answer correctly for BL

Answer Correctly For BL

Answers

Answer 1

Answer:

The height is 5 feet

H= v/b

Step-by-step explanation:


Related Questions

What is the domian of the following represented by ordered pairs?
{(3, 7), (-5, 1), (2, 4), (-3, 6)}

Answers

Answer:

The Domain are 3,-5,2,-3

Step-by-step explanation:

hope that helps

Answer:

The domain is (3, -5, 2, -3

Step-by-step explanation:

Plz give brainlyest

Rectangle FGHJ has coordinates F(-8, 6), G(8, 6), H(8,-6), and J(-8, -6). The rectangle is dilated by a scale factor of v with the origin as the center of dilation to form rectangle F'G'H'J'. Which ordered pair represents the coordinates of vertex H'?

Answers

Answer:

H'(8v,-6v)

Step-by-step explanation:

Here coordinate of H is (8,-6). We are dilating it using the rule (x,y)-->(kx,ky) where 'k' is scale factor.

For our problem , the dilation factor is "v"

So, image would be (8v,-6v)

Kiran and Clare live 24 miles away from each other along a rail trail. One Saturday, the two friends started walking toward each other along the trail at 8:00 a.M. With a plan to have a picnic when they meet. Kiran walks at a speed of 3 miles per hour while Clare walks 3.4 miles per hour. After one hour, how far apart will they be?

Answers

Answer:

They would be 44.6 miles apart

Step-by-step explanation:

Here, we want to calculate how far they will be in 1 hour

Mathematically;

Distance = speed * time

In 1 hour, Kiran would have traveled a distance of 3 * 1 = 3 miles

While Clare would have traveled a distance of 3.4 * 1 = 3.4 miles

Now, we want to calculate how far apart they would be

On the 24 miles trail, Kiran would be at a distance of 21 miles to the other end

On the 24 miles Claire would be at a distance of 20.6 miles

So how far apart they would be is

24 miles + 20.6 miles = 44.6 miles

Joseph had 380 heartbeats in 4 minutes. How many did he have in 15 minutes? (Write a proportion)

Answers

1435

Step-by-step explanation:

1435 hope this helps

HELP ILL GIVE YOU 50 POINTS IF SOMEONE HELPS ME What is the total area of the figure below?
28 ft
4 ft 6 ft
14 ft
2 11
A. 47 ft2
B. 52 ft2
C. 168 ft2
D. 402 ft2

Answers

Answer:

D: 402 ft squared

Step-by-step explanation:

Trapezoid: 4 + 6 over 2 multiplied by 2 equals 10

28 x 14 = 392

392 + 10 = 402

hopes this helps plz mark me brainliest

If C = x + 8 and D = 2x + 10, find an expression that equals 2C + 3D in
standard form.

Answers

Answer:

[tex]8x+46[/tex]

Step-by-step explanation:

Insert the original values of C and D into the new expression:

[tex]2(x+8)+3(2x+10)[/tex]

Simplify the expression. Use the distributive property:

[tex]2(x)+2(8)+3(2x)+3(10)\\\\2x+16+6x+30[/tex]

Combine like terms:

[tex](2x+6x)+(16+30)\\\\8x+46=2C+3D[/tex]

:Done

The price of a tv was reduced from $250 to $200. What percent did the price decrease?

Answers

20%
250-200=50
250 x 0.2 =50
so 20%

identify the angles that each have a measure of 88

Answers

Answer:

∠1=∠88(Vertically Opposite angles are equal)

∠8=∠88(corresponding angles are equal)

∠3=∠88(alternate interior angles are equal

Angles ∠1, ∠3 and ∠8 are equal to 88°.

What is angle?

An angle is the formed when two straight lines meet at one point, it is denoted by θ.

Angle 1 and 88 are the vertically opposite angle, so they are equal

∠1 = 88°

Angle 1 and angle 3 are corresponding angle, so they are equal

∠1 = ∠3 = 88°

Angle 3 and 8 angle are vertically opposite angle, so they are equal

∠3 =∠8  = 88°

Therefore, ∠1 = ∠3 = ∠8  = 88°

To learn more about Angle on:

https://brainly.com/question/28451077

#SPJ2

Rewrite the function by completing the square.
g(x)= x^2-x-6
g(x)- __(x+__)^2+___

Thanks :)

Answers

Step-by-step explanation:

g(x) = x²- x - 6g(x) = x²- 2*1*1/2x + (1/2)² - (1/2)²-6g(x) = (x - 1/2)² - 6 1/4org(x) = (x - 1/2)² - 25/4

