a triangle has a base of 15 feet and height of 9.5. what is the area of the triangle

Answers

Answer 1

Answer:

71.25ft

Step-by-step explanation:

A=hbb

2=9.5·15

2=71.25ft²


Related Questions

The length of a rectangle is 5 less than 3 times its width. The perimeter is
78. Find the LENGTH.*

Answers

Answer:

The length is 28 and the width is 11

Step-by-step explanation:

To solve this problem, we can make the width as x.

Since the length is 5 less than 3 times the width, it's going to be 3x - 5

So now we've got the length and width, just need to find the perimeter, which is all the sides added up together. They already gave us the perimeter, so we just have to solve the equation:

2(3x - 5) + 2x = 78

6x - 10 + 2x = 78

8x - 10 = 78

8x = 88

x = 11

x = 11, but remember, x is the width, not the length. Since we already found what x is, we just have to plug it into the equation of:

3x - 5

3 × 11 - 5

33 - 5 = 28

Answer: Length = 28 (don't forget to add the unit if there is one)

p = mv Which equation shows the formula correctly solved for v? O A. V=p-m B. v=pm O C. v= m р O D. V ora​

Answers

Answer:

v=p/m

Step-by-step explanation:

Divide poth side by m

So the answer will be v=p/m

back to 6th grade learning stuff! Please help me

Answers

Answer:

1. 4

2. 20

3. 80

Step-by-step explanation:

  Brainliest? I only need one more. Lol

Help pls I’m getting timed

Which algebraic expression represents "a number divided by nine"?
9 + a

9/a a/9

Answers

Answer:

a/9

Step-by-step explanation:

Tell whether each function is linear or nonlinear. Use the drop-down menus to show your answer.

Answers

function a is non linear while function b is linear

explanation: for function a, y is increasing at a non linear rate (not consistent)

What is the graph of y = 3jx|?
Ο Α.
5
>

Answers

Note: Your question sounds a little unclear and incomplete. I assume you want to get the idea about the graph of 3|x|. My answer may still clear your concept about the graphs.

Answer:

The graph of y=3|x| is attached below.

Step-by-step explanation:

Given the function

[tex]y=3\left|x\right|[/tex]

Determining the domain:

We know that the domain of a function is the set of input or argument values for which the function is real and defined.

The function has no undefined points nor domain constraints. Therefore, the domain is:

[tex]-\infty \:<x<\infty \:[/tex]

Determining the range:

We also know that the range of a function is the set of values of the dependent variable for which a function is defined.

[tex]\mathrm{The\:range\:of\:an\:absolute\:function\:of\:the\:form}\:c|ax+b|+k\:\mathrm{is}\:\:f\left(x\right)\ge \:k[/tex]

[tex]k=0[/tex]

[tex]f\left(x\right)\ge \:0[/tex]

Thus,

[tex]\mathrm{Range\:of\:}3\left|x\right|:\quad \begin{bmatrix}\mathrm{Solution:}\:&\:f\left(x\right)\ge \:0\:\\ \:\mathrm{Interval\:Notation:}&\:[0,\:\infty \:)\end{bmatrix}[/tex]

Determining the x-intercept and y-intercept:

From the graph, it is clear that at x=0, y=0. Therefore, the y-intercept is (0, 0)From the graph, it is clear that at y=0, x=0. Therefore, the y-intercept is (0, 0)

The graph of y=3|x| is attached below.

Write an equation of the line passing through the points (4,15) and (-1, 15)​

Answers

Find slope: (15-15)/(-1-4) = 0/-5 = 0
Y = 0x + b
15 = 0(4) + b, b = 15
Equation: y = 0x + 15
Or... y = 15

At a dinner, the meal cost $22 and a sales tax of $1.87 was added to the bill.

How much would the sales tax be on a $66 meal?
What is the tax rate for meals in this city?
PLEASE HELP

Answers

Answer:

$5.61 if I am not mistaken

Step-by-step explanation:

Let me know if I am wrong.

Sorry if I am.

