responses of the individual under investigation, when the rest of the participants gave wrong answers on purpose. This was intended to allow Asch to determine how the individual's responses changed under the influence of peer pressure. The results of Asch's experiment were interesting showing that peer pressure can have a measurable influence on the answers given.

PLS help
Jose is attracted to a particular job because of the high salary and excellent health benefits. He is motivated by...

A. intrinsic values
B. extrinsic values
C. external values
D. improper values

Answers

Answer:

improper values.

Explanation:

I think this because it says "Jose is attracted to a particular job because of a high salary. " (sorry if I'm wrong).

People with celiac disease suffer from inflammation of the small intestine from eating gluten. The villi get damaged in this process. What is a consequence of this condition?
A. less absorption of nutrients
B. more absorption of nutrients
C. no solid waste exiting the body
D. no hydrochloric acid breakdown of food

Answers

Less absorption of nutrients

Answer:

Less absorption of nutrients

Explanation:

usa test prep and i got it right on the test prep

Imagine you want to convince your parents that changing the high school start time from 7:10 am to 8:30 am would make their lives easier. Which appeal would most likely move this audience to support your case

Answers

Logical or logos maybe

Answer:

I know how much it frustrates you when I sleep through my alarm and have to ask you to drive me to school I know I would be able to get up on time if I were able to set a alarm a little later

Explanation:

What will happen when two balloons with the same charges are brought close to each other


1.The balloons will attract each other.
2. The balloons will repel each other.
3. The charges of both balloons will change.
4. The charge of one of the balloons will change.

Answers

Answer:

They will repel each other - 2.

Explanation:

When two opposite charged balloons are brought together they attract each other because opposites attract, but when you bring two balloons with the same charges together, they will repel each other. Hope this helps :)

Answer: they will repel

Explanation:

What are some examples of cultural segregation?

Answers

Answer:

People who beleived in something and other people did not they will have to segergate

Explanation:

In sexually reproducing organisms, such as humans, which of the following statements is
TRUE about the DNA found in the cells of the children?

Answers

The answer is C I think don’t hate if I’m wrong

Some DNA in the cells of the children contains genetic information from each parent, but the amount of DNA containing information from each parent cannot be predicted is the statement was the true DNA found in the cells of the children. Thus, option (c) is correct.

What is DNA?

DNA can be referred to as deoxyribonucleic acid. The genetic code that gives each species its individuality is found in a molecule called DNA. The DNA are the test to prove the real blood relation. DNA report are the written form to analysis by the doctor. The DNA are the beneficial to the finding the blood relation.

According to Chargaff's criterion, the amount of guanine in the DNA that includes genetic codes from each original species or organism should be equivalent to the quantity of cytosine, and the amount of adenine must be equivalent to the quantity of thymine. The amount of DNA includes information from each father cannot be anticipated.

As a result, the DNA in the cells of the children contains genetic information is the statement of the truth. Therefore, option (c) is correct.

Learn more about on DNA, here:

https://brainly.com/question/264225

#SPJ2

Which court can have a jury?


A) U.S. District Court


B) Florida Supreme Court


C) U.S. Circuit Court of Appeals


D) U.S. Supreme Court

Answers

Answer: im pretty sure its d

Explanation:

Answer:

D. U.S. Supreme Court

Explanation:

Who knows how old Washington was when he was president?
Thanks so much

Answers

Depends on what you mean, when he first became president he was 57 years old. And was 65 when his presidency was over.


Chief Metacomet who rallied Native peoples from the northeast to wage
war on the colonists was known by what name? *

Answers

Answer:

Correct answer is King Philip.

Explanation:

King Philip started a famous war against Britain in 17th Century, known as King Philip's War (Metacomet's Rebellion). Philip was his English name, as at the time many Native leaders also have English names.

The rebellion was unsuccessful and King Philip was killed and beheaded in 1676.

what should be done to become an idol person?​

Answers

Answer:

Explanation: People that are seen as idols in today's world are people who are famous for creating the new best technology or being the wealthiest person in the world. To become an idol you must think out side the box and create something new that will help others benefit along with the world, or be someone who reaches to others through a mental connection such as a politician.

