A student was asked the following question on her biology final exam
question : how do organisms grow in size
her answer : “organisms grow in size when the cells within the organism grow larger. As the cells grow larger the organism grows larger as well
Explain why her answer is not correct then explain how she should have answered the question

Answers

Answer 1
The cell can grow large but not the organisms. Once the cell is growing the organisms grow smaller. I think hope it correct

Related Questions

Which is a major factor that limits cell growth?

Answers

Answer:

ratio of surface area to volume

Explanation:

rates of protein synthesis, and determined by surface area

What type of energy found within every moving object?

Answers

Answer:

Kinetic Energy

Explanation:

Which option percent of valid hypothesis in the correct form?
A if a cotton plant receives 100 ml of water ever day it will display steady growth
B if cotton plant need consistent amount of water to grow steadily than the cotton plant that receives 100 mL of water Everyday Will displayed study group
C if a cotton plant needs a constant amount of water to grow steadily than a contact that displays Teddy Grove and you will receive a hundred mL of water every day
D the cotton plant displays steady growth it will receive 100 ml of water every day

Answers

The answer to the question is possibly A

What is happening to the cell in diagram B?

Answers

Answer:

Explanation:

B

Answer:E

Explanation:


Please help me with these

Answers

those are nucleotides

since all three of them contain deoxyribose (because there's only one hydroxil group) they are DNA nucleotides

the first nucleotide has cytosine as it's nitrogenous base

the second nucleotide has adenine as it's nitrogenous base

the third nucleotide has thymine as it's nitrogenous base

(PLEASE HELP I WILL MARK BRAINLEST) Limestone is a sedimentary rock and marble is a metamorphic rock. Despite limestone and marble having the same chemical makeup, which statement describes why they are classified as different rocks?

They formed at different times.

They were formed from different fossils.

They were formed by different methods.

They formed in different amounts of time.

Answers

Answer:

The were formed by different methods

They were formed by different methods is the statement that describes that limestone and marble are classified as different rocks.Therefore, the correct option is C.

What is limestone?

Limestone is a sedimentary rock primarily made up of calcium carbonate (CaCO3) in the form of the mineral calcite. It is formed from the accumulation of shells, coral, and other debris from marine organisms.

Marble is a metamorphic rock that forms from limestone, which is a sedimentary rock composed primarily of calcium carbonate (CaCO3). It is formed through a process of metamorphism, which involves the transformation of the original rock through heat and pressure over time. Therefore, the correct option is C.

Learn more about limestone, here:

https://brainly.com/question/11726100

#SPJ3

The question is incomplete, but most probably the complete question is,

Limestone is a sedimentary rock and marble is a metamorphic rock. Despite limestone and marble having the same chemical makeup, which statement describes why they are classified as different rocks?

A. They formed at different times.

B. They were formed from different fossils.

C. They were formed by different methods.

D. They formed in different amounts of time.

In a series of rock layers, where do you find the oldest layers? Explain why?
Your answer
Please helppp meh!!

Answers

Answer:bottom

Explanation:

how is groundwater impacted by urban sprawl?

Answers

Answer:

Urbanization causes changes to the land surface by altering to- pography and vegetation, increasing shallow groundwater tempera- tures.

raising or lowering water tables, and extraction of groundwater during or after construction.

Explanation:

Have A great one!

Which organism can convert light energy into chemical energy?
A. alga
B. mushroom
C. paramecium
D. hydra

Answers

Answer:

I think the answer is A but i'm not sure if this is correct hope the explanation part helps

Explanation:

Photosynthesis is the process by which organisms that contain the pigment chlorophyll convert light energy into chemical energy which can be stored in the molecular bonds of organic molecules (e.g., sugars).

The recessive gene for blood typing s...
Type O
Type A
Type B
Type AB

Answers

Answer:

Image result for what is The recessive gene for blood typing

Because A is dominant, that means your mother could carry a hidden O. If she does then when she gets pregnant, each child has a 50% chance of getting her dominant A and a 50% chance of getting her hidden, recessive O. If the child gets the O from mom and an O from dad, he or she will have an O blood type.

Explanation:

Brainliest if right?

What are some environmental indicators?

Answers

Biological diversity, food production, average global surface temperature and carbon dioxide concentrations in the atmosphere

When humans breed organisms, they are selecting variations that occur naturally in populations.
True or false ?

Answers

Answer:

TRUE!!!

Explanation:

Artificial selection, often known as "selective breeding," is when people choose animals or agricultural products based on desirable features, hence it is a true statement.

What is Artificial selection?

Different phenotypes can be introduced into an organism via genetic changes that change gene activity or protein function.

Natural selection is the process of identifying advantageous traits in plants and animals and taking actions to improve and perpetuate those traits in subsequent generations.

