A rental company charges $75 a day and 25 cents a mile for renting a truck. Michael rents a truck for 2 days, and his bill came to $243. How many miles did he drive?

Answers

Answer 1

The calculated total distance he drive is 372 miles

How many miles did he drive?

From the question, we have the following parameters that can be used in our computation:

Charges $75 a day25 cents a mile

So, we have

Total charges = 75 * days + 0.25 * miles

For 2 days and total ot 243. we have

75 * 2 + 0.25 * miles = 243

So, we have

miles = 372

Hence, the total distance he drive is 372 miles

Read more about linear relation at

https://brainly.com/question/30318449

#SPJ1


Related Questions

Solve the following equation algebraically: 3 x squared = 12 a. Plus-or-minus 3 b. Plus-or-minus 2 c. Plus-or-minus 3.5 d. Plus-or-minus 1.5 Please select the best answer from the choices provided A B C D

Answers

The correct option is b, the solutions of the quadratic equation are x = ±2

How to solve the quadratic equation?

Here we want to solve the following quadratic equation:

3x² = 12

To solve this, we need to isolate the variable, so let's start by dividing both sides by 3, then we will get:

x² = 12/3

x² = 4

Now we can apply the square root in both sides:

√x² = ±√4

x = ±2

These are the two solutions, then the correct option is b.

Learn more about quadratic equations at:

https://brainly.com/question/1214333

#SPJ1

Using the region names in the image below, select all regions that represent:

A ∩ B' ∩ C'

3 group Venn Diagram with Roman numeral labeled regions

A intersection not B intersection not C. Region I: Items only in group A, not in B or C. Region II: Items in A and B, but not C. Region III: Items only in B, not in A or C. Region IV: Items in A and C, but not B. Region V: Items in A, B, and C. Region VI: Items in B and C, but not A. Region VII: Items only in C, not in A or B. Region VIII: Items not in any of the groups.

Answers

Answer:

region I

Step-by-step explanation:

Based on the description given, the regions that represent A ∩ B' ∩ C' are:

Region I: Items only in group A, not in B or C. (A intersection not B intersection not C)

These regions fulfill the condition of being in group A (A) and not in group B (B') and not in group C (C') simultaneously.

you can support by rating brainly it's very much appreciated ✅

A clothing designer determines that the number of shirts she can sell is given by the formula S = −4x2 + 88x − 160, where x is the price of the shirts in dollars. At what price will the designer sell the maximum number of shirts? (1 point)
$2
$11
$20
$324

Answers

The price for which the designer will sell the maximum number of shirts is given as follows:

$11.

How to obtain the price?

As the amount sold is modeled by a concave down quadratic function, the price for which the designer will sell the maximum number of shirts is given by the x-coordinate of the vertex of the quadratic function.

The function in the context of this problem is given as follows:

S(x) = -4x² + 88x - 160.

The coefficients are given as follows:

a = -4, b = 88, c = -160.

Hence the x-coordinate of the vertex is obtained applying it's formula as follows:

x = -b/2a

x = -88/-8

x = 11. -> price of $11.

More can be learned about quadratic functions at https://brainly.com/question/1214333

#SPJ1

Someone help me please. The net signed area in the above graph can be written as……

Answers

The net signed area in the above graph can be written as

(x² + 10x - 2√2)dx.

How do we know?


The net signed area can be found by summing the areas of the three parts:

The three being

  A line with slope 2   A Vertical line   The area under the Parabolic curve

Hence the area

: 48 + 0 + 8 = 56

We now calculate values:

of c, d, a, and b:

c = 8 - (-2) = 10

d = 3 - 2 = 1

a = 2 + 8 = 10

b = -2√2

It is important to  note that since the area under the x-axis is negative hence the reason value of b is negative.

Learn more about Parabolic curve at:

https://brainly.com/question/29967594

#SPJ1

Determine whether each pair of triangles are similar. Justify your answer.

Answers

(1) The triangles ABC and DEF are not similar

(2) The triangles JKL and JMN are similar by the SAS similarity statement

(3) The triangles ABC and XYZ are similar

(4) The triangles PQR and TSR are similar

Identifying the similar triangles in the figure.

