Answers
Answer:
There are seven essential processes in common: movement, respiration, sensitivity, growth, reproduction, excretion and nutrition or MRS GREN.
but i think the answer is D
Explanation:
Related Questions
Based on the graph in Figure 2, identify the environmental conditions (flower density AND proportion of deep flowers) where a short- tongued bee has the greatest relative advantage over a long tongued bee. Based on the graph in Figure 2, identify the range of proportion of deep flowers at which a long tongued- bee always has an advantage over a short tongued bee.
Answers
Answer:
The correct answer would be - low flower density and low deep flower proportion
Explanation:
To find the environmental conditions for a short-tongued bee has the greatest relative advantage over long-tongued bees it is required to find the highest value of relative advantage short-tongued bees has on long-tongued bees which is the point where flower density and deep flower proportion is lowest (near the zero) according to the graph. That is represented in the graph by the peak in the white shaded portion.
To find the range of deep flower proportion at which a long-tongued bee has an advantage take a closer look to the grey shaded area where if the deep flower proportion move from 0.6 to 1 the advantage of long-tongued bees over short-tongued.
Floral density with the graph shows the low flower density and low deep flower proportion. Floral density often influences the species composition of flower visitors.
This variation in visitor species composition has significant effects on pollination success and plant fitness, poorly understood, especially in the many pollination guilds dominated by non-territorial species.
How do flower visitors diverse the traits?It explores how flower visitors with diverse traits should distribute themselves across resource patches differing in floral density.
The model predicts that species with low flower search speeds and low flower handling costs compared to competitors will usually dominate dense flower patches.
In addition, amongst flower visitors that have lower energy expenditure rates while handling flowers than while traveling, species maximizing energetic efficiency are associated with dense flower patches.
Therefore, the correct answer is low flower density and low deep flower proportion.
Learn more about the flower density here:
https://brainly.com/question/11253692
4
_ is a component of soil made entirely of decomposed organic remains. This component increases soil fertility and _
the ability of soil to retain water.
A. Humus; increases
B.
Parent material; decreases
C.
Subsoil; increases
D
Topsoil; decreases
Answers
Answer:
The answer is A
Explanation:
am 100% sure
centricles play specific roles during the division of
Answers
Answer:Centrioles play a notable role in cell division. ... These spindle fibers act as guides for the alignment of the chromosomes as they separate later during the process of cell division. Though centrioles play a role in the mitosis of animal cells, plant cells are able to reproduce without them
Explanation:
What are common changes
In an environment?
Answers
Answer:shelter, land, prey
Explanation:
which of the following is not true about an allele?
A. alleles are found at the same place on a chromosome
B. alleles have a dominant and recessive form
C. an allele is never independently assorted and passed down randomly
D. and allele is one of two or more forms of a gene
Answers
Answer:
C
Explanation:
I guess it's C but not conform
C. An allele is never independently assorted and passed down randomly.
What is an allele?Alleles are found at the same place on a chromosome, known as a locus. They can have a dominant and recessive form, meaning that one form of the allele may be expressed over the other in the phenotype of an organism. An allele is one of two or more forms of a gene, which are variations of a particular gene that can produce different traits in an organism.
However, alleles are not always passed down randomly. In meiosis, the process of cell division that produces gametes (sex cells), the alleles of a gene are independently assorted and passed down to the offspring. This means that each gamete receives one copy of each allele at random, which can result in a mix of alleles in the offspring. However, the exact combination of alleles that an offspring receives depends on the combination of alleles that its parents had, which can influence the probability of certain alleles being passed down.
Learn more about allele, here:
https://brainly.com/question/14206531
#SPJ2
Write a summary statement for saturated fats including whether they are solids or liquids at room temperature and weather they have all single carbon-to-carbon or at least one carbon-to-carbon bond
Answers
Answer:
A saturated fat is a type of fat in which the fatty acid chains have all or predominantly single bonds. A fat is made of two kinds of smaller molecules: glycerol and fatty acids. Fats are made of long chains of carbon atoms. Some carbon atoms are linked by single bonds and others are linked by double bonds. Double bonds can react with hydrogen to form single bonds. They are called saturated because the second bond is broken and each half of the bond is attached to a hydrogen atom.
Explanation:
Answer:
saturated fats consists of single covalent bond and they are solid at room temperature and their melting point increases with increasing chain length
hope it helps
Explanation:
What structure is responsible for the suction created by the
starfish's tube feet?
