Answer:
lysosome
Explanation:
It deals with food, and like a vacuum, stores things
A vacuum cleaner helps collect waste that is left behind on the floor. Some vacuum cleaners even suction up liquids. The vacuum cleaner could represent lysosomes.
What is lysosomes?Lysosomes are defined as membrane-enclosed organelles containing a variety of enzymes capable of degrading all sorts of biological polymers, including proteins, nucleic acids, carbohydrates, and lipids.
It can also be defined as sphere-shaped vesicles or sacs containing hydrolytic enzymes capable of breaking down nearly all types of biomolecules.
Lysosomes are hydrolytic enzyme-containing cell organelles. Hydrolytic enzymes can degrade undesirable cell components such as proteins, lipids, and carbohydrates, resulting in cell waste.
Vacuum cleaner is defined as a suction device used to remove dirt off floors, upholstery, drapes, and other surfaces It is usually powered by electricity.
Thus, a vacuum cleaner helps collect waste that is left behind on the floor. Some vacuum cleaners even suction up liquids. The vacuum cleaner could represent lysosomes.
To learn more about lysosomes, refer to the link below:
https://brainly.com/question/28202356
#SPJ2
which is NOT part of the cell theory?
A) all living thing a are composed of cells
B) Cells are the building blocks of germs
C) All cells come from other cells
D) Cells are the basic units of structure and function in living things
Answer:
B.
Explanation: Hope this helps! ^^
Answer 15 and 16 correctly and I will mark as brainliest
Answer:
I think its A and G
Answer:
15. B.
16. H
Explanation:
What is the difference between a molecule and a diagram of a molecule ?
Answer: The molecule itself is the actual thing present.
while the diagram explains what makes up a molecule or what it looks like structurally
Explanation:
rko vs claymore who will win
Answer:
claymore duh
Explanation:
Answer:
claymore
Explanation:
16. In which of the following situations are the phenotypes of F2 offspring expected to follow
the ratio of 9:3:3:1?
a. monohybrid cross for two unlinked traits
b. a monohybrid cross for two closely linked traits
c. a dihybrid cross for two unlinked traits
d. a dihybrid cross for two closely linked traits
Answer:
C
Explanation:
The F2 offspring of a cross would follow the ratio of 9:3:3:1 only if the cross is a dihybrid for two unlinked traits.
There is nothing like a monohybrid cross for two traits. A cross involving two traits is a dihybrid cross. Hence, options a and b are out of the equation.
A dihybrid cross for two closely linked traits would produce F2 offspring in another ratio that is different from 9:3:3:1 depending on the linkage map.
Hence, the correct option is C.
What is the definition of a DNA Polymerase
A. Enzyme involved in DNA replication that joins individual nucleotides to produce a DNA molecule
B. An enzyme that unwinds the DNA double helix during DNA replication
C. A class of nucleotides that includes adenine and guanine.
D. A bond between complimentary base pairs in DNA
What are the three main classifications that describe galaxies? By what one visible
characteristic do scientists categorize galaxies?
Answer:
Spiral Galaxies, Elliptical Galaxies & Irregular Galaxies
Explanation:
How did galaxies originate? Astronomers believe that after the big bang, the explosion which began the universe 10 billion to 20 billion years ago, gravity began to compress masses of free-floating gas. Two main theories, bottom-up and top-down, explain what happened next. According to bottom-up theories, clusters began to form and assembled together into the larger units we know as galaxies. Top-down theories suggest that galaxies formed first, and the stars and other objects within them were subsequently produced. They categorized different galaxies to maintain their tests from the other galaxies.
MULTIPLE CHOICE QUESTION
Why do scientists think that cuttlefish
have the biggest brain to body ratio of all
invertebrates (animals without a spine)?
Answer:
Due to its high intelligence.
Explanation:
Scientists think that cuttlefish have the biggest brain to body ratio of all invertebrates that allows it to sense sight, smell, and sound that comes to it in the form of pressure waves. Due to this big brain, cuttlefish are very intelligent so due to its intelligence the scientists thinks that cuttlefish has the biggest brain as compared to other big vertebrates such as octopus.
What environment does ambulocetus live in?
Answer:
northern Pakistan, in long-lost coastal shallow seas and brackish rivers
Explanation:
i'm hoping this is right
Identity Factors in an Experiment
WARM-UP
Consider what you already know about scientific design. To set up an experiment testing whether
students' grades are affected by their level of exercise, which factors do you think you would need to keep
in mind? Check all that apply.
student gender
vpe of exercise
amount of exercise
what grades are measured
how long the experiment will last
what time of day the students exercise
how much time the students spend studying
DONI
Answer:
Did you copy and paste this from somewhere because i want to help but i don't understand it at all.