(1) Triangle ABC and DEF

The triangles in this figure are

ABC and DEF

These triangles are not similar is because:

The triangles do not have similar corresponding sides i.e. Ratio = 30/24 ≠ Ratio = 24/18

Evaluate

Ratio = 1.25 ≠ Ratio = 1.33

(2) Triangle JKL and JMN

The triangles in this figure are

JKL and JMN

"If two sides in one triangle are proportional to two sides in another triangle and the included angle in both are congruent, then the two triangles are similar"

This means that they are similar by the SAS similarity statement

(3) Triangle ABC and XYZ

The triangles in this figure are

ABC and XYZ

These triangles are similar is because:

The triangles have similar corresponding sides i.e. Ratio = 33/22 = 45/30 = 42/28

Evaluate

Ratio = 1.5

(4) Triangle PQR and TSR

The triangles in this figure are

PQR and TSR

These triangles are similar is because:

The triangles have similar corresponding sides i.e. Ratio = 10/5 = 9/4.5

Evaluate

Ratio = 2

Read mroe about similar triangles at

brainly.com/question/31898026

#SPJ1

6.334*104=6.334*10<sup>4</sup>=​

Answers

Answer:

what's that

Step-by-step explanation:

Find the value of x.

Answers

The calculated value of x in the circle is 40

How to find the value of x.

From the question, we have the following parameters that can be used in our computation:

The circle

From the circle, we have

Center = C

Also, we have

LIne CS bisects the chord RT

Using the above as a guide, we have the following:

RS = ST

Where

ST = 40 and RS = x

So, we have

x = 40

Hence, the value of x is 40

Read more about circle at

https://brainly.com/question/32192505

#SPJ1

You are washing cars over the summer. It costs you $3 to wash each car and a one-time cost of $35 for some supplies to market your car wash. You plan to charge $10 per wash. Write an equation and solve to determine the amount of cars you need to break even.

Answers

The amount of cars you need to break even is 5.

To determine the number of cars you need to break even, we can set up an equation where the revenue equals the total cost.

Let's denote the number of cars as x.

Revenue = Number of cars × Price per wash

= x × $10

Total cost = Cost per car × Number of cars + One-time cost

= $3x + $35

To break even, the revenue should be equal to the total cost:

x × $10 = $3x + $35

Now, let's solve this equation to find the value of x:

10x = 3x + 35

Subtract 3x from both sides:

10x - 3x = 3x + 35 - 3x

7x = 35

Divide both sides by 7:

x = 35 / 7

x = 5

For similar questions on amount

https://brainly.com/question/24644930

#SPJ11

How do I factor an expression

Answers

To factor an expression, you need to find the common factors of the terms in the expression. Then, group the terms with common factors together and factor out the common factor. This process can be repeated until the expression is completely factored.

Next
7
Post Test: Ratios and Proportional Relationships
Select the correct answer.
Area Buckeye Butterflies Monarch Butterflies
A
B
C
D
E
Rachel traveled to five different areas (A, B, C, D, and E) to study the number of buckeye butterflies and the number of monarch butterflies living
there. The table shows her findings.
OA
OB.
n. All rights reserved
15
27
12
24
44
areas A and B
areas C and E
Submit Test
16
36
25
32
33
The relationship between the number of buckeye butterflies and the number of monarch butterflies is not proportional across all areas. Which two
areas have buckeyes and monarchs in the same proportion?
Reader Tools

Answers

The two areas where buckeyes and monarchs have the same proportion are areas A and B.

How to determine the  two areas have buckeyes and monarchs in the same proportion

Based on the information given, we can determine the two areas where the number of buckeye butterflies and the number of monarch butterflies are in the same proportion.

Comparing the data in the table, we can see that the ratio of buckeye butterflies to monarch butterflies is consistent in areas A and B.

In area A, there are 15 buckeye butterflies and 27 monarch butterflies, which simplifies to a ratio of 5:9.

In area B, there are 27 buckeye butterflies and 48 monarch butterflies, which also simplifies to a ratio of 5:9.