Answers
What’s the corresponding mRNA strand for this DNA strand: TACGGGATAAGGCCACCTCTGGTAGACCACATT
Answers
Thymine(T) pairs with adenine(A)
Adenine(A) pairs with uracil(U)
Cytosine(C) pairs with guanine(G)
therefore the corresponding mRNA strand for TACGGGATAAGGCCACCTCTGGTAGACCACATT
is
AUGCCCUAUUCCGGUGGAGACCAUCUGGUGUAA
I need help with number 3
Answers
O2 (oxygen) is a covalent compound
How would a geologist use absolute dating to determine the age of sedimentary layers? by dating the age of intrusions and extrusions near a sedimentary rock layer by comparing the relative ages of several sedimentary rock layers by identifying fossils in nearby intrusion and extrusions and determining their age
Answers
Answer:
Radiometric dating methods
Explanation:
Absolute dating is the process of determining an age on a chronological or specified time scale in which events occurred in archaeology and geology. Absolute dating can be determined by using properties of the atoms that make up materials.
The most common method of absolute dating uses by geologists is radiometric dating methods which is based on the natural radioactive decay of certain elements such as potassium and carbon found in the rocks. By comparing the ratio of parent isotope with a known half-life to daughter product in the rock, the age of the rock can be determined.
The carbon-14 isotope is used in radiocarbon dating, but is only useful for measuring recently formed rocks in the geologic past. The decay of Potassium-40 isotope known as potassium-argon (K-Ar) method allows dating of materials that up to 1,000 billion years old.
Answer:
by dating the age of intrusions and extrusions near a sedimentary rock layer
Explanation:
got it right on the assighment
can u answer that question
Answers
Answer:
The synthesis of new proteins
Can you give me a slogan for using compost at home
Answers
Answer:
Mark my answer the brainliest if this helps,
A Partner with the Environment.
Because What You’ve Got is Not Waste.
Clean Up Your Act. Compost.
Compost On Your Mind?
Don’t Burn Our Future.
Eat Smart
Enriching the Soil Naturally.
Feed the Soil.
Fit Energy Saving Light Bulbs
Give Green a Chance
Greening the Hill.
It’s Easy to Do.
Lets Talk Dirty.
Local Composting Made Easy.
Making a Clean Scene.
Making a Compost Pile
Mother Nature Recycles.
Nature’s Way to Grow.
Plant a Garden
Plant Trees
Raking Leaves
Recycle All Recyclable Items
Recycle Your Grey Water
Reduce The Use of Energy
Replenish the Earth for Generations.
Reuse Stuff
Reuse Whatever You Can
Reuse, Reduce and Recycle
Save Water To Save Money
Shoveling The Driveway
Smells Like Green Spirit
So Hot Right Now.
Sustainability Stools.
The Compost People.
The Solution to Sustainable Soil and Water.
Think Before You Buy
Too Good to Waste.
Turn It Off When Not In Use
Use Less Electricity
Walk To Work or Take The Bus
Waste Wise.
We Speak Organic.
We’re Growing.
Zero Waste.
Answer:
mark ssydnie the brainliest
Explanation:
describe and explain how the rate of photosynthesis is affected by light intensity
Answers
what occurs in a chemical reaction
Answers
Answer:
options on. D is write answer
6. Name the nitrogenous wastes excreted by the following organisms:-
(1) Desert mole
(ii) Marine fish
(111) Tilapia
Answers
Answer:
Desert mole excretes concentrated urine with urea.
Marine fish excretes urine with uric acid.
Tilapia excretes dilute urine with amino acids.
Explanation:
The nitrogenous wastes that are excreted by the following organisms are as follows:
Desert mole: Urea.Marine fish: Uric acid.Tilapia: Amino acids. What is Nitrogenous waste?Nitrogenous waste may be defined as the compounds which are excreted by the organisms that contain an excessive amount of nitrogen or its derivative products.
Among the above-given organisms, Desert mole and Marine fish are Ureotelic organisms that excrete either concentrated or diluted urine with a significant amount of urea and uric acid respectively.
While Tilapia is an Ammonotelic organism that excretes diluted urine with a significant amount of amino acids.
Therefore, it is well described above.
To learn more about Nitrogenous waste, refer to the link:
https://brainly.com/question/9517408
#SPJ2
Tay-Sachs disease is a rare inherited disorder that progressively destroys nerve cells
in the brain and spinal cord. The allele for having Tay-Sachs is recessive written as t
and the functional allele is written as T. If two heterozygous parents have four
children, how many of the offspring will most likely inherit and develop Tay-Sachs
disease?
Answers
Answer:
B and C
Explanation:
I just took the test and it was right
5 tips to improve your critical thinking - Samantha Agoos
Watch the Video and make a summary
Ps: They don't let me paste the link lookup what it says above
Answers
Answer:
that one is hard because we did not see the vidoe
Explanation:
The movement of water in or out of the cell membrane without the use of ATP.
Diffusion
Facilitated diffusion
Osmosis
Excoytosis
Answers
PLEASE HELP ME!!!
3) Describe a eukaryotic cell. Your description should include where you would expect to
find these types of cells.