Victor Wooten asks us to approach music the same way we...

A. listen to it.
B. learn to ride a bike.
C. learn a verbal language.

Answers

Answer:

I think its C.

Explanation:

hefwnrgjvlkb

What do you understand by Citizen ?​

Answers

Answer:

citizen is the legal member of a country either by birth, neutralisation or marriage who the enjoys the full rights

how do these two events relate to each other?

Answers

Answer:

I need two events relate to each other

Explanation:

so I can answer the question

in kenya most communites were rulled by​

Answers

big juicy ballsacks ok ok I want points don’t a me

Answer:

Daniel Arap Moi

Other Questions
In tundra vegetation the soil is frozen from____ cm down what is the answer 1. Many plants can reproduce asexually. How is this an advantage for the plant? Why can it sometimes be a disadvantagefor the plant? Use details to support your answer. PLS ANSWER ASAP. ILL GIVE BRAINLIEST! Match the system for each of the following bodily organs.1.Nose a. Skeletal System2.Skull b. Circulatory System3.Kidneys c. Urinary System4.Veins d. Respiratory System 2 Which piece of evidence explains WHY the five themes of geography were created (A) In 1984. educators sought to better organize the teaching of geography in kindergarten through 12th grade classrooms. (B) The themes were created by the National Council for Geographic Education and the Association of American Geographers. (C) While these five themes have been since replaced by the National Geography Standards, they still provide an effective organization for the teaching of geography (D) Humans shape the landscape through their interaction with the land; this has both positive and negative effects on the environment Fill in the blank with the appropriate preposition.Paris est _____________ New York.a.) prs deb.) loin dec.) surd.) dans plz help timed MATHHHH 12 pointes Use the restriction enzyme EcoRi to cut DNAVictim DNA :GGAAG ATTCTACATTACTGACGGACGTGACGTGACCTTCTTAA GATGTAATGACTGCCTGCACTGACTNumber of restriction fragments ( pieces of DNA after digestion) :Size of restriction fragments ( count the number of bases on the top strand of each fragment , listed from largest to smallest ) :Suspect 1 DNA :GGAATTAAGCTTATTG AATTCTTATAG AATTCGGGGCCCAAGCTTATG AATTCAATT CCTTAATTCGAATAACTTAA GAATATCTTAA GCCCCGGGTTCGAATACTTAA GTTAANumber of restriction fragments ( pieces of DNA after digestion) :Size of restriction fragments ( count the number of bases on the top strand of each fragment , listed from largest to smallest ) :Suspect 2 DNA :CCATATAG AATTCAAGCTTAAG AATTCGGGGGAACGTTG AATTCAATTAATTGGGGGTATATCTTAA GTTCGAATTCTTAA GCCCCCTTGCAACTTAA GTTAATTAACCCNumber of restriction fragments ( pieces of DNA after digestion) :Size of restriction fragments ( count the number of bases on the top strand of each fragment , listed from largest to smallest ) :PLEASE HELPPP!!!!I WOULD APPRECIATE A LOT :) Select one of the readings in this unit, EXCEPT the Gettysburg Address, and in at least 150 words, discuss the historical context or cultural context the author demonstrates. i cant ever forgive the vampire diaries producers and directors for killing enzo but letting ratty matty the human LIVE?? like why did they keep matt alive when no one liked him but KILLED ENZOOOOOO How did Tisquantum help the Pilgrims????i will give brainliest and extra points Find the value of x in the image Which two numbers have a mean of 10 and a range of 4?NEED THIS ASAP PLEASE I WILL LEAVE A GOOD RATING I need helppppp with this please Read and choose the option with the regular verb in the imperfect tense.La princesa ley el libro.El rey no hablaba.La reina fue a la torre.El prncipe tom caf, Do you believe that parents should have all of the powers described in the Parents Constitution? Why or why not? answer the pic below How can you use density to separate mixtures like sand and small plastic pellets? What is the x- coordinate of the zero of the graphed line? How does the setting influence the theme of the story (pieces in the past ) story 15 points please help me with these three questions, i'll give brainliest