Therefore, the two areas where buckeyes and monarchs have the same proportion are areas A and B.

learn more about proportion at https://brainly.com/question/1496357

#SPJ1

Solve |x-5| > -2. Write your solution in interval notation.

Answers

Answer:

(−∞,∞)

Step-by-step explanation:

Since |x−5| is always positive and −2 is negative, |x−5| is always greater than −2, so the inequality is always true.

All real numbers

So, the answer is (−∞,∞)

IF AB measures 115° what is the length of the radius of the circle to the mearest hundredth

Answers

The length of the radius of the given circle whose central angle has been given would be = 7cm.

How to calculate the radius of a circle when a central angle is given?

To calculate the radius of the given circle, the formula that should be used will be given below as follows:

Length of arc = 2πr×∅/360

Length of arc = 14cm

∅ = 115°

14 = 2×3.14×r ×115/360

make R the subject of formula;

r = 14/2.006

= 6.9

= 7cm

Learn more about area here:

https://brainly.com/question/28470545

#SPJ1

What is the measure of angle B? Do not include a degree sign.

Answers

The measure of angle B is given as follows:

m < B = 60º.

What are the trigonometric ratios?

The three trigonometric ratios are the sine, the cosine and the tangent, and they are obtained according to the rules presented as follows:

Sine of angle = opposite side/hypotenuse.Cosine of angle = adjacent side/hypotenuse.Tangent of angle = opposite side/adjacent side = sine/cosine.

For the angle B, we have that:

x is the hypotenuse.x/2 is the adjacent side.

Hence we apply the cosine ratio to obtain the measure of angle B as follows:

cos(B) = (x/2)/x

cos(B) = 1/2

B = arccos(1/2)

B = 60º.

Missing Information

The triangle is given by the image presented at the end of the answer.

Learn more about trigonometric ratios at brainly.com/question/24349828

#SPJ1

please help! thank uu ~ :)

Answers

Answer:

The word or phrase that describes the probability that Ariana will win the raffle if she buys 50 tickets is "likely." Therefore, option (d) is the correct choice.

Since there are 100 tickets in total and Ariana buys 50 of them, her chance of winning the raffle is 50/100 or 1/2, which is equal to 0.5 or 50%. This means that it is more likely than not that she will win the raffle, but it is not guaranteed, as there is still a 50% chance that someone else will win the prize.

What the dude on top said

Find the cross product of v = (1, 0, 1) and u = (2, 6, 4).

Answers

Answer:

The cross product of v x u is (-6, 2, 6).

Step-by-step explanation:

The two vectors are v = ( 1, 0, 1)  and u = (2, 6, 4).The formula for vector cross product v x u.v x u = ( v₂u₃ - v₃u₂, v₃u₁ - v₁u₃, v₁u₂ - v₂u₁).

so,

   v x u = ( 0 x 4 - 1 x 6 , 1  x 2 - 1 x 4, 1 x 6 - 0 x 2)

   v x u = ( 0 - 6, 2 -4, 6 - 0)

   v x u = ( -6, 2, 6)

Therefore the cross product of u, v is ( -6, 2, 6).

To know more about the cross product,

brainly.com/question/17553347

brainly.com/question/14308624

Directions: Use the given rules to complete the table for each sequence and
create the ordered pairs. Plot the ordered pairs on the coordinate plane and
connect them in order. Then, write a short description of how the corresponding
terms are related.
1. Rule 1: 2y, where y is equal to 5, 6, 7, 8, 9.
Rule 2: Add 10, then subtract 9, starting from 5.
Sequence 1
Sequence 2
Ordered Pair
What is the relationship between the
corresponding terms in the two sequences?

Answers

Here are the completed tables for each sequence:

Sequence 1 Sequence 2 Ordered Pair

5                    15                   (5, 15)

6                        14               (6, 14)

7                        13             (7, 13)

8                    12                 (8, 12)

9                   11                (9, 11)

How to explain the sequence

The corresponding terms in the two sequences are related by a linear function. The slope of the line is 1, which means that for every 1 increase in y, there is a 1 increase in x.