Answer:

$5.61

Step-by-step explanation:

Help me pls ASAP thank you

Answers

Answer:

3rd option

Step-by-step explanation:

The input(x) does not repeat

Find p(4) p(x) = 3x - 9

Answers

Answer:

p(4)=3

Step-by-step explanation:

p(4)=3(4)-9=12-9=3

find the slope from the graph. (3,-1) (0,-3)

Answers

I found the slope for these numbers

Is -4 a real number? Is -4 a whole number?

Answers

Answer:

-4 is a real number, but not a whole number.

All non zero numbers are real.

All numbers without a decimal, fraction, or negative are whole numbers.

Step-by-step explanation:

Answer:

Yes -4 is a real number. No, -4 is not a whole number.

Step-by-step explanation:

Real numbers include all positive and negative numbers. A whole number is any number that does not contain a fraction, decimal, or negative value.

Describe the transformation.

* Dilation with a scale factor of 1⁄2
* Dilation with a scale factor of 2
* Dilation with a scale factor of 3
* Dilation with a scale factor of 4
* none of the above

Answers

Answer:

Dilation with a scale factor of 2

Answer:

* Dilation with a scale factor of 2

Step-by-step explanation:

B is my answer

What is the y-intercept of the graph?

Answers

Answer:

4

Step-by-step explanation:

What is the y-intercept of the graph?
The y-intercept is 2

Consider the table for f(x) and the graph for g(x). Which statement is true when comparing the y-intercepts of the functions?
A) The y-intercept for f(x) is greater than the y-intercept for g(x).
B) The y-intercept for both functions is (0,0).
C) The y-intercept for g(x) is greater than the y-intercept for f(x)
D) The y-intercept for both functions is (0, 2).​

Answers

Answer:

Should be C

Step-by-step explanation:

The y-intercept for f(x) is greater than the y-intercept for g(x). Therefore, option A is the correct answer.

What is a y-intercept?

In Maths, an intercept is a point on the y-axis, through which the slope of the line passes. It is the y-coordinate of a point where a straight line or a curve intersects the y-axis. This is represented when we write the equation for a line, y = mx+c, where m is slope and c is the y-intercept.

From the table, we have the coordinates (-2, 0) and (-1, 1).

Here, slope (m)=(1-0)/(-1+2)

m=1

Substitute m=1 and (x, y)=(-2, 0) in y=mx+c, we get

0=1(-2)+c

c=2

From the graph y-intercept is c=1

Therefore, option A is the correct answer.

To learn more about the y-intercept visit:

brainly.com/question/14180189.

#SPJ2

ASAP plss
An amusement park is holding a contest for people who are in line before 7 AM. The 42nd person in line winds free admission, and so do the six people before and after that person. Which graph could be used to determine the winners?

Answers

Answer: Bottom left

Step-by-step explanation:

Can you please help me with this question?​

Answers

Answer:

Reflection over the y-axis and a translation down two units

Step-by-step explanation:

You can see that the corners of the triangle have been vertically reflected because of their orientation and then you have to think about what that would look like and decide what else was done to the object. With this, we can tell that the object moved down 2 units.

I WILL GIVE BRAINLIEST!!!!
The following figures give the distribution of land (in acres) for a county containing 67,000 acres. Identify each category on the circle graph. Land Use Acres Relative Frequency Forest 10,050 0.15 Farm 6700 0.10 Urban 50,250 0.75 A circle graph titled Land Use. Blue is about 75 percent; green, 15 percent; red, 10 percent. a. Farm - Blue - 75% Forest -Green - 15% Urban - Red - 10% c. Forest - Blue - 75% Urban - Green - 15% Farm - Red - 10% b. Urban - Blue - 75% Forest - Green - 15% Farm - Red - 10% d. Forest - Blue - 75% Farm - Green - 15% Urban - Red - 10% Please select the best answer from the choices provided A B C D

Answers

Answer:

c

Step-by-step explanation:

its c on edge

What is an equation of the line that passes through the point (-2, 2) and is parallel to the line 2x + y = 1?​

Answers

2x+y=1 is in standard form so we will convert it to slope int form by subtracting 2x

y=-2x+1

the line we are finding the equation for is PARALLEL to this line here so the slope is the same

for the line’s equation we will put it in point slope form. y-y1=m(x-x1)

y-2=-2(x+2) is the answer!