Answer:

[tex]g(x) = 1 (x+ -\frac{1}{2} )^{2} + -\frac{25}{4}[/tex]

Which solution set is graphed on the number line?
4 -3 -2 -1
0 1
2
3
4
0x21
Ox>1
Ox<1
O XS1

Answers

x>1 i’ve took this before

Plz help convert and show work plz!
1) 60 miles per hour to feet per second
2) 2.40 Euros per kilogram to dollars per pound (1 euro =
o = $1.42)

Answers

Answer:

1) 5280 feet/sec

2)$3.41

Step-by-step explanation:

60 miles is 316800 feet, divided by 60 which is 5280 feet/sec

2)2.4x1.42 is 3.41

You start at (-3, 0). You move right 4 units and up 1 unit. Where do you end?

Answers

Answer:

(1, 1)

Step-by-step explanation:

is x=-2 linear or nonlinear

Answers

Answer:

non linear

Step-by-step explanation:

Answer: I'd say linear

Step-by-step explanation:Because it is a straight line vertically on the x-axis -2

Im in desperate need of help

I need help with Just ONE question in math specifically 8th grade pls help.

Answers

I don’t see a problem but repost it and I can see if I know it

What is the perimeter of △JKL? 6 9.5 11.5 19

Answers

For perimeter, you just need to add up all the numbers!

Answer:

the awnser is 19

Step-by-step explanation:

i got it correct on edge2020

Chin canned a number of quart jars and a number of pint jars of tomatoes from his garden. A pint is 16 ounces and a quart is 32 ounces. The number of pints he canned is represented by p, and the number of quarts he canned is represented by q. Which equation models the scenario if Chin canned a total of 1,280 ounces? 1280 plus 16 p equals 32 q 1280 plus 32 q equals 16 p 32 q minus 16 p equals 1280 16 p plus 32 q equals 1280

Answers

Answer:

16 p plus 32 q equals 1280

16p + 32q = 1,280

Step-by-step explanation:

A pint = 16 ounces

A quart = 32 ounces

p = number of pints he canned

q = number of quarts he canned

if Chin canned a total of 1,280 ounces?

Total ounces canned = 1,280

Equation:

p × 16 ounces + q × 32 ounces = 1,280

16p + 32q = 1,280

The options:

1280 plus 16 p equals 32 q

1,280 + 16p = 32q

1280 plus 32 q equals 16 p

1,280 + 32q = 16p

32 q minus 16 p equals 1280

32q - 16p = 1,280

16 p plus 32 q equals 1280

16p + 32q = 1,280

The correct answer is

16 p plus 32 q equals 1280

16p + 32q = 1,280

Answer:

16p+32q=1280

Step-by-step explanation:

edge

A while back, either James borrowed $12 from his friend Rita or she borrowed $12 from him, but he can't quite remember which. Either way, he is planning to pay her back or ask that she pay him back this afternoon. If he has $42.80 in his wallet, which equation represents the amount of money he may have after he sees Rita? |x – 42.80| = 12

Answers

Answer:

|x - 42.80| = 12

Step-by-step explanation:

The absolute value |x - a| = b means either x - a = b or x - a = -b

Let x represent the amount of money in the afternoon after he has either paid her back or she has paid him.

Given that he has $42.80 in his wallet and he either borrowed $12 from his friend Rita or she borrowed $12 from him. Therefore:

x = 42.80 + 12; or x = 42.80 - 12

Hence:

x - 42.80 = 12; or x - 42.80 = -12

|x - 42.80| = 12

A museum requires a minimum number of chaperones proportional to the number of students on a field trip. The museum requires a minimum of 333 chaperones for a field trip with 242424 students.

Answers

Answer: See explanation

Step-by-step explanation:

Here is the complete question:

A museum requires a minimum number of chaperones proportional to the number of students on a field trip. The museum requires a minimum of 3 chaperones for a field trip with 24 students. Which of the following could be combinations of values for the students and the minimum number of chaperones the museum requires? Choose 2 answers.

A. Students: 72

Minimum of chaperones: 9

B. Students: 16

Minimum of chaperones: 2

C. Students: 60

Minimum of chaperones: 6

D. Students: 45

Minimum of chaperones: 5

E. Students: 40

Minimum of chaperones: 8

Since the museum requires a minimum of 3 chaperones for a field trip with 24 students. This means that there will be 24/3 = 8 students per chaperone.