The corresponding terms in the two sequences are related by a linear function. The slope of the line is 1, which means that for every 1 increase in y, there is a 1 increase in x. This means that the two sequences are increasing at the same rate.

Learn more about Sequence on

https://brainly.com/question/6561461

#SPJ1

6. Suppose this preference schedule gives the results of an election among three candidates: Abe
(A), Benny (B), and Chloe (C). Which candidate, if any, wins using the plurality method?
number of votes 20 19 5
A|B|C
B CB
1st
2nd
3rd
CAA
O Abe (A)
OBenny (B)
O Chloe (C)
ONo candidate wins using the plurality method.
(1

Answers

Benny (B) would win the election using the plurality method.

To determine the winner using the plurality method, we need to calculate the total number of first-place votes for each candidate and see which candidate receives the most votes.

According to the given preference schedule, the number of first-place votes for each candidate is as follows:

Abe (A): 1st - 20 votes, 3rd - 2 votes (from the 2nd preference of voter 1)

Benny (B): 1st - 19 votes, 2nd - 5 votes

Chloe (C): 1st - 5 votes, 2nd - 19 votes, 3rd - 3 votes (from the 1st and 2nd preferences of voter 1)

Now, let's calculate the total number of first-place votes for each candidate:

Abe (A): 20 + 2 = 22 votes

Benny (B): 19 + 5 = 24 votes

Chloe (C): 5 + 0 + 3 = 8 votes

Based on the plurality method, the candidate with the highest number of first-place votes wins.

In this case, Benny (B) received the most first-place votes with a total of 24 votes.

Therefore, Benny (B) would win the election using the plurality method.

Learn more about plurality method click;

https://brainly.com/question/32003097

#SPJ1

A survey asked 1,200 students which movie genre was their favorite. The results of the survey are shown in the circle graph. How many students chose comedy movies than drama movies

Answers

The number of students who chose comedy movies more than drama movies were 60 students

How to find the students ?

First, find the number of students who chose comedy :

= 20 % x 1, 200 students

= 0. 20 x 1, 200

= 240 students

Then find the students who chose drama movies ;

= 15 % x 1, 200

= 0. 15 x 1, 200

= 180 students

The number who chose comedy more :

= 240 - 180 students

= 60 students

In conclusion, the number of students who chose comedy more than those who chose drama was 60 students.

Find out more on movie genre favorites at https://brainly.com/question/17200322

#SPJ1

I WILL GIVE 5 STARS, BRAINLIEST AND A HEART TO WHOEVER HELPS ME
IM BEGGING YOU PLEASE
(Please answer all the questions)

Answers

Answer:

1. Group B

2. Group A

3. The median.

Answer:

1. Group B has the lowest age range out of both groups. Group B has at least 18 students under 16 and Group A has ages from 5 through 30.

2. Group A has more of a variability of ages because it is more scrambled than Group B. Group B had more students that had ages that were all close to each other.

3. I think it's best to use the median because it measures the age above which is found. If we use the mean, it will only be calculated by adding all numbers together and then dividing the sum of the numbers by the number of numbers.

Solve.
A. A furniture truck is carrying five couches. Each couch weighs 250 pounds. How many
more couches are needed to increase the truckload to one ton?

Answers

Answer:

three more couches are needed to increase the truckload to one ton.

Step-by-step explanation:

First, let's calculate the weight of the five couches:

5 couches * 250 pounds/couch = 1250 poundsSince one ton is equal to 2000 pounds, we can subtract the weight of the couches from one ton to find out how much additional weight is needed:

2000 pounds - 1250 pounds = 750 poundsEach couch weighs 250 pounds, so we can divide the additional weight needed by the weight of each couch to determine how many more couches are needed:

750 pounds / 250 pounds/couch = 3 couches Therefore, three more couches are needed to increase the truckload to one ton.

7 more couches ,
2,000 ponds in a ton
1 couch is 250
2,000 divided by 250 is 8
8 minus the 1 couch you already have
is 7

Prove the following?