An equation of the line that passes through the point (-2, 2) and is parallel to the line 2x+y=1 is y=2x+6.

Given that, the equation of a line is 2x+y=1 and the coordinate point is (-2, 2).

What is an equation of the line?

The equation of line is an algebraic form of representing the set of points, which together form a line in a coordinate system. The numerous points which together form a line in the coordinate axis are represented as a set of variables x, y to form an algebraic equation, which is referred to as an equation of a line.

In the equation of a line 2x+y=1, slope is 2.

As we know the slopes of parallel lines are equal, that is m1=m2.

Now, put (-2, 2) and m=2 in y-y1=m(x-x1) and simplify.

That is, y-2=2(x+2)

⇒ y-2=2x+4

⇒ y=2x+4+2

⇒ y=2x+6

Therefore, an equation of the line that passes through the point (-2, 2) and is parallel to the line 2x+y=1 is y=2x+6.

To learn more about an equation of the line visit:

https://brainly.com/question/14200719.

#SPJ5

Anna sells candy apples at her yard sale. She wants to earn more than $40. She sells the apples for $2 and has earned $26. How many apples does she need to sell to reach her goal?

Answers

Answer:

7 apples

Step-by-step explanation:

40 - 26 = 14

14 / 2 = 7

5^4+4^5 please please pleaseee need it ASAP for missing assignments

Answers

Answer: 1649

Step-by-step explanation:

Answer:

1649

5×5×5×5 + 4×4×4×4×4

Which graph represents a nonlinear function?​

Answers

Answer:

It's the second one :) I think?

it’s the second one, nonlinear functions are curved, linear functions are straight.

A garden table and a bench cost $804 combined. The garden table costs $54 more than the bench. What is the cost of the bench?

Answers

Answer:

its 750

Step-by-step explanation:

because its 804 combined and 804-54=750 and 750+54=804

750 I agree with the other person

You are eating a slice of pizza that has 391 calories in it. Each time you dip the pizza into ranch dressing, though, you add 7 calories to the total. If your meal wound up being 454 calories in total, how many times did you dip the pizza into ranch dressing? I don't get it

Answers

Answer:I think it is about 55 times

Step-by-step explanation:

Answer:

9 times

Step-by-step explanation:

The pizza has 391 calories in it, and everytime you dip it into ranch, you add 7 calories to the 391.

454(calories in total) - 391(calories in the pizza)= 63

63 ÷ 7(calories everytime you dip into ranch) = 9

Please answer A.S.A.P.!!!!

Malcolm is trying a very low-carbohydrate diet. He would like to keep the amount of carbs consumed in grams between the levels shown in the following compound inequality:

50 50; Malcolm needs to consume less than 20 grams of carbohydrates or more than 50 grams of carbohydrates.

B) x > 20 and x 30 and x 60; Malcolm needs to consume less than 30 grams of carbohydrates or more than 60 grams of carbohydrates.

Answers

Answer:

x > 20 and x < 50; Malcolm needs to consume more than 20 grams of carbohydrates, but less than 50 grams of carbohydrates.

Step-by-step explanation:

What is the slope? (1,7) (15,14)

Answers

Step-by-step explanation:

y2-y1/x2-x1

15-1/14-7

14/7

=2

sorry for spamming but may i get help on this last one

Answers

Answer: x = -6

Step-by-step explanation:

Since 2 angles have to equal 180, you add both of the angles you see and figure out what that answer is

101+91=192

192 - x - x

192 - 6 - 6 = 180

Answer: x=-6

Step-by-step explanation:

They are supplementary angles so both measures = 180. So x+91+x+101=180. 2x+192=180. 2x=-12. X=-6

Based on the spinner shown, what is the probability of the next spin landing on an even
number?