If a trait is advantageous and aids an individual in surviving and reproducing, the genetic variation is more likely to be passed to the next generation.

Therefore as opposed to letting the species evolve naturally without human intervention, as in the natural selection, hence it is a true statement.

Learn more about selection, here:

https://brainly.com/question/1306974

#SPJ2

Gravitational force multiple choice

Answers

Answer:

Option B. The force would be quartered (factor of 1/4).

Explanation:

The gravitational force between two objects can be expressed with the equation:

By analyzing the equation, we can see that if we multiply both m1 and m2 by 1/2, the resulting new F would be lower by a factor of 1/4 (as 1/2 times 1/2 equals 1/4).

Thus the correct answer is option B.

PLEASE HELP!!! Thank you so much!!

Answers

Answer:

math

Explanation:

hhaha

“Fish and other wildlife become unhealthy and die without __________.”

Oxygen
Carbon Dioxide
Eutrophication

(This is 7th grade science)

Answers

Answer:

Oxygen

Explanation:

Andwer is oxygen if not then eutrophication

Maribel brings her backpack to the lab. She is also given a set of lab materials. What is the safest way for Maribel to organize these items in a lab?

Answers

Answer:

The personal items should be off the table, and the lab materials should be placed neatly away from the edge of the table.

Explanation:

It is given that Maribel goes to the lab with her backpack and she is given the lab materials to be used inside the lab to perform her experiment.

Now Maribel in the lab before doing her experiment must keep the personal items like her backpack off the working table and the lab materials are should be kept away from the edge of the table otherwise it might fall accidentally and hurt her.

One needs to be very careful while in the laboratory. One should follow the safety procedures to remain safe and also ensure safety of others. Being unsafe and disorganize can hurt others and can cause harm to others. There are various equipment and chemical in the lab. Therefore one should be careful while working in the lab.

Light-dependent and light-independent reactions occur at the same time. True or False

Answers

true  because they are driven by the ATP made by the light-dependent reactions. Both systems shut down in the dark. The light-independent reactions can last a little longer if there is ATP remaining in the chloroplast.

DNA analysis has little to offer from forensic science
true or flase​

Answers

Answer:

DNA analysis has little to offer forensic science is false.

Explanation:

DNA may be found on the handle or tip of a baseball bat if it is used in a crime. The evidence is used for DNA analysis

How is the Grand Canyon related to volcanic activity?

Answers

In the western Grand Canyon hundreds of volcanic eruptions occurred over the past two million years. At least a dozen times, lava cascaded down the walls of the Inner Gorge, forming massive lava dams that blocked the flow of the Colorado River. ... 1064 a series of eruptions built the park's namesake cinder cone.

hope this helps ^^

Answer:

In the western Grand Canyon hundreds of volcanic eruptions occurred over the past two million years. At least a dozen times, lava cascaded down the walls of the Inner Gorge, forming massive lava dams that blocked the flow of the Colorado River.

Explanation:

it takes 25 min to cook 10 egg how long does it take to cook 20​

Answers

Answer:

it takes 50 min

Explanation:

20 is twice of ten so if it take 25 min to cook ten then it is 50 min to cook 20.

Work for it:

10 x 2 = 20

10 eggs=10 min

25x2=50

Answer:

it takes 50 minutes to cook 20 eggs

Explanation:

ok first you have to see how long it takes 1 egg to cook so 25/10=2.5minute an egg then u multiply 2.5 x 20=50

hope this helps

What are some of the things that Vincent had to do to enhance his genetic
"imperfections?" so that he looked like the real Jerome? GATTACA

Answers

Answer:

Lengthen his legs and straighten his teeth.

Explanation:

Vincent had done surgery to lengthen his legs and straighten his teeth in order to enhance his genetic  imperfections because he has short legs and improper teeth. He also had some other diseases such as heart disorder, neurological disorder, manic depressive and attention deficit disorder. These disorder can't be cure because it occur to him genetically.

The _________________ is the hereditary material of the cell made up of sequences of four nucleotides arranged in linear strands called chromosomes.

Answers

Answer:

DNA

Explanation:

The answer is DNA. It belongs to a class of molecules called the nucleic acids, which are polynucleotides(long chains of nucleotides)

Hope this helped :)

A cell membrane is called _____________ because it allows only certain substances to enter and leave the cell *

a. exocytosis
b. endocytosis
c. semipermeable
d. diffusion

Answers

The answers is semi permeable hope this helps

You added 20 g of NaCl to 100 g of water. What is the percent by mass of the solute?