Answers

The proof that there is no set X such that P(X) ⊂ X is below

How to prove the set statement

From the question, we have the following parameters that can be used in our computation:

There is no set X such that P(X) ⊂ X

The above means that

There is no set X such that the power set of X is a subset of set X

By definition, the power set is the set of all subsets of the a Set which includes the set itself and the null or empty set

Using the above as a guide, we have the following:

We assume there is a set XSuch that Y is any element in the X.

Because Y is in X, then by definition of the power set P(X), Y is a subset of X.

However, this is a contradiction because it is not possible for a set to be a proper subset of itself.

Read more about sets at

https://brainly.com/question/24713052

#SPJ1

A rocket is launched upward with an initial velocity of 1960 m/s. After how many minutes does it fall to the ground? (in meter the formula h=rt-4.9t^2 is used

Answers

Answer:

3.33 minutes

Step-by-step explanation:

h = rt - 4.9t^2

In this case, the rocket is launched upward, so the initial velocity (r) is positive 1960 m/s. The rocket will fall to the ground when the height (h) becomes zero.

0 = 1960t - 4.9t^2

To solve this quadratic equation, we can set it equal to zero and use the quadratic formula:

4.9t^2 - 1960t = 0

Using the quadratic formula:

t = (-b ± √(b^2 - 4ac)) / (2a)

Here, a = 4.9, b = -1960, and c = 0. Plugging in these values:

t = (-(-1960) ± √((-1960)^2 - 4 * 4.9 * 0)) / (2 * 4.9)

Simplifying further:

t = (1960 ± √(3841600)) / 9.8

t = (1960 ± 1960) / 9.8

t = 1960 / 9.8 = 200

So, the rocket will fall to the ground after 200 seconds. To convert this to minutes, divide by 60:

200 seconds / 60 = 3.33 minutes (approximately)

Therefore, the rocket will fall to the ground after approximately 3.33 minutes.

find the first four iterates of the function f(z)=z^2+2+2t with an initial value of z0=-1+2t

Answers

The four iterates of the function f(z) = z² + 2 + 2t are:

f(z0) = 4t² - 2t + 3f(f(z0)) = 16t⁴ - 16t² + 40t² - 12t + 14f(f(f(z0))) = 256t⁸ - 512t⁷ + 768t⁶ - 768t⁵ + 560t⁴ - 288t³ + 88t² - 16t + 18f(f(f(f(z0)))) = 65536t¹⁶ - 262144t¹⁵ + 557056t¹⁴ - 787456t¹³ + 801216t¹² - 623616t¹¹ + 378752t¹⁰ - 185536t⁹ + 72432t⁸ - 21856t⁷ + 4916t⁶ - 800t⁵ + 84t⁴ - 4t³ + 2t² + 2t + 2

To find the first four iterates of the function f(z) = z² + 2 + 2t with an initial value of z0 = -1 + 2t, we will substitute the initial value into the function repeatedly.

Substitute z0 into the function:

f(z0) = (-1 + 2t)^2 + 2 + 2t

Simplify the expression:

f(z0) = 1 - 4t + 4t² + 2 + 2t

f(z0) = 4t² - 2t + 3

This is the first iterate of the function.

Substitute the first iterate into the function:

f(f(z0)) = f(4t² - 2t + 3)

Simplify the expression:

f(f(z0)) = (4t² - 2t + 3)² + 2 + 2t

f(f(z0)) = 16t⁴ - 16t² + 40t² - 12t + 14

This is the second iterate of the function.

Repeat the process for the third and fourth iterates:

f(f(f(z0))) = (16t⁴ - 16t³ + 40t² - 12t + 14)² + 2 + 2t

f(f(f(z0))) = 256t⁸ - 512t⁷ + 768t⁶ - 768t⁵ + 560t⁴ - 288t³ + 88t² - 16t + 18

and, f(f(f(f(z0)))) = (256t⁸ - 512t⁷ + 768t⁶ - 768t⁵ + 560t⁴ - 288t³ + 88t² - 16t + 18)² + 2 + 2t

f(f(f(f(z0)))) = 65536t¹⁶ - 262144t¹⁵ + 557056t¹⁴ - 787456t¹³ + 801216t¹² - 623616t¹¹ + 378752t¹⁰ - 185536t⁹ + 72432t⁸ - 21856t⁷ + 4916t⁶ - 800t⁵ + 84t⁴ - 4t³ + 2t² + 2t + 2

These are the first four iterates of the function f(z) = z² + 2 + 2t with the initial value of z0 = -1 + 2t.