4)Describe a prokaryotic cell. Your description should include where you would expect to
find these types of cells.
Answers
3)Eukaryotic cells have membrane-bound organelles. They have a nucleus. They are usually found in animals and plants. In all multicellular organisms and some unicellular(amoeba)
4)Prokaryotic cells don't have a nucleus. They don't contain membrane-bound organelles they only contain ribosomes.They are much smaller. Bacteria are prokaryotes.
plants Which part of the carbon cycle occurs when plants, trees, or fossil fuels are burned?
A. Transpiration B. Oxidation C. Photosynthesis D. Combustion
Answers
Set of 25 green plants and 25 mushrooms were put in a cool, dark room for two weeks. Each set was watered daily with 50 mL of a 0.1% fertilizer solution. Which statement best explains why the green plants died and the mushrooms survived?
Answers
Answer:
This question lacks options, however, it can be answered based on general understanding.
The green plant died because of absence of LIGHT
Explanation:
Plants (green) are autotrophic organisms i.e. organisms that are capable of synthesizing their own food via a process called PHOTOSYNTHESIS. However, on the other hand, mushrooms (kingdom FUNGI) are heterotrophic organisms i.e. rely on other organisms for energy source and cannot make their own food.
Green plants strictly require light energy from the sun in order to perform the process of photosynthesis. According to this question, a set of 25 green plants and 25 mushrooms were put in a cool, dark room for two weeks and watered daily with 50 mL of a 0.1% fertilizer solution. The green plants, despite the nutrients and regular watering dies because they were not exposed to LIGHT in order to make their food via photosynthesis. However, since light is not a requirement for mushrooms to obtain food, they will surely survive.
What do RNAs do in the cell?
Group of answer choices
Answers
Answer:
A wide range of functions are performed by RNA, from translating genetic information into molecular machines and cell structures to controlling gene activity during development, cellular differentiation, and changing environments.
Explanation:
None
someone pleaseee help me with this !!
Answers
This stuff annoying!!!!!!!!!!!!!!!!!!!!
Answers
wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink
Can a
Brain cell
Fat cell
Muscle cell
Red blood cell
Liver cell
Convert one type of fuel molecule to another
Answers
answer: yes
exanation:
Which is an example of the use of plants in human societs?
Answers
Answer:
|
v
Explanation:
photosynthesis creates oxygen, water and glocose(starch) and we take in those and use it in our mitochondrias to create atp so it can hapen all over again.
I'll give you a brainliest if is right or at least shows some effort
(thanks & i hope your having a good day)
In your own words, explain how background noise detected in space provides evidence for the Big Bang Theory.
Answers
Answer:
Celestial microwave radiation found a strange microwave signal causing background noise in the radio telescope. The signal came from every direction. The young universe would have been very hot. The microwave background radiation is the remaining heat from the Big bang.
I tried my hardest and this is what I put on MY test so good luck
1. Peer review allows others in the field to assess a scientist's investigations and results.
a. True
b. False
Answers
Answer:
False.
Explanation:
Peer review provide others scientist in the field to assess a scientist's investigations and results.
Peer Review:
It is the reviewing or evolution of the work by many professionals and experts in the field.
For example- A scienfic manuscript is send to the many scientist for evolution before publication.
This peer review is unbiased because the reviewer does not know the name or other information about writter.
To know more about Peer Review:
https://brainly.com/question/10853815
what is a cell membrane?
Answers
Answer:
The cell membrane is the semipermeable membrane of a cell that surrounds and encloses its contents of cytoplasm and nucleoplasm.
Explanation:
Answer:
Short. The semipermeable membrane surrounding the cytoplasm of a cell.
Long. The cell membrane is the semipermeable membrane of a cell that surrounds and encloses its contents of cytoplasm and nucleoplasm. The cell membrane separates the cell from the surrounding interstitial fluid, the main component of the extracellular fluid.
Explanation:
Adhesion occurs when water is attracted to other polar substances. Which of the following is an example of adhesion in organisms?
a. Capillary action of liquid in plant stems b. Release of sweat to reduce body heat
C. Movement of ions to maintain homeostasis
d. Pumping of blood through the circulatory system
Answers
Answer:
a. Capillary action of liquid in plant stems
C. Movement of ions to maintain homeostasis
d. Pumping of blood through the circulatory system
Explanation:
Hope this helped!
In organisms, an important example of adhesion is the: a. Capillary action of liquid in plant stems.
What is Adhesion?Adhesion can be described as the attraction that occurs between molecules as a result of molecular mechanism, which is also known as capillary action.
In plants, capillary action occurs when the molecules of water cling to the xylem cell walls. This is known as adhesion.
Therefore, an example of adhesion in organisms is: a. Capillary action of liquid in plant stems.
Learn more about adhesion on:
https://brainly.com/question/14457491
#SPJ2