We then divide the number of students given in the question by the number of chaperone to know our answers. This. Will be:

Students: 72

Minimum of chaperones: 9

This will be: 72/9 = 8

Therefore, this is correct.

B. Students: 16

Minimum of chaperones: 2

This will be: 16/2 = 8

This is correct

C. Students: 60

Minimum of chaperones: 6

This will be: = 60/6 = 10.

Therefore, this is wrong

D. Students: 45

Minimum of chaperones: 5

This will be 45/5 = 9

Therefore, this is wrong.

E. Students: 40

Minimum of chaperones: 8

This will be: 40/5 = 8.

Therefore, this is wrong.

Therefore, options A and B are correct.

[WORTH 100 WHOLE POINTS] !!

I need it soon!!

Answers

1. 1/5
2. 3/5
3. i do not understand
4. 1/2 (even chance)

Answer:

1. 1/5    2. 3/5       4. 1/2    I dont know what 3 is

Step-by-step explanation:

How to find the constant of y=3/5x

Answers

Combine 35 and x . Since the equation can be written in the form y=kx y = k x , y varies directly with x and k . The constant of variation, k , is 35 .

Answer:

3/5

Step-by-step explanation:

y=3/5x = 0                 x both sides by 5

5y-3x=0                     reorder terms (community property)

-3x+5y=0

3x-5y=0                                changes the signs when you do that

IS THIS GRAPH A FUNCTION? YES OR NO

Answers

Answer:

no, because multiple x-values repeat

Step-by-step explanation:

No, using the line method we can see that two dots line up with each other, therefor it is not a function.

Billy is making a sign in the shape of a regular octagon. What is the measure of each interior angle of the sign?
O 45°
O 60°
O 120°
O 135°

Answers

Answer:

135°

Step-by-step explanation:

Interior angle= (n-2)/n ×180°

n= no. of sides

so,

putting the value of n which is 8

(8-6)/8 × 180

=135°

The measure of each interior angle of the sign is 135 degrees.

The correct option is D.

What is an interior angle?

Angles inside a polygon are referred to as interior angles. A triangle, for instance, has three internal angles. Interior angles are sometimes defined as "angles confined in the interior area of two parallel lines when they are crossed by a transversal."

In a regular octagon, all the interior angles are equal.

The formula to find the measure of each interior angle of a regular polygon with n sides is:

measure of each interior angle = (n-2) x 180 / n

For an octagon, n = 8, so we can substitute this value into the formula and simplify:

measure of each interior angle = (8-2) x 180 / 8

measure of each interior angle = 6 x 180 / 8

the measure of each interior angle = 135 degrees

Therefore, the measure of each interior angle = 135 degrees.

To learn more about the interior angles;

brainly.com/question/10638383

#SPJ7

There is a sale at your favorite clothing store. They have their jeans priced at $49.99 with a extra 20% off. How much will you pay for three pairs of jeans, not including tax? Exlpain how you got your answer.

Answers

Answer: You need to pay $119.98 for three pairs of jeans.

Step-by-step explanation:

Market price of 1 jeans = $49.99

Discount percent = 20% = 0.20

Market price for 3 jeans = 3 x ($49.99)

= $ 149.97

Discount price = 20% of (Market price for 3 jeans )

= .0.20 x ($149.97)

= $ 29.99

Price of 3 jeans after discount = (Market price for 3 jeans ) - ( Discount price)

= $ (149.97 - 29.99)

= $  119.98

Hence, you need to pay $119.98 for three pairs of jeans.

Emily used 27 centimeters of tape to wrap 3 presents. How much tape will Emily need in all if she has to wrap 5 presents? Assume the relationship is directly proportional.

? centimeters

Answers

Answer: 45 centimeters

Step-by-step explanation:

27 - 3

divide both by 3

9 - 1

multiply by 5

45 - 5

Answer:

45 Centimeters.

Step-by-step explanation:

27 / 3 = 9

9 x 5 = 45

Why are the solutions to the proportions StartFraction 40 over 8 EndFraction = StartFraction x over 10 EndFraction and StartFraction x over 40 EndFraction = StartFraction 10 over 8 EndFraction the same?

Answers

Answer:Because both result in the equation 8x = 400 which simplifies to 50.

 Step-by-step explanation:

Answer:

50

Step-by-step explanation:

no need

Please answer asap take ur time


Maya is going to an amusement park. The price of admission into the park is

$10, and once she is inside the park, she will have to pay $2 for every ride she

rides on. How much money would Maya have to pay in total if she goes on 15

rides? How much would she have to pay if she goes on r rides?