Learn more about Iteration here:

https://brainly.com/question/31197563

#SPJ1

13/ 14 by 26 /49 simplify ​

Answers

Hello!

13/14 x 26/49

= 13x26/14x49

= 338/686

= 169/343

Select the correct answer.
What is the equation of the parabola shown in the graph?

Answers

Answer:

c) y=-x^2/4 - 2x - 7

Step-by-step explanation:

100 Points! Multiple choice algebra question. Photo attached. Thank you!

Answers

Hello !

1. Explanation

student's number / total students

9)

288/360 = 0,8

⇒ it's C

10)

90/360 = 0,25

⇒ it's B

Have a good day!

In a college, some courses contribute more towards an overall GPA than other courses. For example, a science class is worth 4 points; mathematics is worth 3 points; history is worth 2 points; and English is worth 3 points. The values of the grade letters are as follows, A= 4, B=3, C=2, D=1, F=0. What is the GPA of a student who made a “C” in Trigonometry, a “B” in American History, an “A” in Botany, and a “B” in Microbiology?

Answers

The GPA of the student who earned a "C" in Trigonometry, a "B" in American History, an "A" in Botany, and a "B" in Microbiology is 3.

How to find the values

To calculate the GPA, we need to assign point values to each grade and then calculate the weighted average.

Given:

Trigonometry (C) = 2 points

American History (B) = 3 points

Botany (A) = 4 points

Microbiology (B) = 3 points

To calculate the GPA, we'll sum the total points earned and divide by the total number of courses:

Total Points = 2 + 3 + 4 + 3 = 12

Total Courses = 4

GPA = Total Points / Total Courses = 12 / 4 = 3

Therefore, the GPA of the student who earned a "C" in Trigonometry, a "B" in American History, an "A" in Botany, and a "B" in Microbiology is 3.

learn more about word problems at https://brainly.com/question/21405634

#SPJ1

A square has the perimeter of 88cm, find the area of the square​

Answers

Answer: 484cm

Step-by-step explanation:

Every side of a square has equal lengths.

88/4 = 22

A = LW

   = 22 x 22

   = 484cm

Which sun difference is modeled by the algebra tiles?

Answers

The sum or difference that is modeled by the algebra tiles is option D. (-x² + 2x + 3) + (-x² - 2x - 1) = -2x² + 2

What are algebra tile?

Algebra tiles are physical manipulatives used to teach and visualize algebraic concepts. They consist of small, square-shaped tiles that represent different algebraic expressions or values. The tiles come in different colors to represent positive and negative numbers, variables, and constant terms.

Here are the common types of algebra tiles:

1. Unit Tiles: These tiles represent the number one. They are typically square-shaped and are often the base tiles used to build other expressions.

2. Variable Tiles: These tiles represent variables or unknowns. They are usually rectangular in shape and may have different colors to distinguish between different variables.

3. Positive and Negative Tiles: Tiles of different colors, usually red and blue, are used to represent positive and negative values. These tiles can be combined or separated to illustrate operations like addition and subtraction.

4. Area/Rectangle Tiles: These tiles are used to represent quadratic expressions or algebraic expressions involving products or factoring. They are rectangular in shape and can be arranged to model multiplication, factoring, or area representation of polynomials.

Therefore, the type of the algebra tiles in the given question is that of Positive and Negative tiles.

learn more about algebra tiles: https://brainly.com/question/29535773

#SPJ1

1. A student determines that one solution to a system of quadratic-quadratic equations is (2.1).
Determine the value of n if the equations are:
4x²-my=10
mx² +ny=20

Answers

N is rounded to two decimal places so n=7.052/m = 7.052/2.8 2.52.