Answers

Answer:

The probability is about 60%

Answer:

60%

Step-by-step explanation:

even numbers =6

spinner=10

6/10=3/5

3/5 x 100

=60%

Will mark brainliest who ever answers first !!!

Please help

Answers

I believe the answer is x=-2

Jim wanted to find out what the audience thought about the debate. After the event, Jim stood at the exit to survey every fifth guest. Was this a random or a biased sample and why?

Answers

Answer: D. This was a random sample. It may have included anyone in attendance.

Step-by-step explanation:

The options are:

A. This was a biased sample. Jim should interview all in attendance.

B. This was a census. Any guest may have participated.

C. This was a random sample. It may not have included anyone in attendance.

D. This was a random sample. It may have included anyone in attendance.

A random sampling is simply referred to as a subset of individuals that are picked from a larger set of individuals.

With regards to the question, Jim wanted to find out what the audience thought about the debate and after the event, he stood at the exit to survey every fifth guest.

This means that it was a random sampling and anyone could have been picked, the sampling wasn't bias.

Other Questions
Harder equationsSolve these equations:3x + 3 = -6. X= in the french and indian war, list 3 reasons why each side decided to go to war in 1754. The map shows ancient and modern cities in the Indian subcontinent. A map titled Ancient and Modern Cities on the Indian Subcontinent. A key shows Ancient Indian civilizations with yellow dots and Modern Indian cities with purple dots. There are groups of yellow dots near the western coast and along rivers in the western region. The modern Indian cities of Mumbai and Chennai are along the coastline with Kolkata and New Delhi near rivers. How do the locations of modern cities on the Indian subcontinent compare to the locations of ancient cities? Both are located on inland plains. Both are located along water sources. Both are located along the Bay of Bengal. Both are located far from the Ganges River. A prime number has two factors, itself and 1? * AABB Rhythm poem christmas themed. pls can you make 3 stanza of AABB poem. pls help me what is the role of the grana in chloroplast? Which of the following will NOT help reduce the costs of car ownership? A. Carpooling and safe driving B. Performing maintenance tasks on your own C. Speeding D. All of the above 5TH GRADE LEVEL QUESTION: look at photo and answer. A school has 617 students. Each class has between 28 and 32 students. Which is the best estimate of the number of classes in the school?14 classes20 classes30 classes60 classes Whats the corresponding mRNA strand for this DNA strand: TACGGGATAAGGCCACCTCTGGTAGACCACATT Think about a game you've played recently, a program you've interacted with, or an application you've recently used. Explain how the programmers for that software used multiple data types as variables. Your discussion should cover logical types, string variables, and at least one type of numerical variable. Please select the correct conjugation of the verb llamar ("to call") togo in the blank.Yoa sus nios por telfono.llamallamollamasllamamosFill in da blank 20 POINTS!!!!!!Which of the following is probably not an effect of urban sprawl?A. the loss of habitats and biodiversityB. decreased shortages of water and other resourcesC. increased temperatures in summer monthsmore air pollution that is harmful to human healthPlease select the best answer from the choices providedABCD GMMThe numbers are36XAnd 46 degrees QUESTION 10 of 10: You have a need to purchase 30 units of a product and have them delivered to your company in five days. The sale price is $35 each. Sales tax on the product is 8%. Shipping price is $15. But there is also a 25% rush charge on the sales price added for deliveries less than seven days, which is also taxable. What will be the total cost of this purchase? O a) $1,050.00 b) $1,327.50 Oc) $1,396.50 O d) $1,432.50 A 12 N net force is applied to an object as it moves a distance of 3.0 m: Use theWork-Kinetic Energy Theorem to determine the object's change in kinetic energy.Enter your answer in Joules. plz help i need help im failing 50 POINTS PLZ HELP MEEEE Two moles of neon gas at 25oC and 2.0 atm is expanded to 3 times the original volume while the pressure is reduced to 1.0 atm. Find the end temperature.A. 447 CB. 174 CC. -66 CD. 38 CE. 150 C Simplify as far as possible.182