Answers

Answer: We are given:

Mass of solvent (water) = 100 grams

Mass of solute (NaCl) = 20 grams

Mass of the Solution:

Mass of Solution = Mass of Solute + mass of Solvent

100 + 20 = 120 grams

Mass Percent of NaCl:

We know that

mass percent of NaCl = (Mass of NaCl / Mass of Solution) * 100

replacing the variables

Mass% of NaCl = (20 / 120)*100

Mass% of NaCl = 100 / 6

Mass% of NaCl = 16.67%

Explanation:

trna is bring a ggu anticodon what amino acid do you infer it will be carrying?

Answers

Proline

This is the amino acid that corresponds to GGU

Please help worth 95 points. Project: Algae Cultures: Directions
In this report, you will be researching the different types of algae. Report on one algae from each of the three categories (blue-green, green, and green-brown). Include the following information: Name of the algae, Category if falls under, Where it is mostly found and what conditions it needs to survive, Whether it is unicellular or multicellular, Where in the food chain algae are, and what predators it may have, Research why some scientists think algae should be classified plants, and explain the debate.

1.Which organisms did you identify 2. How easy or difficult was it to find an example of each category? Which one was the hardest to find? Why? 3. Which environments were most common to find algae in? Why do you think so? 4. What part of the food chain is the alga? 5. Why is algae classified in the Protist Kingdom and not the Plant Kingdom even though they are photosynthetic? Research why scientists feel they should be classified as plants.

Answers

Answer:

1) I identified the Golden-Brown Algae.

2)  It was very easy to find the category because of the solid color base and because it only had the daitoms. It did not have multiple like the Green Algae and the Blue-Green Algae.

3) In fresh, brackish or salt water. They are found both in tropical lakes and seas, and in the alpine and polar snows. They are unicellular or multicellular protist plant organisms, whose cells do not form tissues and lack flowers. They are considered the first link in the food chain in the aquatic environment. They are found in fresh, brackish or salt water. They are primary producers in the food chain, capable of producing organic substances through photosynthesis, so they use sunlight. They are found in tropical lakes and seas up to the alpine and polar snows.

4) Producer Alga is A plant and produces food for other organisms.

5) Algae (Euglena) do photosynthesis as plants do. They also move around and eat, as do animals. But they are unicellular. In order to be classified as a plant or animal, an organism has to be multicellular, made of more than one cell. Since it is a unicellular organism with some plant and animal characteristics, it is called a protist. Plant cells have walls while algae does't have one, so it is a protozoan. Algae resemble the protozoa, so they are put into the Protist Kingdom.

Explanation:

I had the project.

Algae recreate a major part of the marine ecosystem because they exist as the decomposers current in the marine ecosystem; any harm to them could cause an inequality in the whole marine ecosystem.

What are golden-brown algae?

1)The Chrysophyceae, usually named chrysophytes, cryptomonads, golden-brown algae or golden algae exist as an extensive set of algae, seen mainly in freshwater.

2) It stood very easy to see the class because of the solid color base and because it only contained the diatoms. It did not contain multiple like the Green Algae and the Blue-Green Algae.

3) In fresh, saline, or salt water. They exist seen both in tropical lakes and seas and in the alpine and polar snows. They exist as unicellular or multicellular protist plant organisms, whose cells do not constitute tissues and absent flowers. They exist thought the first link in the food chain in the aquatic environment. They exist seen in fresh, brackish, or salt water. They exist as primary producers in the food chain, qualified of producing organic substances through photosynthesis, so they utilize sunlight.

4) Producer Alga exists in a plant and makes food for different organisms.

5) Algae (Euglena) accomplish photosynthesis as plants do. They even move about and eat, as do animals. But they exist unicellular. To be categorized as a plant or animal, an organism contains to be multicellular, made of better than one cell. Since it stands as a unicellular organism with some plant and animal elements, it exists named a protist. Plant cells contain walls while algae don't contain one, so it exists as a protozoan. Algae reach the protozoa, so they stand to put into the Protist Kingdom.

To learn more about algae refer to:

https://brainly.com/question/1747534

#SPJ2

Select the correct answer
Linda owns a great deal of land. She decides to rent her land to Andrea. However, she places certain restrictions on Andrea regarding the land use. Linda is using
which rights?
ОА. .
use rights
OB.
alienation rights
OC. management rights
OD. ownership rights

Help need answer ASAP !!

Answers

Management rights.

_______________________

What would happen to a plant if the amount of carbon dioxide in the air suddenly decreased?

Answers

The decreased carbon dioxide concentration inside the leaves and the increased leaf temperatures favour the wasteful process of photorespiration.

1) How many people is AIDS (the disease caused by HIV) responsible for killing?