Answers

total= 40, rides= 30

How many lines of symmetry are in this snowflake design?
5

Answers

BS UDJD9AYW VS DHS EG EE S WCWVW W S FHRD DJE EHVEBE EBE

935 = 85 x 11
Which statement does the equation represent?
O A 85 is 11 more than 935.
B. 935 is 85 more than 11.
OC. 935 is 85 times as many as 11.
D. 85 is 11 times as many as 935.

Answers

Answer:

since 85 times 11 is equal to 935 I'd say the answer to that is D

Step-by-step explanation:

Answer:

5x185=935

Step-by-step explanation:

Please help asap- will give brainliest:
See the image attached and choose ONE

Answers

Yellow is the correct answer, I think.
if u have desmos it will help a lot and i think it would be blue

PLEASE HELP WILL GIVE BRAINLEST

Answers

=√40 = 6.32455 ≈ 6.3

Answer:  B )  6.3

Other Questions
what do you divide (-2/3) with to get 3/10 The sum of the tens digit and the hundreds digit of a number is three times the units digit. 1/5 of the sum of all three digits is 1 less than the units digit. Find all three-digit numbers that satisfy these conditions. Which of the following sentences is not punctuated correctly?A. She was the sweetest and most generous person I have ever met.B. This is the last long boring class I have left today.C. Dallas is a huge and sprawling city.D. Instead of carrying guns, the police in Britain carry long, metalnightsticks.SUBMIT I need help ASAP!!!!!!!! PLEASE CORRECT ANSWER!A student writes an incorrect step while checking if the sum of the measures of the two remote interior angles of triangle ABC below is equal to the measure of the exterior angle.A triangle ABC is shown. The base of the triangle extends into a straight line. The angle formed between this straight line and the edge of the triangle is marked as w. The angle adjacent to w is marked as z, and the other two angles inside the triangle are marked as x and y.Step 1: mx + my + mz = 180 degrees (sum of angles of a triangle)Step 2: mw mz = 90 degrees (corresponding angles)Step 3: Therefore, mx + my + mz = mw + mzStep 4: So, mx + my = mwIn which step did the student first make a mistake and how can it be corrected? (5 points)Select one:a. Step 1; it should be mx + my + mz = 180 degrees (sum of corresponding angles)b. Step 2; it should be mw + mz = 180 degrees (supplementary angles)c. Step 1; it should be mx + my + mz = 90 degrees (corresponding angles)d. Step 2; it should be mw + mz = 90 degrees (alternate exterior angle) Harder equationsSolve these equations:3x + 3 = -6. X= A prime number has two factors, itself and 1? * AABB Rhythm poem christmas themed. pls can you make 3 stanza of AABB poem. pls help me what is the role of the grana in chloroplast? Which of the following will NOT help reduce the costs of car ownership? A. Carpooling and safe driving B. Performing maintenance tasks on your own C. Speeding D. All of the above 5TH GRADE LEVEL QUESTION: look at photo and answer. A school has 617 students. Each class has between 28 and 32 students. Which is the best estimate of the number of classes in the school?14 classes20 classes30 classes60 classes Whats the corresponding mRNA strand for this DNA strand: TACGGGATAAGGCCACCTCTGGTAGACCACATT 20 POINTS!!!!!!Which of the following is probably not an effect of urban sprawl?A. the loss of habitats and biodiversityB. decreased shortages of water and other resourcesC. increased temperatures in summer monthsmore air pollution that is harmful to human healthPlease select the best answer from the choices providedABCD GMMThe numbers are36XAnd 46 degrees QUESTION 10 of 10: You have a need to purchase 30 units of a product and have them delivered to your company in five days. The sale price is $35 each. Sales tax on the product is 8%. Shipping price is $15. But there is also a 25% rush charge on the sales price added for deliveries less than seven days, which is also taxable. What will be the total cost of this purchase? O a) $1,050.00 b) $1,327.50 Oc) $1,396.50 O d) $1,432.50 plz help i need help im failing Simplify as far as possible.182 Part B: A triangle has vertices A (-2, 3), B (0, 0), and C (1, 2). What are the coordinates of the vertices if the original triangle is dilated by a scale factor of 3 and then reflected over the x-axis? A medium artichoke contains about 14% of the recommended amount of a certain mineral an average adult should have each day. About how many grams of the mineral should the average adult have each day? I walked into that reading room a happy healthy man. I crawled out a decrepit wreck