Explanation:
Can someone please help me I don't understand the and my parents don't under please
432hz x 432hz = 2228
Explanation:
the simple explanation is shushh
Electron transport from complex I to complex IV pumps more protons than transport from complex II to complex IV.
With this in mind, which will produce more ATP
A. Transport from complex I produces more ATP.
B. Transport from complex II produces more ATP.
C. Both produce the same amount of ATP.
Answer:
A
Explanation:
ATP synthase uses a proton gradient to make ATP. Since transport from complex I creates a larger proton gradient, it also produces more ATP.
Electron transport from complex I produces more ATP.
ELECTRON TRANSPORT CHAIN:
The electron transport chain, ETC, is the third and last stage of aerobic cellular respiration. It produces the highest molecules of ATP in cellular respiration. The ETC involves the transfer of electrons to series of molecules in order to create an electrochemical gradient needed for ATP synthesis. The electron transport chain is made up of four complexes namely: Complex I, II, III and IV. NADH and FADH2 produced in the Krebs cycle are the electron carriers. Complex I pumps more hydrogen ions (H+) from the mitochondrial matrix to the intermembrane space. Since the pumped is directly related to the number of ATP molecules, complex I will produce more ATP molecules.Learn more: https://brainly.com/question/442662?referrer=searchResults
when an experiment shows that two variable are closely related the experiment shows what
Answer:When an experiment shows that two variables are closely related, the experiment shows correlation between the two variables. Correlation helps to show how two variables are related and connected. Related variables are said to be correlated. For example, we can say, good health is correlated to daily exercise routine.
Explanation:
decode CCGCTTTCGCTATTATAAAAAGGGCTATAACTA
Answer:
GGCGAAAGCGAUAAUAUUUUUCCCGAUAUUGAU. I think sorry if I'm wrong
The function of mitochondria and chloroplasts is related to energy. In what way does their function differ?
A.
Mitochondria produce energy in prokaryotic cells, while chloroplasts produce energy in eukaryotic cells.
B.
Mitochondria produce energy from food, while chloroplasts produce food from the Sun’s energy.
C.
In plants, mitochondria provide energy in non-green cells, while chloroplasts provide energy to cells in parts of the plant that are green.
D.
Mitochondria provide energy in the night, while chloroplasts provide energy in the day.
E.
Mitochondria provide energy from food synthesized by organelles other than chloroplasts, while chloroplasts provide energy through photosynthesis using the Sun’s energy.
Answer:
The answer is option E- Mitochondria provide energy from food synthesized by organelles other than chloroplasts, while chloroplasts provide energy through photosynthesis using the Sun’s energy.Explanation:
How do I calculate a heart rate?
Explanation:
To check your pulse at your wrist, place two fingers between the bone and the tendon over your radial artery — which is located on the thumb side of your wrist. When you feel your pulse, count the number of beats in 15 seconds. Multiply this number by four to calculate your beats per minute.
1. What is the pH range for an acid?
A. 0 - 7- 14
2. What is the pH range for a base
A. 0 - 7- 14
3. What are the products of an acid base reaction?
A. water and salt
B. acid and base
C. water and sugar
D. water
4. What substance has a neutral pH?
A. ammonia
B. water
C. sodium bicarbonate
D. vinegar
5. The negative ion found in bases is the ______________
A. hydrogen ion (H+)
B. hydroxide ion (OH-)
Answer:
0-7-14
0-7-12
c is correct water and suger
d is correct vinegar
b is correct (OH-)
explain how the equilibrium price is determined
Answer:
The equilibrium price is the price at which the quantity demanded equals the quantity supplied. It is determined by the intersection of the demand and supply curves. .
A decrease in demand will cause the equilibrium price to fall; quantity supplied will decrease.
Explanation:
When covalent bonds form. the amount of energy present decreases. What happens to the stability of the atoms in the bond?
At which type of technonic plate boundary is a volcano least likely to occur
Answer: A
coz its just sliding one another
Hope it is correct
^_^
Look at the graph below. A graph is shown with Absolute magnitude shown on y axis and Surface temperature in degree Celsius shown on x axis. The Dwarf stars are shown along a slanting line from coordinates 30,000 and minus 3 to 10,000 and minus 4. The Main Sequence stars are shown along a slanting line from coordinates 20,000 and minus 2 to 2,000 and minus 6. The giants are shown along a line parallel to the x axis from coordinates 5,000 and 2 to 2,000 and 3. The supergiants are shown along a line parallel to the x axis from coordinates 7,500 and 4 to 2,500 and 4. Point A has coordinates 20,000 and minus 4. Point B has coordinates 2,500 and minus 4. Point C has coordinates 5,000 and 2. Point D has coordinates 7,000 and 4. Which of the following stars is most likely to be red? Star A Star B Star C Star D
Answer:
Star A
Explanation:
If you look directly at the diagram, the dwarf stars are labeled under 'A' and are the least in mass and temperature.