Answers

Answer:

770000

Explanation:

Answer:

30 million people

Explanation:

Since the epidemic began, more than 60 million people have been infected with the virus and nearly 30 million people have died of HIV-related causes. Nearly 13,000 people with AIDS in the United States die each year. Engagement in care: AIDS-related deaths occur when people who are infected do not receive the testing, treatment and care they need.

Please help I will mark brainliest

Answers

Its b

Mark me brainliest

Explanation:

Answer:

B

Explanation:

because I already did that

Other Questions
After the government ordered the removal of all American Indians from Illinois, a. Black Hawk attacked a militia led by Isaiah Stillman. b. the Sauk fought until they ran out of supplies. c. Black Hawks followers killed three delegates of a peace convention sent under a white flag to Saukenuk. d. Sauk forces attacked U.S. troops as they attempted to retreat across a river. Read this excerpt from the Supreme Court's Hazelwood v. Kuhlmeier dissenting opinion: The state educator's undeniable, and undeniably vital, mandate to [teach] moral and political values is not a general warrant to act as "thought police" stifling discussion of all but state-approved topics. . . . Official censorship of student speech on the ground that it addresses "potentially sensitive topics" is . . . impermissible.4 The reasoning in this opinion is most similar to the reasoning in which other Supreme Court ruling? A. New Jersey v. T.L.O. B. Miranda v. Arizona C. Gideon v. Wainwright D. Tinker v. Des Moines pls help asap!! no trolls 1. Many plants can reproduce asexually. How is this an advantage for the plant? Why can it sometimes be a disadvantagefor the plant? Use details to support your answer. PLS ANSWER ASAP. ILL GIVE BRAINLIEST! Match the system for each of the following bodily organs.1.Nose a. Skeletal System2.Skull b. Circulatory System3.Kidneys c. Urinary System4.Veins d. Respiratory System 2 Which piece of evidence explains WHY the five themes of geography were created (A) In 1984. educators sought to better organize the teaching of geography in kindergarten through 12th grade classrooms. (B) The themes were created by the National Council for Geographic Education and the Association of American Geographers. (C) While these five themes have been since replaced by the National Geography Standards, they still provide an effective organization for the teaching of geography (D) Humans shape the landscape through their interaction with the land; this has both positive and negative effects on the environment Fill in the blank with the appropriate preposition.Paris est _____________ New York.a.) prs deb.) loin dec.) surd.) dans plz help timed MATHHHH 12 pointes Use the restriction enzyme EcoRi to cut DNAVictim DNA :GGAAG ATTCTACATTACTGACGGACGTGACGTGACCTTCTTAA GATGTAATGACTGCCTGCACTGACTNumber of restriction fragments ( pieces of DNA after digestion) :Size of restriction fragments ( count the number of bases on the top strand of each fragment , listed from largest to smallest ) :Suspect 1 DNA :GGAATTAAGCTTATTG AATTCTTATAG AATTCGGGGCCCAAGCTTATG AATTCAATT CCTTAATTCGAATAACTTAA GAATATCTTAA GCCCCGGGTTCGAATACTTAA GTTAANumber of restriction fragments ( pieces of DNA after digestion) :Size of restriction fragments ( count the number of bases on the top strand of each fragment , listed from largest to smallest ) :Suspect 2 DNA :CCATATAG AATTCAAGCTTAAG AATTCGGGGGAACGTTG AATTCAATTAATTGGGGGTATATCTTAA GTTCGAATTCTTAA GCCCCCTTGCAACTTAA GTTAATTAACCCNumber of restriction fragments ( pieces of DNA after digestion) :Size of restriction fragments ( count the number of bases on the top strand of each fragment , listed from largest to smallest ) :PLEASE HELPPP!!!!I WOULD APPRECIATE A LOT :) Select one of the readings in this unit, EXCEPT the Gettysburg Address, and in at least 150 words, discuss the historical context or cultural context the author demonstrates. i cant ever forgive the vampire diaries producers and directors for killing enzo but letting ratty matty the human LIVE?? like why did they keep matt alive when no one liked him but KILLED ENZOOOOOO How did Tisquantum help the Pilgrims????i will give brainliest and extra points Find the value of x in the image Read and choose the option with the regular verb in the imperfect tense.La princesa ley el libro.El rey no hablaba.La reina fue a la torre.El prncipe tom caf, Do you believe that parents should have all of the powers described in the Parents Constitution? Why or why not? answer the pic below How can you use density to separate mixtures like sand and small plastic pellets? What is the x- coordinate of the zero of the graphed line? How does the setting influence the theme of the story (pieces in the past ) story 15 points kareem drew a diagram to compare flatworms and segmented worms which label belongs in the area marked X?a. can reproduce sexuallyb. are always parasites c. are all sessiled. are covered in setaePLEASE HELP