Take the equation set into consideration:

4x² - my = 10  --- (1)

mx² + ny = 20  --- (2)

When x = 2.1, one of the system's solutions is provided by the problem. Using this knowledge, we can change x in both equations to be 2.1. It results in:

4(2.1)2 my = 10 ---> 17.64 my = 10 ---> my = 7.64 --- (3) m(2.1)² + ny = 20 ---> 4.41m + ny = 20 --- (4)

Ascertaining n's value is necessary.

My = 7.64, as determined by equation (3).

With this number as a replacement in equation (4), we obtain:

4.41m + 7.64 = 20

(Rounded to one decimal place) 4.41m = 12.36 m = 2.8

This value of m is substituted in equation (4) to yield the following results: 2.8(2.1)2 + ny = 20, 12.948 + ny = 20.

For such more questions on decimal

https://brainly.com/question/28393353

#SPJ8

Other Questions
HELP NEED IT TODAY ASAPPolygon ABCD is drawn with vertices A(4, 4), B(4, 6), C(1, 6), D(1, 4). Determine the image coordinates of B if the preimage is reflected across y = 3. B(4, 6) B(4, 12) B(1, 3) B(10, 6) avoiding plagiarism, citing sources, and maintaining academic integrity: for what reason might a company acquire treasury stock? Given the vectors A=i+2j+3k, B= +2j+k and C=4ij, determine x such that A+XB is perpendicular to C. (5 marks) how can someone under 18 open their own brokerage account? The following DNA sequences were used to generate a contig from a genome sequencing project. ttcagattttccccg gctaaagctccgaa gccattaacgcc tttagcatactacggcgtta aaaaccggggaaaat tccgaatcggtcattcaga How long is the fully assembled contig? match the parametric equations with the correct graph. x = cos(8t), y = sin(8t), z = e0.8t, t 0 According to this passage, why is Cassius so frustrated with Caesar?Cassius believes Caesar to be a god.Cassius is angry because Caesar has a bad temper and is rude to people.Cassius is concerned that the strain of ruling will put unnecessary stress on Caesars overall health.Cassius cannot believe that a man with all of Caesars weaknesses can become so powerful. 2. what are some similarities and differences between skimming pricing, prestige pricing, and above-market pricing? Glycolysis depends on a continuous supply of: a. NADP b. pyruvate c. NAD+ d. NADH e. H2O Douglas Diners Inc. Charges an initial franchise fee of $90,000 broken down as follows: Rights to trade name, market area, and proprietary know-how$40,000 Training services11,500 Equipment (cost of $10,800)38,500 Total initial franchise fee$90,000 Upon signing of the agreement, a payment of $40,000 is due. Thereafter, two annual payments of $30,000 are required. The credit rating of the franchisee is such that it would have to pay interest of 8% to borrow money. The franchise agreement is signed on August 1, 2014, and the franchise commences operation on November 1, 2014. Assuming that no future services are required by the franchisor once the franchise begins operations, the entry on November 1, 2014 would include a. A credit to Unearned Franchise Revenue for $40,000. b. A credit to Service Revenue for $11,500. c. A credit to Sales Revenue for $38,500. d. A debit to Unearned Franchise Revenue for $40,000 .1. Discovered the conscious and unconscious part of the mind2. His studies were the basis for psychology and psychiatry in what identification procedure are suspects entitled to legal representation? smokeless tobacco has been regulated in the sport of Which of the following are good seal rocks within an oil field?A. fractured graniteB. fine grained limestoneC. shaleD. sandstone left join gets all records from the left table but if you have selected some columns from the right table and if no matches are found in the right table, these columns will contain null. T/F fill in the blank. 10 po McKinney Farms issued 2,000 shares of $1 par value stock for $10 a share. The journal entry to record the transaction includes a _____ to Common Stock A Debit of $18,000 B Credit of $18,000 C Debit of $2,000 D Credit of $2,000 ruler guides display as ________ on the vertical and horizontal rulers. express the product of 4.0x10^-2m and 8.1 Activity 4.2 I Can Determine the Different Characteristics of Summary of FindingsConclusions and Recommendations"