Being the smallest and coldest, dwarf stars most commonly have red coloration, which would make them the obvious choice.
Star A which is a dwarf star has the coldest temperature, and therefore is a red star since red stars are the coldest stars.
What are stars?Stars are a large self-luminous bodies whichbpriducw large amounts of heat energy and light energy as a result of the nuclear reactions occurring within them.
Stars have different colors and different sizes.
Red stars are the coldest stars and also the least massive.
From the chart, Star A which is a dwarf star has the coldest temperature, and therefore is a red star.
Learn more about red stars at: https://brainly.com/question/11562269
#SPJ2
biological macromolecules are organized into four main categories. What type of macromolecule contains phosphorus as part of a phosphate group?
1.) lipids
2.) proteins
3.) nucleic acid
4.) carbohydrates
Answer:
3.) nucleic acid
Explanation:
Biological macromolecules can be defined as a very large molecule (structure) that comprises of covalently bonded organic atoms and smaller molecular structures (monomers).
Biological macromolecules are organized into four main categories and these includes;
I. Lipids: these categories of biological molecules is mainly made up of fats and it is responsible for providing the body with long-term energy.
II. Carbohydrates: it is contained in energy-giving foods and it aids the functioning of the muscles, nervous system and other organs found in the body.
III. Proteins: it contains amino acids and it is responsible for maintaining the functioning of the body system.
IV. Nucleic acid: it comprises of deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) which are the genetic codes (blueprints) for living organisms.
Hence, the type of macromolecule that contains phosphorus as part of a phosphate group (sugar 2-deoxyribose) is nucleic acid.
From the biological macromolecules, Nucleic acids contains phosphorus as part of a phosphate group.
Nucleic acids are biopolymers, macromolecules, crucial for all known types of life. Nucleotides, which are the monomer components, make up their structure. a sugar with five carbons, a phosphate group, and a base with nitrogen. Deoxyribonucleic acid and ribonucleic acid are the two main types of nucleic acids.
Deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) are two types of nucleic acids that carry genetic information that is read by cells to create the RNA and proteins that allow living things to function.
Know more about nucleic acids:
https://brainly.com/question/11737667
#SPJ6
.
Why are some sources of sugar better than others?
Explanation:
[tex]\huge{\underbrace{\overbrace{\mathfrak{\pink{Answer:❣}}}}}[/tex]
Whether an added sugar contains more or less fructose versus glucose has little impact on health. (An exception may be people with diabetes who need to control their blood glucose, in which case a higher-fructose, lower-glucose sugar may be preferable
Answer:
Some sugar that's made is usually take and unhealthy, but other sources can be purely made with no artificial s added to it making it fake.
Explain which processes take place during meiosis that lead to variation in inherited traits.
Answer:
We are left with four haploid cells; each one genetically different from each other and the parent cell. 8. Describe the three ways meiosis produces genetic variability. We have seen that meiosis creates variation three ways: crossing over, mutations caused during crossing over, and independent assortment.
list one part of the cell theory in your own words, explain what it means
One part of the cell theory is that pre-existing cells can form more cells
This means that cells that currently exist are capable of creating more cells, however it’s a slow process
multiple choice
Daytime temperatures on Mercury are extremely hot because:
1. it is close to the sun
2. it has long days
3. one side is facing the sun
4. it gives off internal heat
5. there are volcanoes
Answer: it has long days
Explanation:
Select the correct bisector of the segment.
B
A
B
B
B
А
M
B
B
D
Answer:
C
Explanation:
it has the example figure number 7 and also it has the correct bisector
What process in humans is a good representation of asexual reproduction?
A. Meiosis
B. Mitosis
C.Fertilization
Answer:
B.
Explanation:
What is a constant?
O a variable
a number that stands alone with no variable
O the number in front of the variable
O two terms that look exactly the same
need help please
Answer:
a number that stands alone with no variable
Hope this helps!
Why most foods needs to be digested? Give at least 3 reasons
Answer:
Why most foods needs to be digested? Give at least 3 reasons.
Explanation:
Foods must be digested cause of the following reasons:
1. To get energy the food must be digested.
2. To provide nourishing vitamins and minerals to our body.
3. You will be affected by some diseases if you didn't digest your food.